"Windows of Grace" have a narrow span... She and I were there, on the 16th of February, 2020!!!, at the Lakewood Church, just before the globalist hell broke loose..., that window I expected to still be open, I think that has just been slammed right on my face right now. But I believe GOD will open an above and beyond my wildest imagination ONE!!! That is in HIS NATURE!!! Thank YOU God for Your wisdom above and beyond my own limitations, sins and mistakes!!!:
The bitches just removed a Christian channel that was reporting what was going on without the bias of the sold-out prostitute MSM and its despicable whore daughter the Social Media with whom we all interact... https://archive.vn/ovUE8, https://archive.vn/8UPld, https://archive.vn/37tFq, https://archive.vn/a9AAk, https://archive.vn/UWzWz, https://archive.vn/FKA9F, https://archive.vn/ls2Vq, https://archive.vn/dyXHR, https://archive.vn/v4BoN; then, 26 pages in a loop of people committing an "Unlawful Entry" (funny that the real Antifa / BLM and other more obscure characters are not seen anywhere here, i.e., Sullivan, the one with the "all-seeing-eye" tattoo over his hand that was precisely by the side of the shooting victim): https://web.archive.org/web/20210107172705/https://dam.tmz.com/document/63/o/2021/01/07/6343de0c1d1f41a59f45e7722f409a12.pdf
Updated Jan 10, 2021, 4:27 PM
https://youtu.be/mKdcPfJYA2U... In the fading light, hearts collide; Shadows dance in the distance; Something just ain't right... There's a thousand miles between you and I; Oh, my, my, my; Just a thousand miles between me and paradise... When the dark has gone, the morning's won; We're gonna feel something different... Learn to be brave, see the other side; Won't you lead me there? Have no fear; Close your eyes, find paradise...
Updated Jan 6, 2021, 2:03 PM
Fernando Castro-Chavez
Look at the whole event of the meeting to Save America and you will see the good people that follows light orderly, quietly and happily gathering together by the millions. So, those animal beasts in viking attire, bearded crazy violent savages letting on purpose inside the Capitol are a completely different crew coming from a completely different place, impersonators that sooner or later will be accountable for what they have done. It starts with prayer, with godly reminders, with pastors and preachers:
Updated Jan 8, 2021, 6:56 PM
Fernando Castro-Chavez updated his status.
Another post removed by "the CCP controlled" (another way to call the despicable Bankster Clan (Rothsch) that aims to control the world):
Fernando Castro-Chavez updated his status.
Updated Jan 6, 2021, 8:48 AM
BIGGER THINGS COMING IN DISREGARD OF THEIR DESPICABLE INTIMIDATION TACTICS: "If you see something say something, record it, publish it": Heads up: Pallets of cement blocks placed in D.C. Josh Hawley has been already threatened by the Deep State Central Banksters, by Soros and by the DaemonKrafts and their Antifa, BLM paid scum: Tonight while I was in Missouri, Antifa scumbags came to our place in DC and threatened my wife and newborn daughter, who can’t travel. They screamed threats, vandalized, and tried to pound open our door. Let me be clear: My family & I will not be intimidated by leftwing violence: https://archive.vn/adzmG, https://twitter.com/tr00p3RR/status/1346314780135587842 (https://archive.vn/mw5JG); #DC, Antifa threatened Senator Hawley’s wife and newborn daughter while he was away in Missouri. They screamed threats, vandalized, and tried to pound open the door. (My Note: Please Our President Trump, do NOT let that Soros paid anarchy to continue!!!), Gral. Flynn wrote: "EVERY MEMBER OF CONGRESS SHOULD IMMEDIATELY CONDEMN THIS! And Melissa Tate wrote: "Antifa is the terrorist arm of Democrats Party. The media, which is the propaganda arm of the Democrat Party, will not even reports on these acts. We the people are not going to be intimidated into giving up our freedom to these ravenous s wolves. They can’t stop us!", Senator @HawleyMO you & your family have millions and millions of supporters. #WeThePeople do not accept this behavior in our election process to choose who runs the greatest country in world history. #GodBlessAmerica"; V-Shaped Recovery: Manufacturing Defies Expectations as Rebound Continues Despite Covid Surge: The strength of U.S. manufacturing appears to have been largely unshaken despite the recent surge in coronavirus infections. The Institute for Supply Management said its manufacturing index rose to a reading of 60.7 in December from 57.5 in the prior month, marking the highest level since 2018. Economists had expected a small decline in the index, which is based on surveys of manufacturing sector senior executives. New orders matched their pandemic high at a reading of 67.9, up from 65.1, signaling that the sector has been more resilient in the face of the pandemic’s winter surge than many other parts of the economy. President Donald Trump made strengthening U.S. manufacturing a key part of his campaign in 2016 and his administration deployed many policies to bolster the sector.https://www.breitbart.com/economy/2021/01/05/v-shaped-recovery-manufacturing-defies-expectations-as-rebound-continues-despite-covid-surge/?utm_source=feedburner&utm_medium=feed&utm_campaign=Feed:+breitbart+(Breitbart+News), https://archive.vn/gMZkJ; "Trump Renominates Judy Shelton For Federal Reserve Board After Failed Confirmation. President Donald Trump again nominated Judy Shelton to the Federal Reserve’s Board of Governors in a last-minute attempt to fill its only vacant seat... Trump renewed Shelton’s nomination Sunday, the first day of the 117th Congress. She was originally nominated in 2019, but failed to be confirmed by the Senate in December. Her failed nomination came after retiring Tennessee Sen. Lamar Alexander announced his opposition to her confirmation and Sens. Chuck Grassley and Rick Scott were quarantining after being exposed to the coronavirus. Alexander has since been succeeded by Sen. Bill Haggerty, meaning that if Georgia Republican Sens. David Perdue and Kelly Loeffler win their runoffs, Shelton could have enough support to be confirmed..."; James O’Keefe wrote: "BREAKING: @CentralOAC has now DELETED their Twitter account following @Project_Veritas #GAVoterFraud release tonight exposing their illegal registering of thousands of Atlanta homeless to vote at the same address! What are they trying to hide? We already got it all on tape! pic.twitter.com/YncsG4qYdc, #GAVoterFraud pic.twitter.com/5j2uJ2XV4T, https://twitter.com/JamesOKeefeIII/status/1346303974203338752"; Paul Sperry wrote: "DEVELOPING: While the mastermind behind Biden’s and the DNC’s multistate mass mail-in voting scam is Stacey Abrams, records show the financial catalyst behind her well-funded operation is leftwing globalist George Soros & his son Alexander, who have donated millions to her cause"; Trump Lawyer Jenna Ellis Suggests Pence Could Defer Certifying Election, Send Requests to State Legislatures (VIDEO). Trump’s legal team has argued to state legislatures in these contested states that they have plenary power Under Article II, Section 1 Clause 2 of the Constitution to choose which electors are sent to Congress. The President over the weekend spoke to 300 legislators urging them to decertify the ‘unlawful’ election results for Joe Biden": https://archive.vn/ouzzv; Trump wrote: “You watch what happens over the next couple of weeks. You watch what’s going to come out. Watch what’s going to be revealed. You watch.” –POTUS pic.twitter.com/HzLBHUny5N", "The Vice President has the power to reject fraudulently chosen electors" and also: "Pleased to announce that @KLoeffler & @sendavidperdue have just joined our great #StopTheSteal group of Senators. They will fight the ridiculous Electoral College Certification of Biden. How do you certify numbers that have now proven to be wrong and, in many cases, fraudulent!"; Jim Jordan wrote: "Who makes election law: -State legislatures, Who doesn’t: -Liberal judges (I call them "Libertine"), -Secretaries of State, -County clerks (and I add, the stupid MSM and its daughter SM). It’s about the Constitution"!!!; Georgia State Senators Call on Pence to Delay Jan. 6 Electoral Vote: Republican state senators in Georgia started a push on Monday to delay the Jan. 6 counting of electoral votes. At least a dozen have signed a letter directed to Vice President Mike Pence asking him to officially delay the count—and the number is still growing.Source: theepochtimes.com, Dave comments: "There are also other senators from Pennsylvania, Wisconsin, and Arizona also wrote letters sent to the Vice President, [telling him] we want the vice president to at least delay it 10 to 12 days.” Jan 20th is date that matters Constitutionally: “Terms of the President and Vice President shall end at noon on the 20th day of January” Will this depend on the Senators on how it is going in the Senate?, How do you return the power to people?, How do you introduce the constitution? People are now hearing it on the MSM, people want to know what it says and how it works: https://archive.vn/h4439; Sidney Powell wrote: "...One citizen—one vote is imperative to the Rule of Law#DefendingTheRepublic#Pence has the authority to recess until machine fraud fully investigated & and actual ballots counted https://t.co/3ynwbq4HyO pic.twitter.com/Hxod4eKzeB"; “It’s now inside the gates, CCP is here in America” —Pompeo; Those who went against Trump will pay in the end, he will unseat each and everyone one of them in the next 4 years, how by telling the people and the people will vote them out. 1) Pence rejects electors from fraud states; sent back to state legislatures, 2) Biden doesn’t have 270 on 1/6, 3) State legislatures convene hearings, 4) Trump drops powerful new evidence, 5) Fraud states decertify, 6) 12A House Vote – 1 per state delegation, 7) Trump 2nd term; President Trump Replaces US Attorney in Atlanta with Another Trump-Appointed Prosecutor After Byung “BJ” Pak Abruptly Resigns: President Trump wasted no time replacing the top federal prosecutor in Atlanta with another Trump-appointed prosecutor. US Attorney in Atlanta Byung “BJ” Pak abruptly resigned on Monday and it is unclear if it was voluntary or if he was asked to leave his post. President Trump bypassed the Assistant US Attorney who was supposed to take Pak’s place and instead chose to replace the outgoing US Attorney with a former state prosecutor. Bobby L. Christine was named Acting U.S. Attorney for the Northern District of Georgia “by written order of the President": https://archive.vn/XeETh, https://archive.vn/WtCPJ; Lin Wood to Paedo Supreme Court John Roberts: "Note to Chief Justice John Roberts: Many are interested in docket entry numbers 41, 46, 57, 58, & 60 in Case No. 15-545 below. As head of highest court obligated to rule on election fraud cases, would you inform public of contents of these entries & then resign? Or vice versa? pic.twitter.com/GlhwlJJvJv", https://twitter.com/LLinWood/status/1346325897306120192/photo/1; Richard Grenell wrote: "The political objective of bringing our troops home and not starting any new wars was made clear to the American people in 2016. The DC crowd & Pentagon elites want more wars." The Daemocratic false flag: "False Flags: FDA Admits PCR Tests Give False Results, Prepares Ground For Biden To “Crush” Casedemic. The FDA today joined The WHO and Dr.Fauci in admitting there is a notable risk of false results from the standard PCR-Test used to define whether an individual is a COVID “Case” or not. This matters significantly as it fits perfectly with the ‘fake rescue’ plan we have previously described would occur once the Biden admin took office. But before we get to that ‘conspiracy’, we need a little background on how the world got here… As a reminder, “cycle thresholds” (Ct) are the level at which widely used polymerase chain reaction (PCR) test can detect a sample of the COVID-19 virus. The higher the number of cycles, the lower the amount of viral load in the sample; the lower the cycles, the more prevalent the virus was in the original sample. So, in summary, with regard to our current “casedemic”, positive tests as they are counted today do not indicate a “case” of anything. They indicate that viral RNA was found in a nasal swab. not sufficient replication of the virus to make anyone else sick. the media reports… and is used to fearmonger mask mandates and lockdowns nationwide... Why is this being brought up now: The Fake "Rescue" by the Cheaters: Biden will issue national standards, like the plexiglass barriers in restaurants he spoke about during the debate, and pressure governors to implement mask mandates using the federal government’s financial leverage (NOTE: his 100-day mask-wearing ‘mandate’ is already in play). Some hack at the CDC or FDA will issue new guidance lowering the Ct the labs use, and cases will magically start to fall. The change will only eliminate false positives, but most Americans won’t know that"; Meanwhile, the Globalists keep on pushing China as their NWO leader: "A shift to a more Chinese-style global industry promises to be excellent news for consumers."Prices would fall while choice and innovation would probably grow: Why retailers everywhere should look to China: Yet as we explain this week (see article) it is in China, not the West, where the future of e-commerce is being staked out. Its market is far bigger and more creative, with tech firms blending e-commerce, social media and razzmatazz to become online-shopping emporia for 850m digital consumers. And China is also at the frontier of regulation, with the news on December 24th that trustbusters were investigating Alibaba, co-founded by Jack Ma, China’s most celebrated tycoon, and until a few weeks ago its most valuable listed firm: https://archive.vn/09q39" Sources: https://archive.vn/1k4T9; Videos, financial: https://tinyurl.com/JudyS-CrashFed, geopolitical: https://tinyurl.com/big2Brevealed |
BIGGER THINGS COMING IN DISREGARD OF THEIR DESPICABLE INTIMIDATION TACTICS: "If you see something say something, record it, publish it": Heads up: Pallets of cement blocks placed in D.C. Josh Hawley has been already threatened by the Deep State Central Banksters, by Soros and by the DaemonKrafts and their Antifa, BLM paid scum: Tonight while I was in Missouri, Antifa scumbags came to our place in DC and threatened my wife and newborn daughter, who can’t travel. They screamed threats, vandalized, and tried to pound open our door. Let me be clear: My family & I will not be intimidated by leftwing violence: https://archive.vn/adzmG, https://twitter.com/tr00p3RR/status/1346314780135587842 (https://archive.vn/mw5JG); #DC, Antifa threatened Senator Hawley’s wife and newborn daughter while he was away in Missouri. They screamed threats, vandalized, and tried to pound open the door. (My Note: Please Our President Trump, do NOT let that Soros paid anarchy to continue!!!), Gral. Flynn wrote: "EVERY MEMBER OF CONGRESS SHOULD IMMEDIATELY CONDEMN THIS! And Melissa Tate wrote: "Antifa is the terrorist arm of Democrats Party. The media, which is the propaganda arm of the Democrat Party, will not even reports on these acts. We the people are not going to be intimidated into giving up our freedom to these ravenous s wolves. They can’t stop us!", Senator @HawleyMO you & your family have millions and millions of supporters. #WeThePeople do not accept this behavior in our election process to choose who runs the greatest country in world history. #GodBlessAmerica"; V-Shaped Recovery: Manufacturing Defies Expectations as Rebound Continues Despite Covid Surge: The strength of U.S. manufacturing appears to have been largely unshaken despite the recent surge in coronavirus infections. The Institute for Supply Management said its manufacturing index rose to a reading of 60.7 in December from 57.5 in the prior month, marking the highest level since 2018. Economists had expected a small decline in the index, which is based on surveys of manufacturing sector senior executives. New orders matched their pandemic high at a reading of 67.9, up from 65.1, signaling that the sector has been more resilient in the face of the pandemic’s winter surge than many other parts of the economy. President Donald Trump made strengthening U.S. manufacturing a key part of his campaign in 2016 and his administration deployed many policies to bolster the sector.https://www.breitbart.com/economy/2021/01/05/v-shaped-recovery-manufacturing-defies-expectations-as-rebound-continues-despite-covid-surge/?utm_source=feedburner&utm_medium=feed&utm_campaign=Feed%3A+breitbart+%28Breitbart+News%29, https://archive.vn/gMZkJ; "Trump Renominates Judy Shelton For Federal Reserve Board After Failed Confirmation. President Donald Trump again nominated Judy Shelton to the Federal Reserve’s Board of Governors in a last-minute attempt to fill its only vacant seat... Trump renewed Shelton’s nomination Sunday, the first day of the 117th Congress. She was originally nominated in 2019, but failed to be confirmed by the Senate in December. Her failed nomination came after retiring Tennessee Sen. Lamar Alexander announced his opposition to her confirmation and Sens. Chuck Grassley and Rick Scott were quarantining after being exposed to the coronavirus. Alexander has since been succeeded by Sen. Bill Haggerty, meaning that if Georgia Republican Sens. David Perdue and Kelly Loeffler win their runoffs, Shelton could have enough support to be confirmed..."; James O’Keefe wrote: "BREAKING: @CentralOAC has now DELETED their Twitter account following @Project_Veritas #GAVoterFraud release tonight exposing their illegal registering of thousands of Atlanta homeless to vote at the same address! What are they trying to hide? We already got it all on tape! pic.twitter.com/YncsG4qYdc, #GAVoterFraud pic.twitter.com/5j2uJ2XV4T, https://twitter.com/JamesOKeefeIII/status/1346303974203338752"; Paul Sperry wrote: "DEVELOPING: While the mastermind behind Biden’s and the DNC’s multistate mass mail-in voting scam is Stacey Abrams, records show the financial catalyst behind her well-funded operation is leftwing globalist George Soros & his son Alexander, who have donated millions to her cause"; Trump Lawyer Jenna Ellis Suggests Pence Could Defer Certifying Election, Send Requests to State Legislatures (VIDEO). Trump’s legal team has argued to state legislatures in these contested states that they have plenary power Under Article II, Section 1 Clause 2 of the Constitution to choose which electors are sent to Congress. The President over the weekend spoke to 300 legislators urging them to decertify the ‘unlawful’ election results for Joe Biden": https://archive.vn/ouzzv; Trump wrote: “You watch what happens over the next couple of weeks. You watch what’s going to come out. Watch what’s going to be revealed. You watch.” –POTUS pic.twitter.com/HzLBHUny5N", "The Vice President has the power to reject fraudulently chosen electors" and also: "Pleased to announce that @KLoeffler & @sendavidperdue have just joined our great #StopTheSteal group of Senators. They will fight the ridiculous Electoral College Certification of Biden. How do you certify numbers that have now proven to be wrong and, in many cases, fraudulent!"; Jim Jordan wrote: "Who makes election law: -State legislatures, Who doesn’t: -Liberal judges (I call them "Libertine"), -Secretaries of State, -County clerks (and I add, the stupid MSM and its daughter SM). It’s about the Constitution"!!!; Georgia State Senators Call on Pence to Delay Jan. 6 Electoral Vote: Republican state senators in Georgia started a push on Monday to delay the Jan. 6 counting of electoral votes. At least a dozen have signed a letter directed to Vice President Mike Pence asking him to officially delay the count—and the number is still growing.Source: theepochtimes.com, Dave comments: "There are also other senators from Pennsylvania, Wisconsin, and Arizona also wrote letters sent to the Vice President, [telling him] we want the vice president to at least delay it 10 to 12 days.” Jan 20th is date that matters Constitutionally: “Terms of the President and Vice President shall end at noon on the 20th day of January” Will this depend on the Senators on how it is going in the Senate?, How do you return the power to people?, How do you introduce the constitution? People are now hearing it on the MSM, people want to know what it says and how it works: https://archive.vn/h4439; Sidney Powell wrote: "...One citizen—one vote is imperative to the Rule of Law#DefendingTheRepublic#Pence has the authority to recess until machine fraud fully investigated & and actual ballots counted https://t.co/3ynwbq4HyO pic.twitter.com/Hxod4eKzeB"; “It’s now inside the gates, CCP is here in America” —Pompeo; Those who went against Trump will pay in the end, he will unseat each and everyone one of them in the next 4 years, how by telling the people and the people will vote them out. 1) Pence rejects electors from fraud states; sent back to state legislatures, 2) Biden doesn’t have 270 on 1/6, 3) State legislatures convene hearings, 4) Trump drops powerful new evidence, 5) Fraud states decertify, 6) 12A House Vote – 1 per state delegation, 7) Trump 2nd term; President Trump Replaces US Attorney in Atlanta with Another Trump-Appointed Prosecutor After Byung “BJ” Pak Abruptly Resigns: President Trump wasted no time replacing the top federal prosecutor in Atlanta with another Trump-appointed prosecutor. US Attorney in Atlanta Byung “BJ” Pak abruptly resigned on Monday and it is unclear if it was voluntary or if he was asked to leave his post. President Trump bypassed the Assistant US Attorney who was supposed to take Pak’s place and instead chose to replace the outgoing US Attorney with a former state prosecutor. Bobby L. Christine was named Acting U.S. Attorney for the Northern District of Georgia “by written order of the President": https://archive.vn/XeETh, https://archive.vn/WtCPJ; Lin Wood to Paedo Supreme Court John Roberts: "Note to Chief Justice John Roberts: Many are interested in docket entry numbers 41, 46, 57, 58, & 60 in Case No. 15-545 below. As head of highest court obligated to rule on election fraud cases, would you inform public of contents of these entries & then resign? Or vice versa? pic.twitter.com/GlhwlJJvJv", https://twitter.com/LLinWood/status/1346325897306120192/photo/1; Richard Grenell wrote: "The political objective of bringing our troops home and not starting any new wars was made clear to the American people in 2016. The DC crowd & Pentagon elites want more wars." The Daemocratic false flag: "False Flags: FDA Admits PCR Tests Give False Results, Prepares Ground For Biden To “Crush” Casedemic. The FDA today joined The WHO and Dr.Fauci in admitting there is a notable risk of false results from the standard PCR-Test used to define whether an individual is a COVID “Case” or not. This matters significantly as it fits perfectly with the ‘fake rescue’ plan we have previously described would occur once the Biden admin took office. But before we get to that ‘conspiracy’, we need a little background on how the world got here… As a reminder, “cycle thresholds” (Ct) are the level at which widely used polymerase chain reaction (PCR) test can detect a sample of the COVID-19 virus. The higher the number of cycles, the lower the amount of viral load in the sample; the lower the cycles, the more prevalent the virus was in the original sample. So, in summary, with regard to our current “casedemic”, positive tests as they are counted today do not indicate a “case” of anything. They indicate that viral RNA was found in a nasal swab. not sufficient replication of the virus to make anyone else sick. the media reports… and is used to fearmonger mask mandates and lockdowns nationwide... Why is this being brought up now: The Fake "Rescue" by the Cheaters: Biden will issue national standards, like the plexiglass barriers in restaurants he spoke about during the debate, and pressure governors to implement mask mandates using the federal government’s financial leverage (NOTE: his 100-day mask-wearing ‘mandate’ is already in play). Some hack at the CDC or FDA will issue new guidance lowering the Ct the labs use, and cases will magically start to fall. The change will only eliminate false positives, but most Americans won’t know that"; Meanwhile, the Globalists keep on pushing China as their NWO leader: "A shift to a more Chinese-style global industry promises to be excellent news for consumers."Prices would fall while choice and innovation would probably grow: Why retailers everywhere should look to China: Yet as we explain this week (see article) it is in China, not the West, where the future of e-commerce is being staked out. Its market is far bigger and more creative, with tech firms blending e-commerce, social media and razzmatazz to become online-shopping emporia for 850m digital consumers. And China is also at the frontier of regulation, with the news on December 24th that trustbusters were investigating Alibaba, co-founded by Jack Ma, China’s most celebrated tycoon, and until a few weeks ago its most valuable listed firm: https://archive.vn/09q39" Sources: https://archive.vn/1k4T9; Videos, financial: https://tinyurl.com/JudyS-CrashFed, geopolitical: https://tinyurl.com/big2Brevealed
Updated Jan 5, 2021, 9:05 PM
Proud to Live and to Post for an Historical Landmark in the Life of America!!!: https://pbs.twimg.com/media/ErAKtHIXUAQyKE7?format=jpg&name=small
Updated Jan 5, 2021, 5:32 PM
BIG THINGS COMING: More things to be disclosed in Wed., the 6th at D.C., are already starting to come out right now such as: Patrick Byrne (former CEO of Overstock dot com) wrote: "A printing shop in Michigan prints ballots for Delaware County, Pennsylvania and as Lancashire County, Pennsylvania (this is normal). But along with the ballots it prints on contract and delivers to those counties, it prints some ballots that get diverted to Bethpage, New York. There, a boiler room of folks fill in “Biden” (often without even voting down-ballot). The ballots (which are forensically legitimate, given that they come from the same print shop as the good ballots, ) then get trucked into Pennsylvania and mailed. Hundreds of thousands. We have all of that documented. Texts, statements, affidavits, everything. A handful of papers stuck to the side of the shredding bin. They include some unshredded ballots (which 2 federally certified forensic examiners have affied do not match the legitimate ballots). ALSO, A SHIPPING RECEIPT FROM THE CHINESE FIRM THAT PRINTED THE BALLOTS! IN CHINESE! Word is the DOJ and DHS have been told to stand down. That President Trump himself has had to call agents on the ground asking them to continue. If you think they should continue, retweet to let @TheJusticeDept know your feelings." Jovan Hutton Pulitzer said: "#BREAKING Can confirm my team has been provided evidence of mail in ballots with the votes already filled in BY MACHINE. More than one instance of has occurred and it shows the voting machines can read and do accept MACHINE FILLED IN MECHANICAL BALLOTS more soon #ScanTheBallots", then LISTEN TO THE FINAL 1-MINUTE🚨 ...of the call between @realDonaldTrump & GA Secretary of State Raffensperger. President Trump: “We just want the truth. Let the truth come out” pic.twitter.com/ra1tt8Vp8u, Richard Grenell wrote about this: "Brad Raffensperger is imploding after his phone call was leaked. People are now seeing he isn’t doing his job. https://t.co/Gl1PrhPXNe" The failed plan of the Central Banksters, a.k.a. the Deep State, the "Shadow Government", the pesky "Powers-that-be": "What was the [DS] plan: They wanted America economy to fall under COVID. Their plan was to weaken Trump, turn the people on him Trump was suppose to be completely unpopular, so the election was going to be won easily with a little bit of cheating. But this didn’t happen Understand, The PLAN expected Trump to be FINISHED by December 1st, their plan backfired,they underestimated the American people." Dave indicates: "What did Trump do on the phone conversation, Trump had them lie on the record, is Dominion moving machines, nope, then Trump asked a very specific question, are they changing the parts out of the Dominion machines, he did this on purpose. Trump notified them that this was your last chance, we caught you and you can tell the truth now or go down with the ship, we have it all." The VP Mike Pence wrote: “I promise you, come this Wednesday, we will have our day in Congress.” pic.twitter.com/wfCHyHujBy, so... "Trump will present the fraud, video, data, dominion hacking etc.. Senators will be put on the spot, what will they do with the world watching. They will need to reject and admit there has been election fraud. McCarthy: Congress Should Debate Integrity of Elections ‘to Unite This Nation’": https://www.breitbart.com/clips/2021/01/04/mccarthy-congress-should-debate-integrity-of-elections-to-unite-this-nation (https://archive.vn/DCk0u), JUST IN – Mexico’s President Obrador prepares a plan to grant Assange political asylum. UK court ruled earlier in the day to block WikiLeaks founder Julian Assange’s extradition to the US. Lin Wood also talks of the things to be disclosed soon! Paedo Supreme Justice Roberts, for example: "This blackmail scheme is conducted by members of 10 of world’s most well-known & “elite” intelligence agencies. One of those groups was hacked by a group known as Lizard Squad. The blackmail files of rape & murder were obtained by this group & copy was provided to Isaac Kappy. https://t.co/9lCAggRrCG I have shared with several individuals the TRUTH I will be speaking to you. Killing me will NOT prevent the TRUTH from being revealed – it will only trigger its release by many others. I ask @realDonaldTrump to immediately appoint an honest special prosecutor to pursue justice." DoS quotes precisely today Trump: "President @realDonaldTrump: Human trafficking erodes personal dignity and destroys the moral fabric of society. It is an affront to humanity that tragically reaches all parts of the world. #EndTrafficking pic.twitter.com/CIa3FuU2Z3" Today also the recognition of: "White House announcement of Medal of Freedom for Rep. Devin Nunes: pic.twitter.com/3yBCuMBfow", National Guard Activated to Help Support Police During Pro-Trump Protests (But as Dave said, to whom they finally shall obey? (if they are the real ones and not evil foreign agents dressed like them!!!): https://archive.vn/oRuVW, then my questions: Why Trump is also outsmarting the Deep State into going 5G (seen near the end) as he did with the vaccines (under him are NOT mandatory, and as far as I know, with NO "digital certificate", unless they secretly added that "ingredient" as per the specifications of demon Gates). Text: https://archive.vn/otQJY, Video: https://tinyurl.com/closer-1-4-21, Dave resumes his own presentation as: "The patriots are now moving forward with their plan to move the country away from the [CB]. The [CB]s around the world are now moving towards the great reset to save their system, this will no succeed. The patriots are moving the economic system into a system which is not controlled by the [CB]. Trump is ready to go. The [DS] has been given multiple chances to follow the rule of law. He has now trapped them, this will not end well for the swamp. All parts of the plan are now coming together, crimes against humanity, election fraud, the economic system, it is all being exposed at once. The patriots are ready to drop the evidence, buckle up its going to be a bumpy ride." |
BIG THINGS COMING: More things to be disclosed in Wed., the 6th at D.C., are already starting to come out right now such as: Patrick Byrne (former CEO of Overstock dot com) wrote: "A printing shop in Michigan prints ballots for Delaware County, Pennsylvania and as Lancashire County, Pennsylvania (this is normal). But along with the ballots it prints on contract and delivers to those counties, it prints some ballots that get diverted to Bethpage, New York. There, a boiler room of folks fill in “Biden” (often without even voting down-ballot). The ballots (which are forensically legitimate, given that they come from the same print shop as the good ballots, ) then get trucked into Pennsylvania and mailed. Hundreds of thousands. We have all of that documented. Texts, statements, affidavits, everything. A handful of papers stuck to the side of the shredding bin. They include some unshredded ballots (which 2 federally certified forensic examiners have affied do not match the legitimate ballots). ALSO, A SHIPPING RECEIPT FROM THE CHINESE FIRM THAT PRINTED THE BALLOTS! IN CHINESE! Word is the DOJ and DHS have been told to stand down. That President Trump himself has had to call agents on the ground asking them to continue. If you think they should continue, retweet to let @TheJusticeDept know your feelings." Jovan Hutton Pulitzer said: "#BREAKING Can confirm my team has been provided evidence of mail in ballots with the votes already filled in BY MACHINE. More than one instance of has occurred and it shows the voting machines can read and do accept MACHINE FILLED IN MECHANICAL BALLOTS more soon #ScanTheBallots", then LISTEN TO THE FINAL 1-MINUTE🚨 ...of the call between @realDonaldTrump & GA Secretary of State Raffensperger. President Trump: “We just want the truth. Let the truth come out” pic.twitter.com/ra1tt8Vp8u, Richard Grenell wrote about this: "Brad Raffensperger is imploding after his phone call was leaked. People are now seeing he isn’t doing his job. https://t.co/Gl1PrhPXNe" The failed plan of the Central Banksters, a.k.a. the Deep State, the "Shadow Government", the pesky "Powers-that-be": "What was the [DS] plan: They wanted America economy to fall under COVID. Their plan was to weaken Trump, turn the people on him Trump was suppose to be completely unpopular, so the election was going to be won easily with a little bit of cheating. But this didn’t happen Understand, The PLAN expected Trump to be FINISHED by December 1st, their plan backfired,they underestimated the American people." Dave indicates: "What did Trump do on the phone conversation, Trump had them lie on the record, is Dominion moving machines, nope, then Trump asked a very specific question, are they changing the parts out of the Dominion machines, he did this on purpose. Trump notified them that this was your last chance, we caught you and you can tell the truth now or go down with the ship, we have it all." The VP Mike Pence wrote: “I promise you, come this Wednesday, we will have our day in Congress.” pic.twitter.com/wfCHyHujBy, so... "Trump will present the fraud, video, data, dominion hacking etc.. Senators will be put on the spot, what will they do with the world watching. They will need to reject and admit there has been election fraud. McCarthy: Congress Should Debate Integrity of Elections ‘to Unite This Nation’": https://www.breitbart.com/clips/2021/01/04/mccarthy-congress-should-debate-integrity-of-elections-to-unite-this-nation (https://archive.vn/DCk0u), JUST IN – Mexico’s President Obrador prepares a plan to grant Assange political asylum. UK court ruled earlier in the day to block WikiLeaks founder Julian Assange’s extradition to the US. Lin Wood also talks of the things to be disclosed soon! Paedo Supreme Justice Roberts, for example: "This blackmail scheme is conducted by members of 10 of world’s most well-known & “elite” intelligence agencies. One of those groups was hacked by a group known as Lizard Squad. The blackmail files of rape & murder were obtained by this group & copy was provided to Isaac Kappy. https://t.co/9lCAggRrCG I have shared with several individuals the TRUTH I will be speaking to you. Killing me will NOT prevent the TRUTH from being revealed – it will only trigger its release by many others. I ask @realDonaldTrump to immediately appoint an honest special prosecutor to pursue justice." DoS quotes precisely today Trump: "President @realDonaldTrump: Human trafficking erodes personal dignity and destroys the moral fabric of society. It is an affront to humanity that tragically reaches all parts of the world. #EndTrafficking pic.twitter.com/CIa3FuU2Z3" Today also the recognition of: "White House announcement of Medal of Freedom for Rep. Devin Nunes: pic.twitter.com/3yBCuMBfow", National Guard Activated to Help Support Police During Pro-Trump Protests (But as Dave said, to whom they finally shall obey? (if they are the real ones and not evil foreign agents dressed like them!!!): https://archive.vn/oRuVW, then my questions: Why Trump is also outsmarting the Deep State into going 5G (seen near the end) as he did with the vaccines (under him are NOT mandatory, and as far as I know, with NO "digital certificate", unless they secretly added that "ingredient" as per the specifications of demon Gates). Text: https://archive.vn/otQJY, Video: https://tinyurl.com/closer-1-4-21, Dave resumes his own presentation as: "The patriots are now moving forward with their plan to move the country away from the [CB]. The [CB]s around the world are now moving towards the great reset to save their system, this will no succeed. The patriots are moving the economic system into a system which is not controlled by the [CB]. Trump is ready to go. The [DS] has been given multiple chances to follow the rule of law. He has now trapped them, this will not end well for the swamp. All parts of the plan are now coming together, crimes against humanity, election fraud, the economic system, it is all being exposed at once. The patriots are ready to drop the evidence, buckle up its going to be a bumpy ride."
The Real Patriots for a still Real Nation, STILL Stand for Truth, NOT for a Cheating Idiot!!!, on the reception given today to Trump in GA: https://twitter.com/i/status/1346271579664220160
Updated Jan 4, 2021, 8:32 PM
Patriots of all ages are expressing the evidence of fraud through rigged "Dominion" voting machines and multiple other ways that all are going to publicly be exposed on the 6th of Jan., 2021, giving a detail of names and companies involved, with the clear and confidential evidence, there is no other way, and there is no option. All chances were given to the crooked ones to amend their ways and do the right thing, but it was stronger the fascination with money, fame, prestige, and maybe even cowardice...: |
Patriots of all ages are expressing the evidence of fraud through rigged "Dominion" voting machines and multiple other ways that all are going to publicly be exposed on the 6th of Jan., 2021, giving a detail of names and companies involved, with the clear and confidential evidence, there is no other way, and there is no option. All chances were given to the crooked ones to amend their ways and do the right thing, but it was stronger the fascination with money, fame, prestige, and maybe even cowardice...:
So RON, code monkey Z, the one with tools to see, and one of the Cue heads, is wisely recommending to all those going to D.C. on the 6th of Jan., 2021: "If you are planning to attend peaceful protests in DC on the 6th, i recommend wearing a body camera. The more video angles of that day the better"!!!: https://twitter.com/CodeMonkeyZ/status/1345599512560078849, https://archive.vn/o1edS
Patriots are Going to Be By the Millions at Washington, D. C. on the 6th of January, where Trump and his team are going to reveal all the SECRETS of the voting fraud and other things related to the Shadow Government lead by the Central Banksters that want to Subdue YOU to their Evil Wills and Ways, Put RESISTANCE while you are still able to do it!!! Put Resistance as well while you are still on this earth, put resistance if you are led by GOD to do SO as I am doing right now by putting this, once realizing the MSM and the SM are repressing, banning, censoring, and removing the truth!!! Light dissipates darkness!!! So shed some light the best you hear God telling you to DO IT, but DO IT and DO NOT be Idle Anymore, Please In the Living Name of Jesus Christ I beg you to do so. Dear Dave "Lesimpsod" wrote: "The UK is now looking at China as the biggest threat. Nigel Farage issues a warning that China is a direct threat to the UK. Trump halts visas and wants jobs filled by Americans first. Congress went ahead and pushed the NDAA through, we are still in a national emergency, Trump has additional powers. The patriots are now pushing forward with their focus on the constitution. Over the past couple of weeks election fraud evidence has been shown the people. The idea that Pence will need to do his duty and follow the 12th amendment. Senators and Representatives are now coming aboard and are calling for an audit to see how bad the election fraud actually is. The patriots are pushing the rule of law, the [DS]/MSM are now being backed into a corner." |
Patriots are Going to Be By the Millions at Washington, D. C. on the 6th of January, where Trump and his team are going to reveal all the SECRETS of the voting fraud and other things related to the Shadow Government lead by the Central Banksters that want to Subdue YOU to their Evil Wills and Ways, Put RESISTANCE while you are still able to do it!!! Put Resistance as well while you are still on this earth, put resistance if you are led by GOD to do SO as I am doing right now by putting this, once realizing the MSM and the SM are repressing, banning, censoring, and removing the truth!!! Light dissipates darkness!!! So shed some light the best you hear God telling you to DO IT, but DO IT and DO NOT be Idle Anymore, Please In the Living Name of Jesus Christ I beg you to do so. Dear Dave "Lesimpsod" wrote: "The UK is now looking at China as the biggest threat. Nigel Farage issues a warning that China is a direct threat to the UK. Trump halts visas and wants jobs filled by Americans first. Congress went ahead and pushed the NDAA through, we are still in a national emergency, Trump has additional powers. The patriots are now pushing forward with their focus on the constitution. Over the past couple of weeks election fraud evidence has been shown the people. The idea that Pence will need to do his duty and follow the 12th amendment. Senators and Representatives are now coming aboard and are calling for an audit to see how bad the election fraud actually is. The patriots are pushing the rule of law, the [DS]/MSM are now being backed into a corner."
Every Patriot is Doing the Best Possible for Truth and Justice to Be Done, so as for us to Keep Freely GATHERING as Before and as God Prescribes in our Prayers for our Lawfully, Legally Chosen Authorities: |
Every Patriot is Doing the Best Possible for Truth and Justice to Be Done, so as for us to Keep Freely GATHERING as Before and as God Prescribes in our Prayers for our Lawfully, Legally Chosen Authorities:
The crucial moment demonstrating the fraudulent nature of the "Dominion" voting machines: |
The crucial moment demonstrating the fraudulent nature of the "Dominion" voting machines:
Updated Jan 3, 2021, 2:43 PM
Updated Jan 3, 2021, 10:05 AM
Then, she just sent me this one, great oceans, outdoors, other landscapes: https://www.youtube.com/watch?v=VF-r5TtlT9w&list=PL1BwKXJqW9zXtoSuoI6LVjof1H9gb13Re
Updated Jan 3, 2021, 9:39 AM
Sent by the One that Melts my Heart:
Updated Jan 3, 2021, 8:43 AM
Updated Jan 3, 2021, 8:11 AM
Fernando Castro-Chavez shared a memory.
You tagged Silvia Preciado
3 Years Ago
Alexandra Preciado added a new photo.
Different times... ..God Bless the ones who Love You
Updated Jan 3, 2021, 8:11 AM
Updated Jan 2, 2021, 11:01 PM
Updated Jan 2, 2021, 11:01 PM
Updated Jan 2, 2021, 9:20 PM
Updated Jan 2, 2021, 7:32 PM
Pacific, Legal and Active Patriots in Support of Truth, Defeating Lies: https://joyinliberty.com/ (https://archive.vn/GkzvD), (https://archive.vn/uI98e) https://twitter.com/realDonaldTrump/status/1345100089505755139, (https://archive.vn/uI98e) https://twitter.com/realDonaldTrump/status/1340185773220515840, https://twitter.com/realDonaldTrump/status/1345095714687377418 (https://archive.vn/xQ9aj), (https://archive.vn/XVkTN) https://g.clouthub.com/group/patriot-caravans-for-45, (https://archive.vn/UUHOj) https://trumpmarch.com/, and endless more...
Updated Jan 2, 2021, 2:10 PM
Updated Jan 2, 2021, 8:17 AM
Please sent your message requesting justice to: history@mail.house.gov, david.ralston@house.ga.gov, mike.dugan@senate.ga.gov, my email sent says:
Demand a Vote on Decertification Against Cheater and Lame Biden
Ralston and Dugan, with a witness (The Historian of the House),
Please, one more of the at least 75 Million Citizens that voted for Trump are requesting from you to:
1) Hear the evidence
2) Correct false statements
3) Demand a vote on decertification
It is historically clear for all the ones that want to see it, from any place in the world, that there was rampant fraud perpetrated by Biden.
Here, just one small historical fact that the historian called as witness here will not deny (check this out before it disappears):
Testimony at Georgia of Jovan Hutton Pulitzer: https://youtu.be/KeVAssjxHx0, Interview of Pulitzer: https://youtu.be/UgeqGmvQXKs
Thank you for attending the truth in this situation,
Fernando Castro-Chavez, PhD
https://orcid.org/0000-0001-9661-5672
Demand a Vote on Decertification Against Cheater and Lame Biden
Ralston and Dugan, with a witness (The Historian of the House),
Please, one more of the at least 75 Million Citizens that voted for Trump are requesting from you to:
1) Hear the evidence
2) Correct false statements
3) Demand a vote on decertification
It is historically clear for all the ones that want to see it, from any place in the world, that there was rampant fraud perpetrated by Biden.
Here, just one small historical fact that the historian called as witness here will not deny (check this out before it disappears):
Testimony at Georgia of Jovan Hutton Pulitzer: https://youtu.be/KeVAssjxHx0, Interview of Pulitzer: https://youtu.be/UgeqGmvQXKs
Thank you for attending the truth in this situation,
Fernando Castro-Chavez, PhD
https://orcid.org/0000-0001-9661-5672
Another of the best teachers, using Proverbs in her class! "A fool and his money are soon parted", for her teaching, as mine is, on Paraphrasing, I paraphrased this sentence as: "Money plus a Fool equals a broken porcelain vase" (Hehee!) Then I also adopted for my own class the resources that she presented: https://owl.purdue.edu/owl/research_and_citation/using_research/quoting_paraphrasing_and_summarizing/paraphrasing.html, and the Technology introduced by her that will allow for the interactive participation of the students: https://www.polleverywhere.com/, here is one of the several ways that such concept has been translated in the Bible: Proverbs 21:20 says "Precious treasure and oil are in a wise man's dwelling, but a foolish man devours it." Here in the Bible we can see the inspiring wisdom of God through a figure of speech that changes the end from "them" to "IT" so as to make us put our emphasis in the word "WISE" and not in the "fool"!
Fernando Castro-Chavez updated his status.
Trump just posted (at 2:00 PM, on the First of Jan, 2021): "The BIG Protest Rally in Washington, D.C., will take place at 11.00 A.M. on January 6th. Locational details to follow. StopTheSteal!"
Videos: Financial: https://tinyurl.com/scum-vs-nation, the other at the bottom of this post; Sources: https://archive.vn/DjLZd More on the Real Victory of Trump over a Confessed Cheater, Biden: JANUARY SIXTH, SEE YOU IN DC! Said Trump, who left Mar A Lago early to go back to DC, cancelling a New Year’s Eve party hundreds of people had bought tickets for. Vice President Pence Must Be Guided by the 12th Amendment, Not the Electoral Count Act, on Jan. 6 (https://archive.vn/seRS5):
"State Lawmakers Choose Electors; the Vice President Determines If There’s a Dispute; the House Resolves the Dispute by a Contingent Election
Under the 12th Amendment, the vice president, in his constitutionally prescribed role as president of the Senate, is granted the sole power to “open” the electoral vote certificates and “count” them at the joint session of Congress, this year scheduled for Jan. 6.
Pence will be faced with dueling electoral votes for the six disputed swing states, a Biden slate from the governors, and a Trump slate from the lawmakers. The six disputed swing states account for 79 electoral votes. Not counting them, Trump stands at 232 and Biden at 227. Thus, the disputed votes are sufficient to make either candidate a winner, if they are counted, or neither candidate a winner, if they are not counted, since in the latter case neither candidate will reach 270 votes (though in that case Trump would have a majority of the votes counted).
A Contingent Election in the House
The 12th Amendment sets forth a procedure for resolving a disputed election where neither candidate achieves a majority of electoral votes. In that case, a “contingent election” is held by the House: “the House of Representatives shall choose immediately, by ballot, the President. But in choosing the President, the votes shall be taken by states, the representation from each state having one vote …”
if Pence were to “open” and read the electoral votes cast by both of the competing slates of electors from the six swing states, and choose “not to count” either set—in light of the conflict—the House of Representatives would immediately vote to determine the winner, with each state getting one vote. Given that a majority of states are GOP-controlled (although the Democrats control a greater number of representatives), Trump would prevail.
Electoral Count Act Sets Forth a Procedure Entirely Different from that Prescribed by the 12th Amendment
the Electoral Count Act (ECA) provides an entirely different procedure. Instead of a contingent election in the House, the ECA calls for “objections” to be sponsored in both chambers, and if, and only if, the objections carry in both houses are the objected-to electors not counted (in which case a contingent election would take place in the House).
if the objection doesn’t carry in either or both houses of Congress, then the ECA further provides that the slate certified by the governor controls, in which case the dispute is thus resolved, and a contingent election never takes place.
The ECA varies the 12th Amendment procedure for resolving disputed electoral votes in three crucial respects:
First, while the 12th Amendment grants no role whatsoever to the Senate, the ECA grants the Senate equal control over objections, as they must pass the Senate and the House.
Second, the ECA provides that in the absence of objections passing in both houses, the slate certified by the governor of the state controls. This is nowhere provided in the 12th Amendment.
Third, by providing for governor-certified slates to be counted even if there are dueling slates of electors—absent objections passing in both houses of Congress—the ECA eliminates and replaces the contingent election procedure set forth in the 12th Amendment, because by virtue of counting the governor-certified slates, the dispute is resolved (though not in the manner set forth in the Constitution, i.e., the 12th Amendment), and never reaches the House (for a contingent election).
the vice president should adhere to his oath of office and refuses to “count” either slate of disputed electors, this will then send the matter to the House for a “contingent election” as the 12th Amendment requires."
The [DS]/[CB] is falling apart, Trump had the [CB]/[DS] accelerate their plan so the people were able to see it clearly. Now the people can see it. The great reset is failing, the pandemic is failing and now the people can see who actually destroyed their lives economically. The [DS]/MSM fell right into the patriots trap. They patriots have been planning this for a long time. The people are now seeing election fraud for the first time and a grand scale. The MSM/SM narrative is falling apart. The constitution is now on deck and the patriots are waiting for the right moment to strike, good will always win in the end. The [DS] players will not be able to walk down the street. The people know who the real enemy is: https://twitter.com/i/status/1344374207979913216 and https://twitter.com/i/status/1344374378461593604, and “Because you’re not having people enter these totals into a spreadsheet, that removes the entire layer, the entire argument for any kind of human entry error, because there is no human being entering anything anywhere in here”: https://twitter.com/i/status/1344374569990287363; they fraudulently increased the numbers for Biden: https://twitter.com/i/status/1344374776853368839: "...the data your @GaSecofState’s office is certifying w/, is the same data that shows these negative decrements [votes being siphoned from Trump] is the same data the NYT is reporting, the networks are reporting. This is simply stunning": https://twitter.com/i/status/1344374877466320897; "Thank you to each of these brave whistleblowers, experts and patriotic Americans for shining a light on this massive fraud, as well as @RSBNetwork for the incredible non-stop coverage." Murray. MarkFinchem wrote: "BREAKING...AzAg joins in battle for forensic audit of Maricopa County elections equipment and ballot images. Files amicus brief in support of the Senate subpoenas! #StopTheSteaI : (https://web.archive.org/web/20201230212249/https://www.azag.gov/sites/default/files/2020-12/Maricopa%20County%20v%20Fann_%20AGO%20Amicus%20Brief.pdf). Senator Doug Mastriano wrote: "Today, members of the PA House and Senate request that Sen Mitch McConnell and Rep Kevin McCarthy dispute the PA election results until an investigation is conducted into the numerous claims of fraud. Until this is completed, the hastily certified results can’t be trusted." Rudy Giuliani wrote: "In a country with a free press, you would know:
1. The Georgia Senate Judiciary Committee issued a report demonstrating the vote was stolen from @realDonaldTrump.
2. The vote was unanimous and BIPARTISAN to audit Fulton County’s Absentee ballots.
3. And to de-certify Biden." Jenna Ellis wrote: "NEW: President Trump files new Wisconsin case in SCOTUS today.
The lawsuit asks to declare the Wisconsin election unconstitutional and void as a result of the multiple violations of law, and order the state legislature to appoint electors consistent with Article II, Sec 1.2." General Flynn Wrote: "How many overseas connections are we talking about involved in our 3 NOV election? Are there any foreign countries NOT interfering in our elections? China, Serbia, Italy, Germany, Iran. WTH!
The electronic voting machines are NOT suppose to be connected to the internet (Period)." Josh Caplan wrote: "List of SOME Republicans planning to challenge Electoral College results (the key ones are held discretely, who may double this number):
Rep. Brian Babin
Rep. Andy Biggs
Rep.-elect Lauren Boebert
Rep. Mo Brooks
Rep. Ted Budd
Rep.-elect Jerry Carl
Rep.-elect Madison Cawthorn
Rep.-elect Andrew Clyde
Rep. Jeff Duncan
Rep. Matt Gaetz
Rep.-elect Burgess Owens
Rep. Scott Perry
Rep.-elect Marjorie Taylor Greene
Rep. Jeff Van Drew ...; "The Chinese Communist Party that paid Joe Biden’s family businesses at least $11 million also offered to pay non-state actors in Afghanistan to attack US forces": https://archive.vn/VHxKL, main video Geopolitical: https://tinyurl.com/fraud-exposed
"State Lawmakers Choose Electors; the Vice President Determines If There’s a Dispute; the House Resolves the Dispute by a Contingent Election
Under the 12th Amendment, the vice president, in his constitutionally prescribed role as president of the Senate, is granted the sole power to “open” the electoral vote certificates and “count” them at the joint session of Congress, this year scheduled for Jan. 6.
Pence will be faced with dueling electoral votes for the six disputed swing states, a Biden slate from the governors, and a Trump slate from the lawmakers. The six disputed swing states account for 79 electoral votes. Not counting them, Trump stands at 232 and Biden at 227. Thus, the disputed votes are sufficient to make either candidate a winner, if they are counted, or neither candidate a winner, if they are not counted, since in the latter case neither candidate will reach 270 votes (though in that case Trump would have a majority of the votes counted).
A Contingent Election in the House
The 12th Amendment sets forth a procedure for resolving a disputed election where neither candidate achieves a majority of electoral votes. In that case, a “contingent election” is held by the House: “the House of Representatives shall choose immediately, by ballot, the President. But in choosing the President, the votes shall be taken by states, the representation from each state having one vote …”
if Pence were to “open” and read the electoral votes cast by both of the competing slates of electors from the six swing states, and choose “not to count” either set—in light of the conflict—the House of Representatives would immediately vote to determine the winner, with each state getting one vote. Given that a majority of states are GOP-controlled (although the Democrats control a greater number of representatives), Trump would prevail.
Electoral Count Act Sets Forth a Procedure Entirely Different from that Prescribed by the 12th Amendment
the Electoral Count Act (ECA) provides an entirely different procedure. Instead of a contingent election in the House, the ECA calls for “objections” to be sponsored in both chambers, and if, and only if, the objections carry in both houses are the objected-to electors not counted (in which case a contingent election would take place in the House).
if the objection doesn’t carry in either or both houses of Congress, then the ECA further provides that the slate certified by the governor controls, in which case the dispute is thus resolved, and a contingent election never takes place.
The ECA varies the 12th Amendment procedure for resolving disputed electoral votes in three crucial respects:
First, while the 12th Amendment grants no role whatsoever to the Senate, the ECA grants the Senate equal control over objections, as they must pass the Senate and the House.
Second, the ECA provides that in the absence of objections passing in both houses, the slate certified by the governor of the state controls. This is nowhere provided in the 12th Amendment.
Third, by providing for governor-certified slates to be counted even if there are dueling slates of electors—absent objections passing in both houses of Congress—the ECA eliminates and replaces the contingent election procedure set forth in the 12th Amendment, because by virtue of counting the governor-certified slates, the dispute is resolved (though not in the manner set forth in the Constitution, i.e., the 12th Amendment), and never reaches the House (for a contingent election).
the vice president should adhere to his oath of office and refuses to “count” either slate of disputed electors, this will then send the matter to the House for a “contingent election” as the 12th Amendment requires."
The [DS]/[CB] is falling apart, Trump had the [CB]/[DS] accelerate their plan so the people were able to see it clearly. Now the people can see it. The great reset is failing, the pandemic is failing and now the people can see who actually destroyed their lives economically. The [DS]/MSM fell right into the patriots trap. They patriots have been planning this for a long time. The people are now seeing election fraud for the first time and a grand scale. The MSM/SM narrative is falling apart. The constitution is now on deck and the patriots are waiting for the right moment to strike, good will always win in the end. The [DS] players will not be able to walk down the street. The people know who the real enemy is: https://twitter.com/i/status/1344374207979913216 and https://twitter.com/i/status/1344374378461593604, and “Because you’re not having people enter these totals into a spreadsheet, that removes the entire layer, the entire argument for any kind of human entry error, because there is no human being entering anything anywhere in here”: https://twitter.com/i/status/1344374569990287363; they fraudulently increased the numbers for Biden: https://twitter.com/i/status/1344374776853368839: "...the data your @GaSecofState’s office is certifying w/, is the same data that shows these negative decrements [votes being siphoned from Trump] is the same data the NYT is reporting, the networks are reporting. This is simply stunning": https://twitter.com/i/status/1344374877466320897; "Thank you to each of these brave whistleblowers, experts and patriotic Americans for shining a light on this massive fraud, as well as @RSBNetwork for the incredible non-stop coverage." Murray. MarkFinchem wrote: "BREAKING...AzAg joins in battle for forensic audit of Maricopa County elections equipment and ballot images. Files amicus brief in support of the Senate subpoenas! #StopTheSteaI : (https://web.archive.org/web/20201230212249/https://www.azag.gov/sites/default/files/2020-12/Maricopa%20County%20v%20Fann_%20AGO%20Amicus%20Brief.pdf). Senator Doug Mastriano wrote: "Today, members of the PA House and Senate request that Sen Mitch McConnell and Rep Kevin McCarthy dispute the PA election results until an investigation is conducted into the numerous claims of fraud. Until this is completed, the hastily certified results can’t be trusted." Rudy Giuliani wrote: "In a country with a free press, you would know:
1. The Georgia Senate Judiciary Committee issued a report demonstrating the vote was stolen from @realDonaldTrump.
2. The vote was unanimous and BIPARTISAN to audit Fulton County’s Absentee ballots.
3. And to de-certify Biden." Jenna Ellis wrote: "NEW: President Trump files new Wisconsin case in SCOTUS today.
The lawsuit asks to declare the Wisconsin election unconstitutional and void as a result of the multiple violations of law, and order the state legislature to appoint electors consistent with Article II, Sec 1.2." General Flynn Wrote: "How many overseas connections are we talking about involved in our 3 NOV election? Are there any foreign countries NOT interfering in our elections? China, Serbia, Italy, Germany, Iran. WTH!
The electronic voting machines are NOT suppose to be connected to the internet (Period)." Josh Caplan wrote: "List of SOME Republicans planning to challenge Electoral College results (the key ones are held discretely, who may double this number):
Rep. Brian Babin
Rep. Andy Biggs
Rep.-elect Lauren Boebert
Rep. Mo Brooks
Rep. Ted Budd
Rep.-elect Jerry Carl
Rep.-elect Madison Cawthorn
Rep.-elect Andrew Clyde
Rep. Jeff Duncan
Rep. Matt Gaetz
Rep.-elect Burgess Owens
Rep. Scott Perry
Rep.-elect Marjorie Taylor Greene
Rep. Jeff Van Drew ...; "The Chinese Communist Party that paid Joe Biden’s family businesses at least $11 million also offered to pay non-state actors in Afghanistan to attack US forces": https://archive.vn/VHxKL, main video Geopolitical: https://tinyurl.com/fraud-exposed
Updated Jan 1, 2021, 2:07 PM
Mi entrega de Hoy, para cerrar: https://youtu.be/QU_qDrhI6XE
Updated Dec 31, 2020, 4:39 PM
A Clamor from the Past: "Alpes et Ribeiro" (sent by HER), Reminding us of the Wild Freedoms of the Great Outdoors, there in the 60s, far from the Madness of the Current Times, Other Problems Indeed, but not as Involved as those Ones of this 2020 that is Dying Today! Bye Past, Welcome Future!!! I Toast for a 2021 as Good as it Gets, Potting God First, In Disregard Anything BUT Him!!! |
A Clamor from the Past: "Alpes et Ribeiro" (sent by HER), Reminding us of the Wild Freedoms of the Great Outdoors, there in the 60s, far from the Madness of the Current Times, Other Problems Indeed, but not as Involved as those Ones of this 2020 that is Dying Today! Bye Past, Welcome Future!!! I Toast for a 2021 as Good as it Gets, Potting God First, In Disregard Anything BUT Him!!!
Fernando Castro-Chavez shared a memory.
1 Year Ago
Dec 31, 2019, 10:53 AM
A poetically visual evocation of the most important event for me in this 2019 that is ending and that 2020 that is starting, an event that is still ongoing and getting more interesting as the seconds are passing-by: My Sunset Into Your Fountain: "The beautiful end of another day! The sunset displaying all of its intriguing colors! Two trees are standing close to two fountains of waters and of lights; in the mean time, one heart is looking at this amazing display of the divine majesty of God, while fervently praying for the woman that he likes the most under this blessed earth and in this awesome time that both of them have had the great privilege and miracle of living!!!" Fernando Castro-Chavez.
Updated Dec 31, 2020, 9:32 AM
Fernando Castro-Chavez shared a memory.
4 Years Ago
Dec 31, 2016, 7:58 PM
Hello, This is my painting 4 U, "Flamingos", with my earnest desire for your best 2017!!!: In my case, this will be a beautiful family looking towards the same God, and with an increase of little "flamingos"... this, and a song, reminding us that, really, it never is "too late...": https://www.youtube.com/watch?v=ULb_oFejouI plus, my writing again on "The Promise"
Such as the fruit is the fulfillment
of the promise of the button and its flower,
The butterfly is the fulfillment
of the promise of the worm and its cocoon,
The chicken is the fulfillment
of the promise of the hen and of its egg,
And the baby is the fulfillment
of the promise of the woman and her belly,
The eternity is the fulfillment
of the human promise and their anointed!
Fernando Castro. (Thanking God for His forgiveness in Christ, and asking in their names for your forgiveness towards me). With All My Love.
Dreams of Being with the One at the Shore of our Lives... that my longingds came to life... And The Will of God is DONE in US
Updated Dec 31, 2020, 8:19 AM
BIG News on the Voting Fraud, 2020 is ending with "a Bang"!: Inventor Jovan Hutton Pulitzer hacked into the voting systems: https://www.thegatewaypundit.com/2020/12/isnt-beating-drum-burning-city-inventor-jovan-pulitzer-destroys-certification-georgias-2020-election-results/
TAKE A LISTEN
Welcome to 2020, when @JovanHPulitzer hacked a voting machine live during a government hearing and the press insists there is no evidence of election fraud.
Two months worth of fake talking points were just blown sky high.
Hutton said if state officials would simply allow investigators to physically examine the ballots, they could quickly determine if the ballots are counterfeit. Hutton says Georgia officials are dragging their feet and keeping the ballots hidden… Hutton says the physical evidence shows material differences in ballots, and investigators should focus on those differences: https://twitter.com/Wizard_Predicts/status/1344315322975875077
New Lott study estimates 11,350 absentee votes lost to Trump in Georgia. Another 289,000 "excess (fraudulent) votes" across GA, AZ, MI, NV, PA, and WI. Check it out!: https://twitter.com/realDonaldTrump/status/1344173684983017473
GA State Senate Judiciary Subcommittee unanimously pass motion to audit Fulton County's absentee ballots (see: State Vote Farm Arena). It follows the bombshell report of the live hack of Dominion by @JovanHPulitzer& would allow him to *audit the ballots.*
1:15 PM • Dec 30, 2020
Trump Campaign Takes Wisconsin Constitutional Fight to US Supreme Court — Challenging 50,000 Illegal Absentee Votes : https://www.thegatewaypundit.com/2020/12/trump-campaign-takes-wisconsin-constitutional-fight-us-supreme-court/
RAFFENSPERGER GETS CAUGHT: Georgia Ballots Were Printed DIFFERENTLY for GOP Counties vs. DEM Counties — Election Was Rigged! : https://www.thegatewaypundit.com/2020/12/raffensperger-gets-caught-georgia-ballots-printed-differently-gop-counties-vs-dem-counties-election-rigged
Jovan Pulitzer revealed the differences between votes printed for Democrat counties versus Republican counties.
The Republican counties had a barcode up in the right-hand corner.
The votes from two different counties are printed differently.
This caused GOP votes to get kicked out by the Dominion machines.
Secretary of State Raffensperger allowed this to take place
Georgia County Official: Raffensperger Sent Armed Secretary of State Agents with Handcuffs to the County After They Complained about the Inaccurate Dominion Machines (VIDEO) : https://www.thegatewaypundit.com/2020/12/georgia-county-official-raffensperger-sent-armed-secretary-state-agents-handcuffs-county-complained-inaccurate-dominion-machines-video/
Coffee County official spoke before Georgia’s Senate Judiciary Subcommittee on Elections. The woman told the subcommittee that when their county complained to Secretary of State Raffensperger about the voting machines and the recounts Secretary Raffensperger sent armed Secretary of State officials with handcuffs and two Dominion operators to the county.
She said Raffensperger was intentionally threatening the county officials.
McConnell Ties $2,000 Checks To Section 230 Repeal, Voter Fraud Investigation: https://dailycaller.com/2020/12/30/mcconnell-2000-checks-section-230-repeal-voter-fraud/
Senate Majority Leader Mitch McConnell introduced legislation authorizing direct cash payments of $2,000 , but tied it to a repeal of Section 230 and an investigation into the president’s allegations of voter fraud.
Democrats immediately criticized McConnell’s bill, calling it a “poison pill” and warning that it would fall short of the necessary support needed to pass.
I want businesses open. I want people working. I want society back: https://twitter.com/SydneyLWatson/status/1343771955418308611
Exactly!! Open your businesses NOW! This lockdown ends when enough people say they’ve had ENOUGH! Rob Schneider: https://twitter.com/RobSchneider/status/1344059728452747265
“Barack Obama was toppled from the top spot and President Trump claimed the title of the year’s Most Admired Man. Trump number one, Obama number two, and Joe Biden a very distant number three. That’s also rather odd given the fact that on November 3rd, Biden allegedly racked up millions more votes than Trump, but can’t get anywhere close to him in this poll. No incoming president has ever done as badly in this annual survey. That’s because he got millions of Fake Votes in the 2020 Election, which was RIGGED!”: https://twitter.com/realDonaldTrump/status/1344259405274087424
UBS Securities (subsidiary of UBS Group) gave Staple Street Capital, owner of Dominion, 400 million dollars in the weeks before the 2020 General Election. UBS group is a SWISS bank: https://twitter.com/CodeMonkeyZ/status/1344261205158858752
Scytl (Spanish company) is partnered with (and perhaps owned by) the SWISS Post: https://twitter.com/CodeMonkeyZ/status/1344261209298673671
Why does a SWISS BANK own the voting company that is one of the biggest voting companies in the US? Why does the SWISS POST count our votes through their partner in Spain? Switzerland held a secret meeting of world elites in 2019. Stacey Abrams was invited. Why?: https://twitter.com/CodeMonkeyZ/status/1344261210875707392
False Flags
Hospitals in COVID-19 hotspots to receive $10 billion more in federal aid: https://www.hfma.org/topics/news/2020/07/the-new-round-will-pay--50-000-per-covid-19-admission--compared-.html
More than 1,000 hospitals in high-impact areas will get a share of $10 billion in new federal assistance.
The new payments will be $50,000 per COVID-19 admission, less than the $77,000 in an earlier round.
Hospitals with large Medicaid populations have until Aug. 3 to apply for a separate pool of funds.
Hospitals that recently have submitted information on large COVID-19 caseloads could start to receive a share of $10 billion in new federal assistance this week.
The U.S. Department of Health and Human Services (HHS) announced it would begin sending payments July 20 to more than 1,000 hospitals in “high-impact” areas of the pandemic, based on the case count data they submitted in recent weeks.
That would add to the $10 billion HHS sent in May to hospitals that had more than 100 COVID-19 patients by April 10.
Hospitals will qualify for payments based on whether admissions between Jan. 1 and June 10 meet one of the following criteria:
More than 161 COVID-19 admissions
At least one COVID-19 admission per day
Higher than the national average ratio of COVID-19 admissions per bed
Amount of assistance reduced
The new round will pay $50,000 per COVID-19 admission, compared with $77,000 in the earlier high-impact round.
A senior HHS official said on a media call that the reduced funding is due to the number of such admissions surging from about 50,000 in the first round to more than 400,000 by the time of the second round.
The first-round payments went to 325 hospitals. The new round of payments will be “net from their payments — what they had already received” will be subtracted from their allocated total, the official said.
Pence’s final visit to Israel before leaving office is canceled: https://www.timesofisrael.com/pence-cancels-final-visit-to-israel-before-leaving-office
A planned visit to Israel by US Vice President Mike Pence was called off less than two weeks before he was due to arrive, the US Embassy confirmed Wednesday.No reason was given for the cancellation, which was first reported by the Ynet news site.Pence was reportedly scheduled to make a number of stops on a final world trip before leaving office on January 20. Earlier this month, Politico reported: https://www.politico.com/news/2020/12/17/pence-trump-election-loss-447326 that the vice president planned to take off on January 6 — the same day the US Congress is scheduled to confirm President-elect Joe Biden’s electoral victory — visiting a number of countries, including Israel from January 10 to 13.
All warfare is based on deception. Everybody assuming Trump hasn't been working furiously behinds the scenes to affect certain outcomes were wrong. They based their assumption Trump doing nothing & just hoping for the best on the surface of things. As they were supposed to. “Hold out baits to entice the enemy. Feign disorder, and crush him.”
https://twitter.com/BrianTh37895972/status/1344328567593820162, etc., etc....; All this documenting text and more: Text: https://archive.vn/wip/ni8i7; Videos: https://tinyurl.com/congr-owned (financial); https://tinyurl.com/slo-mo-2020 (Geopolitical). The [DS]/MSM has just been exposed. The idea that there is no such thing as election fraud and that the election systems are secure has just been debunked. GA held a hearing and now the GA lawmakers are looking into the ballots. The entire election scam is falling apart and those who [knowingly] participated are feeling the heat. Tick tock time is running out... Trump has now trapped, congress. Congress has been put into the spotlight with the stimulus bill and the NDAA. Now people are watching to see how congress handles this.This is something they do not want, they are exposed. The EU begins to talk about the great reset, this is already failing.
TAKE A LISTEN
Welcome to 2020, when @JovanHPulitzer hacked a voting machine live during a government hearing and the press insists there is no evidence of election fraud.
Two months worth of fake talking points were just blown sky high.
Hutton said if state officials would simply allow investigators to physically examine the ballots, they could quickly determine if the ballots are counterfeit. Hutton says Georgia officials are dragging their feet and keeping the ballots hidden… Hutton says the physical evidence shows material differences in ballots, and investigators should focus on those differences: https://twitter.com/Wizard_Predicts/status/1344315322975875077
New Lott study estimates 11,350 absentee votes lost to Trump in Georgia. Another 289,000 "excess (fraudulent) votes" across GA, AZ, MI, NV, PA, and WI. Check it out!: https://twitter.com/realDonaldTrump/status/1344173684983017473
GA State Senate Judiciary Subcommittee unanimously pass motion to audit Fulton County's absentee ballots (see: State Vote Farm Arena). It follows the bombshell report of the live hack of Dominion by @JovanHPulitzer& would allow him to *audit the ballots.*
1:15 PM • Dec 30, 2020
Trump Campaign Takes Wisconsin Constitutional Fight to US Supreme Court — Challenging 50,000 Illegal Absentee Votes : https://www.thegatewaypundit.com/2020/12/trump-campaign-takes-wisconsin-constitutional-fight-us-supreme-court/
RAFFENSPERGER GETS CAUGHT: Georgia Ballots Were Printed DIFFERENTLY for GOP Counties vs. DEM Counties — Election Was Rigged! : https://www.thegatewaypundit.com/2020/12/raffensperger-gets-caught-georgia-ballots-printed-differently-gop-counties-vs-dem-counties-election-rigged
Jovan Pulitzer revealed the differences between votes printed for Democrat counties versus Republican counties.
The Republican counties had a barcode up in the right-hand corner.
The votes from two different counties are printed differently.
This caused GOP votes to get kicked out by the Dominion machines.
Secretary of State Raffensperger allowed this to take place
Georgia County Official: Raffensperger Sent Armed Secretary of State Agents with Handcuffs to the County After They Complained about the Inaccurate Dominion Machines (VIDEO) : https://www.thegatewaypundit.com/2020/12/georgia-county-official-raffensperger-sent-armed-secretary-state-agents-handcuffs-county-complained-inaccurate-dominion-machines-video/
Coffee County official spoke before Georgia’s Senate Judiciary Subcommittee on Elections. The woman told the subcommittee that when their county complained to Secretary of State Raffensperger about the voting machines and the recounts Secretary Raffensperger sent armed Secretary of State officials with handcuffs and two Dominion operators to the county.
She said Raffensperger was intentionally threatening the county officials.
McConnell Ties $2,000 Checks To Section 230 Repeal, Voter Fraud Investigation: https://dailycaller.com/2020/12/30/mcconnell-2000-checks-section-230-repeal-voter-fraud/
Senate Majority Leader Mitch McConnell introduced legislation authorizing direct cash payments of $2,000 , but tied it to a repeal of Section 230 and an investigation into the president’s allegations of voter fraud.
Democrats immediately criticized McConnell’s bill, calling it a “poison pill” and warning that it would fall short of the necessary support needed to pass.
I want businesses open. I want people working. I want society back: https://twitter.com/SydneyLWatson/status/1343771955418308611
Exactly!! Open your businesses NOW! This lockdown ends when enough people say they’ve had ENOUGH! Rob Schneider: https://twitter.com/RobSchneider/status/1344059728452747265
“Barack Obama was toppled from the top spot and President Trump claimed the title of the year’s Most Admired Man. Trump number one, Obama number two, and Joe Biden a very distant number three. That’s also rather odd given the fact that on November 3rd, Biden allegedly racked up millions more votes than Trump, but can’t get anywhere close to him in this poll. No incoming president has ever done as badly in this annual survey. That’s because he got millions of Fake Votes in the 2020 Election, which was RIGGED!”: https://twitter.com/realDonaldTrump/status/1344259405274087424
UBS Securities (subsidiary of UBS Group) gave Staple Street Capital, owner of Dominion, 400 million dollars in the weeks before the 2020 General Election. UBS group is a SWISS bank: https://twitter.com/CodeMonkeyZ/status/1344261205158858752
Scytl (Spanish company) is partnered with (and perhaps owned by) the SWISS Post: https://twitter.com/CodeMonkeyZ/status/1344261209298673671
Why does a SWISS BANK own the voting company that is one of the biggest voting companies in the US? Why does the SWISS POST count our votes through their partner in Spain? Switzerland held a secret meeting of world elites in 2019. Stacey Abrams was invited. Why?: https://twitter.com/CodeMonkeyZ/status/1344261210875707392
False Flags
Hospitals in COVID-19 hotspots to receive $10 billion more in federal aid: https://www.hfma.org/topics/news/2020/07/the-new-round-will-pay--50-000-per-covid-19-admission--compared-.html
More than 1,000 hospitals in high-impact areas will get a share of $10 billion in new federal assistance.
The new payments will be $50,000 per COVID-19 admission, less than the $77,000 in an earlier round.
Hospitals with large Medicaid populations have until Aug. 3 to apply for a separate pool of funds.
Hospitals that recently have submitted information on large COVID-19 caseloads could start to receive a share of $10 billion in new federal assistance this week.
The U.S. Department of Health and Human Services (HHS) announced it would begin sending payments July 20 to more than 1,000 hospitals in “high-impact” areas of the pandemic, based on the case count data they submitted in recent weeks.
That would add to the $10 billion HHS sent in May to hospitals that had more than 100 COVID-19 patients by April 10.
Hospitals will qualify for payments based on whether admissions between Jan. 1 and June 10 meet one of the following criteria:
More than 161 COVID-19 admissions
At least one COVID-19 admission per day
Higher than the national average ratio of COVID-19 admissions per bed
Amount of assistance reduced
The new round will pay $50,000 per COVID-19 admission, compared with $77,000 in the earlier high-impact round.
A senior HHS official said on a media call that the reduced funding is due to the number of such admissions surging from about 50,000 in the first round to more than 400,000 by the time of the second round.
The first-round payments went to 325 hospitals. The new round of payments will be “net from their payments — what they had already received” will be subtracted from their allocated total, the official said.
Pence’s final visit to Israel before leaving office is canceled: https://www.timesofisrael.com/pence-cancels-final-visit-to-israel-before-leaving-office
A planned visit to Israel by US Vice President Mike Pence was called off less than two weeks before he was due to arrive, the US Embassy confirmed Wednesday.No reason was given for the cancellation, which was first reported by the Ynet news site.Pence was reportedly scheduled to make a number of stops on a final world trip before leaving office on January 20. Earlier this month, Politico reported: https://www.politico.com/news/2020/12/17/pence-trump-election-loss-447326 that the vice president planned to take off on January 6 — the same day the US Congress is scheduled to confirm President-elect Joe Biden’s electoral victory — visiting a number of countries, including Israel from January 10 to 13.
All warfare is based on deception. Everybody assuming Trump hasn't been working furiously behinds the scenes to affect certain outcomes were wrong. They based their assumption Trump doing nothing & just hoping for the best on the surface of things. As they were supposed to. “Hold out baits to entice the enemy. Feign disorder, and crush him.”
https://twitter.com/BrianTh37895972/status/1344328567593820162, etc., etc....; All this documenting text and more: Text: https://archive.vn/wip/ni8i7; Videos: https://tinyurl.com/congr-owned (financial); https://tinyurl.com/slo-mo-2020 (Geopolitical). The [DS]/MSM has just been exposed. The idea that there is no such thing as election fraud and that the election systems are secure has just been debunked. GA held a hearing and now the GA lawmakers are looking into the ballots. The entire election scam is falling apart and those who [knowingly] participated are feeling the heat. Tick tock time is running out... Trump has now trapped, congress. Congress has been put into the spotlight with the stimulus bill and the NDAA. Now people are watching to see how congress handles this.This is something they do not want, they are exposed. The EU begins to talk about the great reset, this is already failing.
Updated Dec 30, 2020, 11:51 PM
Fernando Castro-Chavez added an item to the featured collection: The Times We Live.
Dec 30, 2020, 4:12 PM
"How can we account for our present situation unless we believe that men high in this Government are concerting to deliver us to disaster? This must be the product of a great conspiracy, a conspiracy on a scale so immense as to dwarf any previous such venture in the history of man - A conspiracy of infamy so black that, when it is finally exposed, its principals shall be forever deserving of the maledictions of all honest men." - Senator Joseph McCarthy https://youtu.be/lZKfT3brcZg
Updated Dec 30, 2020, 9:23 AM
Living the Current History Day by Day: Unraveling and un-spinning what the corrupt fake MSM and SM are scheming: "Democrats wanted to quickly pass a STANDALONE BILL giving every American $2,000. And the reason McConnell blocked it was because he wants a PACKAGE DEAL that includes the election fraud & revoking 230. It’s a GOOD THING Mitch blocked it" (and the MSM darkness to pretend rivalry within the good teams to divide citizens)!, https://twitter.com/realDonaldTrump/status/1343998076084748288; In the Gallup poll for Most Admired Man, Joe Biden received 6%… Yet he ("supposedly") got 80 million vote??? Soros (the same "animal" that is putting all his money in "hidden" schemes to oust Trump) hired and paid fake "immigrants" from the south and now is when they are trying to use that "card" once the COVID-19 failed them!!! NIST says: "“Dominion, Now the Largest or Second Largest Voting System Company, Is Foreign Controlled and Depends Upon Secret Source Code Created and Owned by Smartmatic, a Foreign Controlled Company With Ties to The Venezuelan Government Led by Hugo Chavez”": https://t.co/ThRgnig9i9, Ron, from Q, asks: "Did you know http://Dominionvoting.com/ shared an SSL certificate hosted on IPs based in multiple countries including Serbia, Canada, and the USA?", https://t.co/WBiHzBPOyc; the "inferno" of nepotism: "WOW! Georgia Judge Who Also Is Stacy Abrams’ Sister BLOCKS Elections Officials from Challenging Voters Who Live Outside of Registered District!: Judge Leslie A. Gardner blocked the Muscogee County Board of Elections and Registrations from keeping more than 4,000 “targeted voters” from casting ballots in the U.S. Senate runoff election on Jan. 5", that ridiculous hell needs to be legally stopped NOW!!!; Dave says: "The voters in question allegedly live outside of the jurisdictions in which they were registered — which would be an illegal vote! This move by Judge Gardner is promoting illegal votes." Trump says about that: "A group of Republican lawmakers in Pennsylvania say 200,000 more votes were counted in the 2020 Election than voters (100% went to Biden). State Representative Frank Ryan said they found troubling discrepancies after an analysis of Election Day data...” https://twitter.com/realDonaldTrump/status/1343919651336712199; however: "What’s This About? On January 6th, After Overseeing Declaration of the Winner of the 2020 Election, VP Pence Will Jump on a Plane and Fly Overseas" (If he attempts to do something wrong, do not let him, please, dear Mr. President), but of course, is coming from the corrupt MSM, maybe to confound?: https://www.nbcnewyork.com/news/business/money-report/mike-pence-to-head-overseas-hours-after-declaring-joe-biden-the-presidential-victor-over-donald-trump/2786788/; the AZ Rep. Part. says: "REPORT: @Twitter wants to cancel our official account. That’s too bad, and all because we support our President and care about #ElectionIntegrity! If that’s how it ends, know we love you all and you can follow us on Facebook (@ArizonaGOP), Instagram (@AZGOP), and Parler (@AZGOP)": https://twitter.com/AZGOP/status/1343959674677305345; "The NDAA was hijacked by the forever war lobby and their bought and paid for allies in the United States Congress... President @realDonaldTrump took a principled stand against this unprincipled legislation by vetoing it", says Rep. Matt Gaetz; also: "The Trump administration has beefed up an executive order banning U.S. investments in Chinese military companies, according to a notice posted by the Department of Treasury late on Monday evening. The November executive order prohibits exchange-traded funds and index funds from financing Chinese military companies and/or any related subsidiary companies", https://justthenews.com/politics-policy/trump-administration-fortifies-executive-order-banning-us-investment-chinese; "More than 1.5 billion face masks will pollute oceans this year, report says https://trib.al/1Pmi6uh", "BREAKING - San Diego County data for FLU infections shows **only 36 cases** so far this year. In a typical year we get over 17,073 on average! Once again, I'm calling for a full audit of the Covid-19 data we are seeing reported from our public health system", said Carl DeMaio, etc., etc. Video: https://tinyurl.com/trump-re-birthing-usa; text: https://archive.vn/cd5vS
Updated Dec 30, 2020, 8:10 AM
A great class with great principles, not only for teaching English but for life: "I always pray", to the great teacher policy of using English only in her class, this is my response as an International student: "...I will not be so strict in the only English policy because sometimes we can learn bunches of things by hearing how a word is known in another language, of course, keeping the international languages to a minimum, say, a maximum of a 3% of the class time, which is approximately 2.5 min. I will do that by putting a word under consideration, like the example that I, as a man of Faith, liked the most: "I Always Pray", and then to ask the students to go to the blackboard and put below the word "PRAY" in their own language, then putting in parenthesis after that their native language. I mean, me, as a teacher, will be more motivated to also learn from them at least a word a class from all of their languages per class!!!"
The Censored Video by Politician and Dr. Ron Paul, Dad of Rand: https://tinyurl.com/pls-fire-fauci from TX:
Updated Dec 29, 2020, 12:00 PM
"The [DS] plan to launder money to special interest groups has been BLOCKED by Trump, he used "the Impoundment control act" of 1974 to pause the funds from going overseas. We need to remember that we are still in "a national emergency" and Trump does have the ability to REALLOCATE these funds. The patriots are now preparing for Jan 6. Pence card has been put out there, but there are other paths to victory. Trump and the patriots are pushing all plans, following the constitution. No matter which one he chooses the [DS]/MSM will attack him and push their agenda. Trump and the patriots know this, they know their playbook. All is going according to plan, the constitution will bring down the [DS] and the MSM. This is not just election interference this is treason", says wise Dave. Text from: https://archive.vn/oBqTh , video at: https://tinyurl.com/01-06-2021 where we hear: "President Donald Trump has signed into law a $2.3 trillion coronavirus aid and government spending package aimed at restoring unemployment benefits to millions of Americans and averting a partial federal government shutdown": "As President, I have told Congress that I want far less wasteful spending and more money going to the American people in the form of $2,000 checks per adult and $600 per child. As President I am demanding many rescissions under the Impoundment Control Act of 1974. The Act provides that, “whenever the President determines that all or part of any budget authority will not be required to carry out the full objectives or scope of programs for which it is provided, or that such budget authority should be rescinded for fiscal policy or other reasons (including termination of authorized projects or activities for which budget authority has been provided), the President shall transmit to both Houses of Congress a special message” describing the amount to be reserved, the relevant accounts, the reasons for the rescission, and the economic effects of the rescission. 2 U.S.C. § 683. I will sign the Omnibus and Covid package with a strong message that makes clear to Congress that wasteful items need to be removed. I will send back to Congress a redlined version, item by item, accompanied by the formal rescission request to Congress insisting that those funds be removed from the bill. I am signing this bill to restore unemployment benefits, stop evictions, provide rental assistance, add money for PPP, return our airline workers back to work, add substantially more money for vaccine distribution, and much more. On Monday the House will vote to increase payments to individuals from $600 to $2,000. Therefore, a family of four would receive $5,200." He READS, not like "Congress" that just transfers whatever the Deep State wants for them to support for money. Further acts of greatness by our Wise President: Trump just signed an executive order to fund students directly if their school doesn’t reopen for in-person instruction.”These scholarships may be used for: (i) tuition and fees for a private or parochial school; (ii) homeschool, microschool, or learning-pod costs; (iii) special education and related services, including therapies; or (iv) tutoring or remedial education.” On the opposite side, the perverted and evil deals of darkness of that piece of scum of Biden (audio recording, Nov. 16, 2016): "Nov 16 2016 call between Biden & Poreshenko: Biden "I have been somewhat limited on what I'm able to tell their team [Trump team] about Ukraine...the incoming administration doesn't know a great deal about the situation... I don't plan on going away... As a private citizen (in 2016), I plan on staying deeply engaged in the endeavor that you have begun and we have begun...I'm worried since they don't know enough...They will question my motives...""", what a grand idiot!!! And meanwhile, more bombshells ready to explode keep on appearing regarding the most enormous vote fraud in human history, by the same idiot that declared the statements before: "Mathematician Bobby Piton Finds More Than 500,000 Unique Last Names in Pennsylvania: ‘Sophisticated State Actor Was Able to Optimize Desired Outcome’
Bobby Piton, the mathematician who testified at the Arizona voter fraud hearing dropped a bombshell this weekend.
Piton revealed this weekend that he examined just over 9 million records in Pennsylvania and has identified 521,879 unique last names.
In other words, these people have no parents, siblings, aunts, uncles or cousins who share the same last name (phantom voters).
Pennsylvania has 695,430 Fewer People in the top 1000 Last Names.
Bobby Piton found that there were fewer people with common surnames such as Smith, Jackson, Johnson. Bobby Piton essentially discovered where those 695,000+ illegal ballots came from in Pennsylvania.
President Trump was ahead of Joe Biden by over 700,000 votes on election night in Pennsylvania and within a few days after the election, hundreds of thousands of ballots appeared for Joe Biden.
Between 695,000 to 958,000 voters just got up and vanished out of Pennsylvania! Based on Piton’s findings, it appears that a centralized actor was calling the shots.
Bobby Piton says a sophisticated State Actor was able to optimize a desired outcome for both the state of Georgia and Pennsylvania." And so much more findings of that fraud, but you do NOT here any of these well documented real news in the prostituted corrupt MSM: "Evidence of Foreign Influence in 2020 Election: Nevada Secretary of State Caught Sending Voter Data List to Pakistani Firm Linked to ISI. Kavtech is a private Pakistani-based business intelligence firm with close ties to the Pakistani intelligence service, the ISI.", etc., etc., heavy loaded and good info. that is ignored by the frivolous and superficial average American!
The Co-Founder Waqas Butt is cc’d on emails containing personally identifiable voter information from the Nevada Secretary of State.
Catherine Engelbrecht is the Founder and President of True The Vote the nation’s largest voters’ rights group.
In November True the Vote wrote the Nevada Secretary of State for the eligible voter list report.
When the Secretary of State responded True the Vote was shocked to see that waqas@kavtech.net was cc’ed. "
Bobby Piton, the mathematician who testified at the Arizona voter fraud hearing dropped a bombshell this weekend.
Piton revealed this weekend that he examined just over 9 million records in Pennsylvania and has identified 521,879 unique last names.
In other words, these people have no parents, siblings, aunts, uncles or cousins who share the same last name (phantom voters).
Pennsylvania has 695,430 Fewer People in the top 1000 Last Names.
Bobby Piton found that there were fewer people with common surnames such as Smith, Jackson, Johnson. Bobby Piton essentially discovered where those 695,000+ illegal ballots came from in Pennsylvania.
President Trump was ahead of Joe Biden by over 700,000 votes on election night in Pennsylvania and within a few days after the election, hundreds of thousands of ballots appeared for Joe Biden.
Between 695,000 to 958,000 voters just got up and vanished out of Pennsylvania! Based on Piton’s findings, it appears that a centralized actor was calling the shots.
Bobby Piton says a sophisticated State Actor was able to optimize a desired outcome for both the state of Georgia and Pennsylvania." And so much more findings of that fraud, but you do NOT here any of these well documented real news in the prostituted corrupt MSM: "Evidence of Foreign Influence in 2020 Election: Nevada Secretary of State Caught Sending Voter Data List to Pakistani Firm Linked to ISI. Kavtech is a private Pakistani-based business intelligence firm with close ties to the Pakistani intelligence service, the ISI.", etc., etc., heavy loaded and good info. that is ignored by the frivolous and superficial average American!
The Co-Founder Waqas Butt is cc’d on emails containing personally identifiable voter information from the Nevada Secretary of State.
Catherine Engelbrecht is the Founder and President of True The Vote the nation’s largest voters’ rights group.
In November True the Vote wrote the Nevada Secretary of State for the eligible voter list report.
When the Secretary of State responded True the Vote was shocked to see that waqas@kavtech.net was cc’ed. "
Updated Dec 28, 2020, 7:31 PM
It’s for Mike Pence to Judge whether a Presidential Election Was Held at All, on January 6, a joint session of Congress will open with Vice President Pence presiding as president of the Senate. His power will be plenary and unappealable. You heard that right. As president of the Senate, every objection comes directly to him, and he can rule any objection “out of order” or “denied.” His task will be to fulfill his oath of office to protect and defend the Constitution of the United States and to ensure that the laws be faithfully executed. This is a high standard of performance, and V.P. Pence will have two choices. He can roll over on “certified” electors, or he can uphold the law, he will be presented with the sealed certificates containing the ballots of the presidential electors. At that moment, the Presidency will be in his hands. And there is nothing stopping Pence, under the (plenary and unappealable) authority vested in him as President of the Senate, from declining to open and count the certificates from the six disputed states... If the votes of all 7 contested states are registered as zero, President Trump will have 232 votes, Joe Biden will have 222... in plain language, Donald Trump will be re-elected, since he has a majority of the actual electoral votes. There will be no need to involve the House of Representatives to resolve a contingent election.then Attorney Sidney Powell released an explosive document of foreign interference: 270 pages of affidavits... military and alphabet testimony, and details everything from interference, to origins of voting machine fraud, to cybersecurity intrusions into U.S. elections systems and more... the president of the Senate is the final authority on any motions or objections during the vote-counting. There is no appeal. That doesn’t mean there won’t be any outrage. Whatever Pence does, people will be angry. But what does the law demand? Seven contested states clearly violated their own laws. An election is a process of counting votes for candidates. Only valid, lawful votes may be counted. A valid lawful vote is:
Cast by an eligible, properly registered elector as prescribed by laws enacted by the state Legislature.
Cast in a timely manner, as prescribed by laws enacted by the state Legislature.
Cast in a proper form as prescribed by laws enacted by the state Legislature.
Any process that does not follow these rules is not an election. Anything that proceeds from it cannot be regarded as having any lawful import.
Most commentators suggest that a process of collecting pieces of paper with marks on them is an election regardless of errors, omissions, and even deliberate malfeasance. This is a mistake. Imagine a golf tournament where every bad shot by one player gets a do-over, but the competing player has to follow USGA rules in detail. One player gets to drop freely out of hazards, but the other has to tackle every embedded ball as it lies. The result is a travesty.
The same thing applies to elections. If there are a handful of improper votes, we can suggest that there was in fact an election, perhaps tainted, but the election wasn’t materially harmed. But when the people charged with managing the election decide to ignore the law, whatever process they supervise is not the process defined by the law. Therefore, it is not an election...: https://tinyurl.com/2363b-x22 and its sources: https://archive.vn/7mrgH, where RINOs are denounced, such as: "If “free money” was truly Romney’s concern, why didn’t object to the massively ridiculous spending in the deal, which included millions for Swamp projects, like $10 million for “gender programs” in Pakistan? Instead, Romney voted for the “America Last” boondoggle, which included $135 million to Burma, $85 million for Cambodia, $130 million for Nepal, $700 million directed towards Sudan, and a cool $33 million for Venezuela. Only now that President Trump is pushing to raise the amount of direct payments to Americans has Romney suddenly become a budget hawk"... "Trump’s own team (NOT Trump himself) is feeding fake leaks about a White House locked in absolute chaos to the media. Fake leakers working for BOTH SIDES have been extremely busy this week. They’re going to get busier the closer we get to the key dates of Jan 5/6..."
Cast by an eligible, properly registered elector as prescribed by laws enacted by the state Legislature.
Cast in a timely manner, as prescribed by laws enacted by the state Legislature.
Cast in a proper form as prescribed by laws enacted by the state Legislature.
Any process that does not follow these rules is not an election. Anything that proceeds from it cannot be regarded as having any lawful import.
Most commentators suggest that a process of collecting pieces of paper with marks on them is an election regardless of errors, omissions, and even deliberate malfeasance. This is a mistake. Imagine a golf tournament where every bad shot by one player gets a do-over, but the competing player has to follow USGA rules in detail. One player gets to drop freely out of hazards, but the other has to tackle every embedded ball as it lies. The result is a travesty.
The same thing applies to elections. If there are a handful of improper votes, we can suggest that there was in fact an election, perhaps tainted, but the election wasn’t materially harmed. But when the people charged with managing the election decide to ignore the law, whatever process they supervise is not the process defined by the law. Therefore, it is not an election...: https://tinyurl.com/2363b-x22 and its sources: https://archive.vn/7mrgH, where RINOs are denounced, such as: "If “free money” was truly Romney’s concern, why didn’t object to the massively ridiculous spending in the deal, which included millions for Swamp projects, like $10 million for “gender programs” in Pakistan? Instead, Romney voted for the “America Last” boondoggle, which included $135 million to Burma, $85 million for Cambodia, $130 million for Nepal, $700 million directed towards Sudan, and a cool $33 million for Venezuela. Only now that President Trump is pushing to raise the amount of direct payments to Americans has Romney suddenly become a budget hawk"... "Trump’s own team (NOT Trump himself) is feeding fake leaks about a White House locked in absolute chaos to the media. Fake leakers working for BOTH SIDES have been extremely busy this week. They’re going to get busier the closer we get to the key dates of Jan 5/6..."
Updated Dec 27, 2020, 8:21 PM
A skit from SNL, at NY: https://youtu.be/ZD28LP01td0 (I was loking for the other "Subway" "Eat FLesh" skit, Hehee)
Updated Dec 27, 2020, 7:59 AM
Updated Dec 27, 2020, 12:04 AM
Updated Dec 26, 2020, 7:26 AM
Remembering, on this 25th of December> https://rumble.com/vc5r6z-melania-and-donald-trump-release-christmas-video-all-of-america-needs-to-se.html
Updated Dec 25, 2020, 2:31 PM
Fernando Castro-Chavez shared a memory.
1 year ago
Dedicated One Year Later To The Same One...:
The bold take of bringing truth, light versus lies and darkness is very heated. Here we are witnessing real history on the making, and not the corrupted "news" that are rather a "brainwash" against the good peoples of this Planet. Happy remembrances of our Savior Jesus Christ Now and Always!!! |
The bold take of bringing truth, light versus lies and darkness is very heated. Here we are witnessing real history on the making, and not the corrupted "news" that are rather a "brainwash" against the good peoples of this Planet. Happy remembrances of our Savior Jesus Christ Now and Always!!!
"We [The People] tried to play fair. We gave you all the chance to correct your misdeeds, but you continue to play dirty. You have no respect for the people and our Constitution. We are going to use the full extent of our Constitutional Power to demolish your stronghold. We [in The Mighty Spiritual Realm] KNOW everything. We SAW everything. We HEARD everything. You can run, but you cannot hide. The day of the reckoning is NOW! We're coming at you Constitutionally strong and mighty!!!" Posted by Lin(coln) Wood, a Q powerhouse (WWG1WGA) and a bold patriot worth to be linked here next: "TRUTH: Light always overcomes darkness. Truth always overcomes lies. “But he that doeth truth cometh to the light, that his deeds may be made manifest, that they are wrought in God.” - John 3:21" https://twitter.com/LLinWood/status/1276885076853379072 |
"We [The People] tried to play fair. We gave you all the chance to correct your misdeeds, but you continue to play dirty. You have no respect for the people and our Constitution. We are going to use the full extent of our Constitutional Power to demolish your stronghold. We [in The Mighty Spiritual Realm] KNOW everything. We SAW everything. We HEARD everything. You can run, but you cannot hide. The day of the reckoning is NOW! We're coming at you Constitutionally strong and mighty!!!" Posted by Lin(coln) Wood, a Q powerhouse (WWG1WGA) and a bold patriot worth to be linked here next: "TRUTH: Light always overcomes darkness. Truth always overcomes lies. “But he that doeth truth cometh to the light, that his deeds may be made manifest, that they are wrought in God.” - John 3:21" https://twitter.com/LLinWood/status/1276885076853379072
Updated down below. YouTube Removed my Research Regarding the Truth of The Second World War II, They Simply do NOT Want the Historical Truth Anymore, They Produced and Have Turned to the Fables That They Themselves Invented and With Whose They Indoctrinate The Future Generations, here is my set of links that "they themselves "HATE"" (Hehee): 1
https://ia800405.us.archive.org/11/items/PlanetRothschildPart1/planet%20rothschild%20part1.pdf,
2
https://ia800402.us.archive.org/9/items/PlanetrothschildPart2/planetrothschild%20part2.pdf
3
https://ia801304.us.archive.org/3/items/TheBadWarTheTruthNEVERTaughtAboutWorldWarII/TheBadWarTheTruthNeverTaughtAboutWorldWarIiversion2MikeKing.pdf
(https://ia801304.us.archive.org/3/items/TheBadWarTheTruthNEVERTaughtAboutWorldWarII/The%20Bad%20War%20-%20The%20Truth%20NEVER%20Taught%20About%20World%20War%20II.pdf)
4
http://the DASH eye DOT eu/public/concen.org/The%20British%20Mad%20Dog/British%20Mad%20Dog_%20Debunking%20the%20Myth%20of%20Winston%20Churchill%2C%20The%20-%20M.%20S.%20King.pdf
5
https://ia803200.us.archive.org/25/items/war-against-putin/War%20Against%20Putin-What%20the%20Government-Media%20Complex%20Isnt%20Telling%20You%20about%20Russia%2C%20The%20by%20M.%20S.%20King.pdf
6
God vs. Darwin
https://web.archive.org/web/20201127050743/https://media.8kun.top/file_dl/0509b530664e334f9cc3b696d89b49730484bdf438ba2852671a363bc4e7efb2.pdf (https://media.8kun.top/file_dl/0509b530664e334f9cc3b696d89b49730484bdf438ba2852671a363bc4e7efb2.pdf)
7
The Real Roosevelts
https://web.archive.org/web/20201127051739/https://media.8kun.top/file_dl/91bc33ee7c7e2e4fde07dfe8b3e5acb5093029a5fd3f8f67397040bb593dd743.pdf
(https://media.8kun.top/file_dl/91bc33ee7c7e2e4fde07dfe8b3e5acb5093029a5fd3f8f67397040bb593dd743.pdf)
8
https://web.archive.org/web/20201127052441/https://itsthetruthstupid.files.wordpress.com/2016/12/meinside.pdf
(https://itsthetruthstupid.files.wordpress.com/2016/12/meinside.pdf)
9
https://media1-production.mightynetworks.com/asset/5221933/ST_JOE_FINAL-1.pdf
10
https://www.realhistorychan.com/uploads/1/3/3/8/133840286/6x9_libtard.pdf
11
https://b DASH ok DOT lat/book/5216195/a865d3
12
https://deutschelobbyinfo.files.wordpress.com/2017/07/hitler_photos.pdf
https://web.archive.org/web/20201130211922/https://deutschelobbyinfo.files.wordpress.com/2017/07/hitler_photos.pdf
13
http://tomatobubble.com/sitebuildercontent/sitebuilderfiles/morphine_genocide.pdf
https://web.archive.org/web/20201101051553/http://tomatobubble.com/sitebuildercontent/sitebuilderfiles/morphine_genocide.pdf
14
http://strai8hts.com/pdfs/Climate-Change-Lie.pdf
https://web.archive.org/web/20201128015257/http://strai8hts.com/pdfs/Climate-Change-Lie.pd
Torrent:
https://concen.org/content/climate-bogeyman-criminal-insanity-global-warming-climate-change-hoax-2017
https://concen.org/sites/default/files/torrents/M.%20S.%20King%20-%20Climate%20Bogeyman%20-%20The%20Criminal%20Insanity%20of%20the%20Global%20Warming%2C%20Climate%20Change%20Hoax%20%282017%29%20pdf%20-%20roflcopter2110.torrent
15
Complete:
http://strai8hts.com/pdfs/Napoleon%20-%20Not%20The%20Ice%20Cream.pdf
(https://web.archive.org/web/20201128013617/http://strai8hts.com/pdfs/Napoleon%20-%20Not%20The%20Ice%20Cream.pdf)
(Excerpt)
http://lust-for-life.org/Lust-For-Life/_Textual/MSKing_NapoleonVersusTheOldAndNewWorldOrders_2016_31pp/MSKing_NapoleonVersusTheOldAndNewWorldOrders_2016_31pp.pdf
(https://web.archive.org/web/20201127202017/http://lust-for-life.org/Lust-For-Life/_Textual/MSKing_NapoleonVersusTheOldAndNewWorldOrders_2016_31pp/MSKing_NapoleonVersusTheOldAndNewWorldOrders_2016_31pp.pdf)
http://www.tomatobubble.com/sitebuildercontent/sitebuilderfiles/napoleon_vs_nwo_2016.pdf
16
https://c-cluster-110.uploads.documents.cimpress.io/v1/uploads/4e05ce3b-76b1-4b48-9b1a-830d91304651~110/original?tenant=vbu-digital
(https://web.archive.org/web/20201128011350/https://c-cluster-110.uploads.documents.cimpress.io/v1/uploads/4e05ce3b-76b1-4b48-9b1a-830d91304651~110/original?tenant=vbu-digital)
17 Genghis Monster (sudden download)
https://media.8kun.top/file_dl/6d859f217150c48715d2bb27be54a21db537cf124f589994b88fbd4758185d59.pdf
(https://web.archive.org/web/20201128011959/https://media.8kun.top/file_dl/6d859f217150c48715d2bb27be54a21db537cf124f589994b88fbd4758185d59.pdf)
18
https://files.secure.website/wscfus/10348600/7999579/interviewhitler.pdf
https://youtu.be/6kP8iQO3Mn0
19
http://strai8hts.com/pdfs/Andrew-Jackson.pdf
https://web.archive.org/web/20201128014516/http://strai8hts.com/pdfs/Andrew-Jackson.pdf
20
https://media.jthnx5wyvjvzsxtu.onion.pet/file_store/6600c6f05e09dfeef203ba59029c38b904be822b49a3d0c56d3deb77fbd75b2e.pdf
https://web.archive.org/web/20201128020108/https://media.jthnx5wyvjvzsxtu.onion.pet/file_store/6600c6f05e09dfeef203ba59029c38b904be822b49a3d0c56d3deb77fbd75b2e.pdf
21
https://media.jthnx5wyvjvzsxtu.onion.pet/file_store/58ce2a30e2509efbf1e94ac6139abc2b91d938392502020d1b23ca913bddafd0.pdf
https://web.archive.org/web/20201128020329/https://media.jthnx5wyvjvzsxtu.onion.pet/file_store/58ce2a30e2509efbf1e94ac6139abc2b91d938392502020d1b23ca913bddafd0.pdf
22
Excerpt on Woodrow Wilson:
https://media.jthnx5wyvjvzsxtu.onion.pet/file_store/8ab157a1fd147e93c329d94ff7dc3dc87da43e6e1797069f0cbcd820f89457c6.pdf
https://web.archive.org/web/20201128020729/https://media.jthnx5wyvjvzsxtu.onion.pet/file_store/8ab157a1fd147e93c329d94ff7dc3dc87da43e6e1797069f0cbcd820f89457c6.pdf
https://uploads.documents.cimpress.io/v1/uploads/6f4ff177-4bb9-4007-8ae3-98cb3561cef3~110/original?tenant=vbu-digital
23
"The Anti-New York Times" King PDF
https://www.pdfdrive.com/download.pdf?id=32387249&h=df1e610b353921c6891e46a7c1de776e&u=cache&ext=pdf
http://tomatobubble.com/id963.html
24
https://uploads.documents.cimpress.io/v1/uploads/17e1cde2-ed3c-4faf-8385-ca7769f3354b~110/original?tenant=vbu-digital
Interviews: Audio:
https://archive.org/details/MikeKingAndrewJacksonJosephMcCarthy
https://archive.org/details/MikeKingMichaelJacksonAndHitler
http://therealistreport.com/?s=Mike+S.+King
http://therealistreport.com/page/2/?s=Mike+S.+King
http://therealistreport.com/?s=TomatoBubble.com
http://therealistreport.com/page/2/?s=TomatoBubble.com
"Ike and McCarthy" Nichols PDF
https://www.pdfdrive.com/download.pdf?id=199765049&h=9661af4c24573cb5e3a8fb58d5eff547&u=cache&ext=pdf
https://www.archives.gov/files/publications/prologue/2015/fall/ike-mccarthy.pdf
Documentary Federal Reserve CFR The Global Elite: https://youtu.be/eb3Zaren9gg
Same DOCUMENTARY: The Council on Foreign Relations (CFR) and the American line James Perloff - The Best D
https://youtu.be/CyBCFvbU--Y
The New American
https://ia802802.us.archive.org/24/items/dayofdeceit/Day%20of%20deceit.pdf
https://www.nsa.gov/Portals/70/documents/news-features/declassified-documents/cryptologic-quarterly/pearlharbor.pdf, etc. with no end...
Update: Continuation of the Narrative:
25
https://www.bitchute.com/video/zJQFGwFnmYKB/
26
https://www.bitchute.com/video/9CsG72uXAk4R/
27
https://www.bitchute.com/video/PWnRT68PCAkB/
28
https://www.bitchute.com/video/hChVD37DY4di/
https://ia800405.us.archive.org/11/items/PlanetRothschildPart1/planet%20rothschild%20part1.pdf,
2
https://ia800402.us.archive.org/9/items/PlanetrothschildPart2/planetrothschild%20part2.pdf
3
https://ia801304.us.archive.org/3/items/TheBadWarTheTruthNEVERTaughtAboutWorldWarII/TheBadWarTheTruthNeverTaughtAboutWorldWarIiversion2MikeKing.pdf
(https://ia801304.us.archive.org/3/items/TheBadWarTheTruthNEVERTaughtAboutWorldWarII/The%20Bad%20War%20-%20The%20Truth%20NEVER%20Taught%20About%20World%20War%20II.pdf)
4
http://the DASH eye DOT eu/public/concen.org/The%20British%20Mad%20Dog/British%20Mad%20Dog_%20Debunking%20the%20Myth%20of%20Winston%20Churchill%2C%20The%20-%20M.%20S.%20King.pdf
5
https://ia803200.us.archive.org/25/items/war-against-putin/War%20Against%20Putin-What%20the%20Government-Media%20Complex%20Isnt%20Telling%20You%20about%20Russia%2C%20The%20by%20M.%20S.%20King.pdf
6
God vs. Darwin
https://web.archive.org/web/20201127050743/https://media.8kun.top/file_dl/0509b530664e334f9cc3b696d89b49730484bdf438ba2852671a363bc4e7efb2.pdf (https://media.8kun.top/file_dl/0509b530664e334f9cc3b696d89b49730484bdf438ba2852671a363bc4e7efb2.pdf)
7
The Real Roosevelts
https://web.archive.org/web/20201127051739/https://media.8kun.top/file_dl/91bc33ee7c7e2e4fde07dfe8b3e5acb5093029a5fd3f8f67397040bb593dd743.pdf
(https://media.8kun.top/file_dl/91bc33ee7c7e2e4fde07dfe8b3e5acb5093029a5fd3f8f67397040bb593dd743.pdf)
8
https://web.archive.org/web/20201127052441/https://itsthetruthstupid.files.wordpress.com/2016/12/meinside.pdf
(https://itsthetruthstupid.files.wordpress.com/2016/12/meinside.pdf)
9
https://media1-production.mightynetworks.com/asset/5221933/ST_JOE_FINAL-1.pdf
10
https://www.realhistorychan.com/uploads/1/3/3/8/133840286/6x9_libtard.pdf
11
https://b DASH ok DOT lat/book/5216195/a865d3
12
https://deutschelobbyinfo.files.wordpress.com/2017/07/hitler_photos.pdf
https://web.archive.org/web/20201130211922/https://deutschelobbyinfo.files.wordpress.com/2017/07/hitler_photos.pdf
13
http://tomatobubble.com/sitebuildercontent/sitebuilderfiles/morphine_genocide.pdf
https://web.archive.org/web/20201101051553/http://tomatobubble.com/sitebuildercontent/sitebuilderfiles/morphine_genocide.pdf
14
http://strai8hts.com/pdfs/Climate-Change-Lie.pdf
https://web.archive.org/web/20201128015257/http://strai8hts.com/pdfs/Climate-Change-Lie.pd
Torrent:
https://concen.org/content/climate-bogeyman-criminal-insanity-global-warming-climate-change-hoax-2017
https://concen.org/sites/default/files/torrents/M.%20S.%20King%20-%20Climate%20Bogeyman%20-%20The%20Criminal%20Insanity%20of%20the%20Global%20Warming%2C%20Climate%20Change%20Hoax%20%282017%29%20pdf%20-%20roflcopter2110.torrent
15
Complete:
http://strai8hts.com/pdfs/Napoleon%20-%20Not%20The%20Ice%20Cream.pdf
(https://web.archive.org/web/20201128013617/http://strai8hts.com/pdfs/Napoleon%20-%20Not%20The%20Ice%20Cream.pdf)
(Excerpt)
http://lust-for-life.org/Lust-For-Life/_Textual/MSKing_NapoleonVersusTheOldAndNewWorldOrders_2016_31pp/MSKing_NapoleonVersusTheOldAndNewWorldOrders_2016_31pp.pdf
(https://web.archive.org/web/20201127202017/http://lust-for-life.org/Lust-For-Life/_Textual/MSKing_NapoleonVersusTheOldAndNewWorldOrders_2016_31pp/MSKing_NapoleonVersusTheOldAndNewWorldOrders_2016_31pp.pdf)
http://www.tomatobubble.com/sitebuildercontent/sitebuilderfiles/napoleon_vs_nwo_2016.pdf
16
https://c-cluster-110.uploads.documents.cimpress.io/v1/uploads/4e05ce3b-76b1-4b48-9b1a-830d91304651~110/original?tenant=vbu-digital
(https://web.archive.org/web/20201128011350/https://c-cluster-110.uploads.documents.cimpress.io/v1/uploads/4e05ce3b-76b1-4b48-9b1a-830d91304651~110/original?tenant=vbu-digital)
17 Genghis Monster (sudden download)
https://media.8kun.top/file_dl/6d859f217150c48715d2bb27be54a21db537cf124f589994b88fbd4758185d59.pdf
(https://web.archive.org/web/20201128011959/https://media.8kun.top/file_dl/6d859f217150c48715d2bb27be54a21db537cf124f589994b88fbd4758185d59.pdf)
18
https://files.secure.website/wscfus/10348600/7999579/interviewhitler.pdf
https://youtu.be/6kP8iQO3Mn0
19
http://strai8hts.com/pdfs/Andrew-Jackson.pdf
https://web.archive.org/web/20201128014516/http://strai8hts.com/pdfs/Andrew-Jackson.pdf
20
https://media.jthnx5wyvjvzsxtu.onion.pet/file_store/6600c6f05e09dfeef203ba59029c38b904be822b49a3d0c56d3deb77fbd75b2e.pdf
https://web.archive.org/web/20201128020108/https://media.jthnx5wyvjvzsxtu.onion.pet/file_store/6600c6f05e09dfeef203ba59029c38b904be822b49a3d0c56d3deb77fbd75b2e.pdf
21
https://media.jthnx5wyvjvzsxtu.onion.pet/file_store/58ce2a30e2509efbf1e94ac6139abc2b91d938392502020d1b23ca913bddafd0.pdf
https://web.archive.org/web/20201128020329/https://media.jthnx5wyvjvzsxtu.onion.pet/file_store/58ce2a30e2509efbf1e94ac6139abc2b91d938392502020d1b23ca913bddafd0.pdf
22
Excerpt on Woodrow Wilson:
https://media.jthnx5wyvjvzsxtu.onion.pet/file_store/8ab157a1fd147e93c329d94ff7dc3dc87da43e6e1797069f0cbcd820f89457c6.pdf
https://web.archive.org/web/20201128020729/https://media.jthnx5wyvjvzsxtu.onion.pet/file_store/8ab157a1fd147e93c329d94ff7dc3dc87da43e6e1797069f0cbcd820f89457c6.pdf
https://uploads.documents.cimpress.io/v1/uploads/6f4ff177-4bb9-4007-8ae3-98cb3561cef3~110/original?tenant=vbu-digital
23
"The Anti-New York Times" King PDF
https://www.pdfdrive.com/download.pdf?id=32387249&h=df1e610b353921c6891e46a7c1de776e&u=cache&ext=pdf
http://tomatobubble.com/id963.html
24
https://uploads.documents.cimpress.io/v1/uploads/17e1cde2-ed3c-4faf-8385-ca7769f3354b~110/original?tenant=vbu-digital
Interviews: Audio:
https://archive.org/details/MikeKingAndrewJacksonJosephMcCarthy
https://archive.org/details/MikeKingMichaelJacksonAndHitler
http://therealistreport.com/?s=Mike+S.+King
http://therealistreport.com/page/2/?s=Mike+S.+King
http://therealistreport.com/?s=TomatoBubble.com
http://therealistreport.com/page/2/?s=TomatoBubble.com
"Ike and McCarthy" Nichols PDF
https://www.pdfdrive.com/download.pdf?id=199765049&h=9661af4c24573cb5e3a8fb58d5eff547&u=cache&ext=pdf
https://www.archives.gov/files/publications/prologue/2015/fall/ike-mccarthy.pdf
Documentary Federal Reserve CFR The Global Elite: https://youtu.be/eb3Zaren9gg
Same DOCUMENTARY: The Council on Foreign Relations (CFR) and the American line James Perloff - The Best D
https://youtu.be/CyBCFvbU--Y
The New American
https://ia802802.us.archive.org/24/items/dayofdeceit/Day%20of%20deceit.pdf
https://www.nsa.gov/Portals/70/documents/news-features/declassified-documents/cryptologic-quarterly/pearlharbor.pdf, etc. with no end...
Update: Continuation of the Narrative:
25
https://www.bitchute.com/video/zJQFGwFnmYKB/
26
https://www.bitchute.com/video/9CsG72uXAk4R/
27
https://www.bitchute.com/video/PWnRT68PCAkB/
28
https://www.bitchute.com/video/hChVD37DY4di/
Update: Adding an extra bit of information, we can see that the 23.12% (https://archive.vn/GUrAi) of the US population is younger than the age to vote (18), this means that 76,740,671 citizens of the US are still unable to vote, so, only counting the ones able to vote, by Oct., 2020, we have that supposedly the 62.67% of the voting population of the US voted on 2020. Does that make sense? Furthermore, my comment on his site (do the Math, do your own analysis by yourself to be fully convinced of the intolerable fraud committed by the Career Democrats and their Handlers): "Current total US population (and growing every second): 331,940,546 (https://www.worldometers.info/world-population/us-population), on the 19th of October, 2020 there were (deduct some 200,000 to the date of today, thinking of some 3,000 babies born every day in the US) ~ 331,740,000. Registered voters at Oct., 2020: 118,755,704 (https://archive.vn/fnuLk), supposed number of people voting in the 2020 Presidential Election: 159,800,000 (https://archive.vn/4QajR), this means that 41,044,296 of extra voters rushed to register after October and that all the previous registered voters all of them voted with no exception, does that make any sense? (Or is better understood by the Rampant Fraud Perpetrated by Biden and his global banking handlers???)." https://www.facebook.com/DonaldTrump/videos/436515744393744/
Updated Dec 23, 2020, 2:13 PM
The update of today presents the work that is being done by independent Patriots in support for the Truth, signaling the evident proofs of fraud and how corrupt individuals are looking to the other side, but how is it that they will not prevail, and that once they are lost and want to resort (being paid by Soros and the Globalist Banksters) to insurrection, riots and even attempting against the current president Trump, Pence and his faithful soldiers have the precise plan to restrain them. An invitation is made by Trump for all the Patriots to gather in DC on the 6th of January, the same day that the traitors were attempting a "coup"... and many more things... |
The update of today presents the work that is being done by independent Patriots in support for the Truth, signaling the evident proofs of fraud and how corrupt individuals are looking to the other side, but how is it that they will not prevail, and that once they are lost and want to resort (being paid by Soros and the Globalist Banksters) to insurrection, riots and even attempting against the current president Trump, Pence and his faithful soldiers have the precise plan to restrain them. An invitation is made by Trump for all the Patriots to gather in DC on the 6th of January, the same day that the traitors were attempting a "coup"... and many more things...
Updated Dec 21, 2020, 10:59 PM
The discoveries of fraud keep on piling up on a daily basis, while the corrupt media, here and there, paid by the banksters, keeps on doing the fabled ostrich hide, but how long?: Kanekoa asks: "When you win a record low 17% of counties, lose Black & Hispanic support, lose 18/19 Bellwether Counties, lose Ohio, Florida, & Iowea - and lose 27/27 Hose "Toss-Ups" - but you shatter the popular vote record..."? (Obama 69M Votes, 873 Counties; Trump: 74M Votes, 2,497 Counties; Biden: 81M Votes??? 477 Counties). Meanwhile Bill Binney, a Constitutional Patriot, does simple maths, and he wrote: Point 39 demonstrating the Biden Fraud: With 212 Million registered voters and 66.2% voting, 140,344 M voted. Now, if Trump got 74 M, that leaves only 66,344 M for Biden. These numbers don't add up to what we are being told. Lies and more Lies!... in the meantime Pence and his faithful soldiers are getting fully prepared to prevent a paid by Soros and the Globalists, artificial "insurrection" by the likes of Antifa and BLM once it is established in January that Biden committed the most rampant, despicable and absurd voting fraud in the whole history of any nation... a total shame... |
The discoveries of fraud keep on piling up on a daily basis, while the corrupt media, here and there, paid by the banksters, keeps on doing the fabled ostrich hide, but how long?: Kanekoa asks: "When you win a record low 17% of counties, lose Black & Hispanic support, lose 18/19 Bellwether Counties, lose Ohio, Florida, & Iowea - and lose 27/27 Hose "Toss-Ups" - but you shatter the popular vote record..."? (Obama 69M Votes, 873 Counties; Trump: 74M Votes, 2,497 Counties; Biden: 81M Votes??? 477 Counties). Meanwhile Bill Binney, a Constitutional Patriot, does simple maths, and he wrote: Point 39 demonstrating the Biden Fraud: With 212 Million registered voters and 66.2% voting, 140,344 M voted. Now, if Trump got 74 M, that leaves only 66,344 M for Biden. These numbers don't add up to what we are being told. Lies and more Lies!... in the meantime Pence and his faithful soldiers are getting fully prepared to prevent a paid by Soros and the Globalists, artificial "insurrection" by the likes of Antifa and BLM once it is established in January that Biden committed the most rampant, despicable and absurd voting fraud in the whole history of any nation... a total shame...
The current scientific "advance" is to the point of controlling your brain and emotions through an electronic implant within it, called such "treatment" with awful implications a "Deep Brain Stimulation", with the excuse of treating and controlling "Parkinson", other humans have already figured out how to control your "feelings", think about the implications of a sinister brain like that of Gates and his attempts to introduce his software within humans!, currently doctors can already do such controls of the brain, and Gates wants to be ahead of that "game" through his other "healthy" pretext of a "Digital Certificate of Vaccination", his "Passport of Immunity" or any other name in disguise of the crazy globalist attempt to track and control every single individual over the face of the earth through inserting an implant within humans themselves!:
Updated Dec 21, 2020, 12:06 AM
The progress of the evaluation of voting fraud and the official awareness of preventing a provoked "insurrection" once it is fully established that the apparently win of Biden was fraudulent, not a "martial" law, that is NOT the path! And the example of Andrew Jackson of defunding the Central Bank (currently and also falsely known as the "Fed", as it is a private, invading and foreign institution just established by the Banksters-Rothsch-Ziono, to rob the Americans through their high interests that it charges to the banks that receive their tainted and filled with their symbolisms"tender"): |
The progress of the evaluation of voting fraud and the official awareness of preventing a provoked "insurrection" once it is fully established that the apparently win of Biden was fraudulent, not a "martial" law, that is NOT the path! And the example of Andrew Jackson of defunding the Central Bank (currently and also falsely known as the "Fed", as it is a private, invading and foreign institution just established by the Banksters-Rothsch-Ziono, to rob the Americans through their high interests that it charges to the banks that receive their tainted and filled with their symbolisms"tender"):
Mi más reciente lectura, que básicamente completa los eventos de la Verdad Detrás de la Segunda Guerra Mundial y nos proyecta hasta los tiempos actuales, como siempre, queda material para continuar:
Updated Dec 20, 2020, 11:00 PM
A clever way to demonstrate the rampant and illegal censorship against the truth by the corrupted "Big Tech", to open the eyes to those still out there that blindly believe the crap tossed at them by the 100% biased (for more than 200 years) MSM: https://youtu.be/RGxbaxviRVw
Updated Dec 20, 2020, 4:58 PM
A Wake Up Call, Not To Get Stung By An "Experimental" Piece Of...: |
A Wake Up Call, Not To Get Stung By An "Experimental" Piece Of...:
A real good human hero, a good Hebrew from NY, Vladimir (Zev) Zelenko, who helped Giuliani and even Trump to heal from their COVID-19 infection with his amazing treatment, hinted and then seen from Minute 58:30 (of said link: https://tinyurl.com/C19VaccPitfallsStart, very recommended the whole program), this is the cure no need at all of the crippling "big sting":
Progress of Today: |
Progress of Today:
Keeping track of history on a daily basis, of these awful times that we all are living, and to demonstrate how the ones that belong to God, can really make a difference while they are still around!!! Keeping the records, past and present, straight!!! |
Keeping track of history on a daily basis, of these awful times that we all are living, and to demonstrate how the ones that belong to God, can really make a difference while they are still around!!! Keeping the records, past and present, straight!!!
Living vital historical moments, preserving the history of today for posterity, the legal fight for justice and the counting of only the legal, and not of the fraudulent ones! the refusal by the crooked ones to do so, the caving-in of the compromised against America, and some manipulators headed to jail while others in jail headed to clearing their acts... all so intense happening here and now, but a very corrupt TV since long ago is not showing you on a timely basis the truth!!! Until also tossed aside and pressed upon by the honest citizens for the truth! |
Living vital historical moments, preserving the history of today for posterity, the legal fight for justice and the counting of only the legal, and not of the fraudulent ones! the refusal by the crooked ones to do so, the caving-in of the compromised against America, and some manipulators headed to jail while others in jail headed to clearing their acts... all so intense happening here and now, but a very corrupt TV since long ago is not showing you on a timely basis the truth!!! Until also tossed aside and pressed upon by the honest citizens for the truth!
In the messages of Trump during these four years, both for Christmas and for Easter, he remind us that Jesus is OUR Savior, Our Hope, Our Lord, and Our Redeemer!!!: https://youtu.be/4RovAF-EeUQ, has any other president really done that? Reminding us of our Brother and Friend Jesus in the most important celebrations of the year??? (And he really means it!)
Updated Dec 15, 2020, 8:27 PM
So, after we reported yesterday that the tainted SolarWinds software was behind the "Dominion" Voting machines that deliberately shifted votes from Trump to Biden and that eliminated thousands of votes for Trump on purpose, by design within its algorithms, they maliciously removed that final line from their pages!!! Here we see that Trump has all the winning cards in his hand, just as he had them when they tried to "impeach" him unlawfully or when they wasted the American Citizens money on the "Russian INterference" investigation. He knows with what kind of scum he is dealing, and he wants to geth them all together to indicte and defeat them! |
So, after we reported yesterday that the tainted SolarWinds software was behind the "Dominion" Voting machines that deliberately shifted votes from Trump to Biden and that eliminated thousands of votes for Trump on purpose, by design within its algorithms, they maliciously removed that final line from their pages!!! Here we see that Trump has all the winning cards in his hand, just as he had them when they tried to "impeach" him unlawfully or when they wasted the American Citizens money on the "Russian INterference" investigation. He knows with what kind of scum he is dealing, and he wants to geth them all together to indicte and defeat them!
Mi transmisión de hoy a favor de la verdad y para entender lo que está sucediendo hoy (a pesar de los medios fraudulentos, que entonces como hoy, engañan aún a presidentes como el de Rusia y al de México, pero aún no termina la búsqueda de la verdad): https://www.youtube.com/watch?v=WSr-KhRGz4s
Updated Dec 15, 2020, 2:47 PM
Update: 01/11/21, In search of more freedom, I also joined Gab: https://gab.com/fdocc due to the usual monopolistic bullies falling also hard against "Parler" on these days: https://parler.com/profile/Fdocc/posts, and reminding you that my eMail, that is also present in all my research Articles, is fdocc@yahoo.com, in case these crazy sites blackout and keep on censoring at the style of the CCP. This is my profile statement there: "I love freedom, and right now, the globalists are enslaving us, censoring us, and diminishing completely the meaning of individual, of independence, of anything for which our Founding Fathers fought!!", and my first post there: "This is my first message here, I am tired of the absurd censorship of all the others (YT, FB, Twitter...) that think that they are "big", and they are really NOTHING without the people, my research going on is about the evidently artificial nature of COVID-19: As seen in my RG: https://www.researchgate.net/post/Third-Sequence-COVID-19-AATGGTACTAAGAGG-HIV-1-isolate-1966324H9-from-Netherlands-envelope-glycoprotein-env-gene-sequence-ID-GU4555031 and in my Article, entitled, for you to search it if you want, as the link has failed to be posted right "Anticovidian v.2 COVID-19: Hypothesis of the Lab Origin Versus a Zoonotic Event which can also be of a Lab Origin": https://zenodo.org/record/3988139 that Fauci did not like, thus deleting three of my previous works that were already at the PubMed on his absurd basis of being publications "after the expiration of my grants", a ridiculous, very harmful globalist that he is..."
SolarWinds the hacked software exposed, to scare and justify the Social Media blackouts, now NASA, serving the same scummers, is warning of real ones from around the 16th and 22th of the current December, 2020... Correcting all those broken records with our Founding Fathers!!! |
SolarWinds the hacked software exposed, to scare and justify the Social Media blackouts, now NASA, serving the same scummers, is warning of real ones from around the 16th and 22th of the current December, 2020... Correcting all those broken records with our Founding Fathers!!!
... and then today: |
... and then today:
April 27, 2016, Washington, D.C.: "We will no longer surrender this country or its people to the false song of globalism. The nation-state remains the true foundation of happiness and harmony. I am skeptical of international unions that tie us up and bring America down. And under my administration, we will never enter America into any agreement that reduces our ability to control our own affairs." D. J. T. (And this is the reason why the Zio-Rothsch-Banksters hate him since before the start!). Portion expanded at: https://youtu.be/EOyma_8dFm0 |
April 27, 2016, Washington, D.C.: "We will no longer surrender this country or its people to the false song of globalism. The nation-state remains the true foundation of happiness and harmony. I am skeptical of international unions that tie us up and bring America down. And under my administration, we will never enter America into any agreement that reduces our ability to control our own affairs." D. J. T. (And this is the reason why the Zio-Rothsch-Banksters hate him since before the start!). Portion expanded at: https://youtu.be/EOyma_8dFm0
Continuando con el estudio acerca de la verdad detrás de la Segunda Guerra Mundial, aquí lo tenemos hasta donde lo dejen, para que ustedes por su cuenta sigan investigando: https://youtu.be/mB7VZpZiLH0
Updated Dec 10, 2020, 10:36 AM
Well. the news today are that Trump and 17 States have joined the Lawsuit by Texas against the four most cheating States. And in this very same day the most corrupt people at YT announces that starting today, the most rampant censorship there will forbid strictly anybody from presenting the truth that Biden commited the most devastating fraud in the history of the US. The Ziono-Rostch-Baksters want Biden in "power" as another dupe of them, as the numerous of the past, to continue with their agenda of the NWO... but we, Body of Christ, are still here to stop them even if they block the truth from every single platform of their Zoo-cial 1/2... |
Well. the news today are that Trump and 17 States have joined the Lawsuit by Texas against the four most cheating States. And in this very same day the most corrupt people at YT announces that starting today, the most rampant censorship there will forbid strictly anybody from presenting the truth that Biden commited the most devastating fraud in the history of the US. The Ziono-Rostch-Baksters want Biden in "power" as another dupe of them, as the numerous of the past, to continue with their agenda of the NWO... but we, Body of Christ, are still here to stop them even if they block the truth from every single platform of their Zoo-cial 1/2...
The big story today of the Biden Most Rampant Fraud is that Texas is suing the four most cheating States, go texans!!!our |
The big story today of the Biden Most Rampant Fraud is that Texas is suing the four most cheating States, go texans!!!our
By the means of Tina Bain, a hero and a Patriot of Justice, wrote in part:
"Hi All, I am not on a Facebook user, my partner is. Colin Wyse (CueAnon).
I,,,my only goal is to get this truth out. I think we have the Covid fraud worldwide to be used to beat Trump. The irony is the election hysteria is stifling Covid.
Found an ally in Robin Monotti, an Italian Architect who is trying to tell the world that Dr Stefano Scoglio has reached the same conclusion as Dr Castro-Chavez. (wish you had a shorter name, Hehee).
Anna Brees knows about your Hypothesis but she was threatened. ( I haven't told anyone this)."
Very interesting post! Yes, also my works, three of them that were in PubMed, as punisment for doing my research, have been removed, this accumulated with other evidence indicates that Fauci is all in for this NWO globalistic attempt of the World Bankers (read: Ziono-Rotsch) to take over the world economy and governments, and even "religion". The last great work that I recommend is one that was also peer-reviewed and accepted, for publication, done by some of my "brethren in arms", Drs. Deigin and Segreto: https://onlinelibrary.wiley.com/doi/10.1002/bies.202000240
"Hi All, I am not on a Facebook user, my partner is. Colin Wyse (CueAnon).
I,,,my only goal is to get this truth out. I think we have the Covid fraud worldwide to be used to beat Trump. The irony is the election hysteria is stifling Covid.
Found an ally in Robin Monotti, an Italian Architect who is trying to tell the world that Dr Stefano Scoglio has reached the same conclusion as Dr Castro-Chavez. (wish you had a shorter name, Hehee).
Anna Brees knows about your Hypothesis but she was threatened. ( I haven't told anyone this)."
Very interesting post! Yes, also my works, three of them that were in PubMed, as punisment for doing my research, have been removed, this accumulated with other evidence indicates that Fauci is all in for this NWO globalistic attempt of the World Bankers (read: Ziono-Rotsch) to take over the world economy and governments, and even "religion". The last great work that I recommend is one that was also peer-reviewed and accepted, for publication, done by some of my "brethren in arms", Drs. Deigin and Segreto: https://onlinelibrary.wiley.com/doi/10.1002/bies.202000240
Updated Dec 8, 2020, 2:22 PM
As David says: "...the case is overwhelming, white hat hackers have the evidence, the tide is turning, Trump and the patriots sent a message, big things are about to happen, buckle up countermeasures are coming." Then,,something very timely that is covered here: https://ust-edu-ph.zoom.us/j/8992208601?pwd=Rzk0UVdzbDkwTi9FdlhiSXV5UmQ4dz09 and https://m.washingtontimes.com/news/2020/oct/29/zuckerberg-paying-election-operations-vote-countin/, sooner or later those B...tards will pay for their lies and that knowingly, suppress the truth!!! But, people is not stupid, it has means to circumvent censure, or are you not reading and watching at this video still here??? Hehee |
As David says: "...the case is overwhelming, white hat hackers have the evidence, the tide is turning, Trump and the patriots sent a message, big things are about to happen, buckle up countermeasures are coming." Then,,something very timely that is covered here: https://ust-edu-ph.zoom.us/j/8992208601?pwd=Rzk0UVdzbDkwTi9FdlhiSXV5UmQ4dz09 and https://m.washingtontimes.com/news/2020/oct/29/zuckerberg-paying-election-operations-vote-countin/, sooner or later those B...tards will pay for their lies and that knowingly, suppress the truth!!! But, people is not stupid, it has means to circumvent censure, or are you not reading and watching at this video still here??? Hehee
In Memoriam... |
In Memoriam...
https://www.politico.com/video/2020/12/04/trump-gives-remarks-for-the-annual-white-house-christmas-tree-lighting-102665, but the important part is left out, the message of Jesus our Savior!!!, that you can see from his previous years in Presidential Office at: https://youtu.be/Mtu3ombsV48, starting at min. 11:04; also this one, was weighted and fell short: https://www.cbsnews.com/video/national-christmas-tree-lighting-2020-white-house/
Updated Dec 7, 2020, 1:20 AM
The additional evidence presented today of the rampant voting fraud by Biden in the prejudice of Trump: "Robb Hurst declares: Ware County, GA, has broken the Dominion algorithm: Using sequestered Dominion Equipment, Ware County ran a equal number of Trump votes and Biden votes through the Tabulator and the Tabulator reported a 26% lead for Biden. 37 Trump votes used in the equal sample run had been “Switched” from Trump to Biden. In actual algorithmic terms this means that a vote for Trump was counted as 87% of a vote and a vote for Biden was counted as 113% of a vote. Those conducting the test were so shocked that they ran the same ballots again. The same results appeared. ONE PIECE OF THE PUZZLE SOLVED. (It is worth noting that this was one County, and on one Tabulator alone. Dominion Tabulators could have been configured with different algorithms in different Counties or States.) The use of illegal and/or fabricated ballots is an additional issue altogether, but this is sufficient evidence to question the validity of the ENTIRE Election in the 28 states that used Dominion software. Source: Debbie Browning Tift Co. Republican Party." David, the analyst declares: "...The fraud that is being presented is unprecedented. The states are now ordering signature verifications, Trump and team are analyzing the Dominion voting systems and video has been coming out documenting the fraud.The world is watching..." |
The additional evidence presented today of the rampant voting fraud by Biden in the prejudice of Trump: "Robb Hurst declares: Ware County, GA, has broken the Dominion algorithm: Using sequestered Dominion Equipment, Ware County ran a equal number of Trump votes and Biden votes through the Tabulator and the Tabulator reported a 26% lead for Biden. 37 Trump votes used in the equal sample run had been “Switched” from Trump to Biden. In actual algorithmic terms this means that a vote for Trump was counted as 87% of a vote and a vote for Biden was counted as 113% of a vote. Those conducting the test were so shocked that they ran the same ballots again. The same results appeared. ONE PIECE OF THE PUZZLE SOLVED. (It is worth noting that this was one County, and on one Tabulator alone. Dominion Tabulators could have been configured with different algorithms in different Counties or States.) The use of illegal and/or fabricated ballots is an additional issue altogether, but this is sufficient evidence to question the validity of the ENTIRE Election in the 28 states that used Dominion software. Source: Debbie Browning Tift Co. Republican Party." David, the analyst declares: "...The fraud that is being presented is unprecedented. The states are now ordering signature verifications, Trump and team are analyzing the Dominion voting systems and video has been coming out documenting the fraud.The world is watching..."
La presentación que hice que me cortaron cuando iba a la mitad (su video, pero la voz me la cortaron desde el minuto 30, cuando iba a traducir la siguiente expresión, escrita en 1924: "Este trabajo... me asistirá en demoler las falsedades acerca de mí creadas por la prensa...", agregando cuál prensa, la Ziono-Roth-Bnk-Jw, exactamente como en el día de hoy!!! 2020, 96 años después!!!), véanla antes de que sea removida:
Updated Dec 5, 2020, 6:54 PM
Details more specific are being presented in the courts as days go by:
2,506 felons voted.
66,248 underage registered.
2,423 voted w/out registration.
1,043 address a Post-Office.
4,926 registered late.
10,315 dead people.
395 cast ballots in another state.
15,700 filed national change of address.
40,279 moved.
100+ affidavits.
With the false pretense of a "Water Main Break at State Farm Arena"... video footage was capable to show that in the voting places everyone was cleared out "including Republican observers", but 4 people stayed behind!!!, pull suitcases filled with ballots from under a table, & continued to count ballots in private from around 10:30 PM until 1 AM, if 6,000 ballots fit in each of those suitcases and there were four suitcases, those four individuals added some 24,000 votes all for Biden during that time!!!, etc., etc., etc., as I have said before, the information is getting more detailed and longer and longer as the days are passing, and for the 19th of this month of Dec., 2020, there where an alud of information regarding the voting fraud perpetrated for Biden is fully exposed...
The gifted author of the video declares: "...the evidence is pouring out and nothing can stop this. People are seeing it, they are now experiencing" the full exposure, in the US, of rampant "fraud for the first time. [DS] panics, sends a message, GA is in the crosshairs. Everything is about to change, the truth is about to come out. The tide is turning." To see more of the profound insight of David, go to: https://rumble.com/c/X22Report |
Details more specific are being presented in the courts as days go by:
2,506 felons voted.
66,248 underage registered.
2,423 voted w/out registration.
1,043 address a Post-Office.
4,926 registered late.
10,315 dead people.
395 cast ballots in another state.
15,700 filed national change of address.
40,279 moved.
100+ affidavits.
With the false pretense of a "Water Main Break at State Farm Arena"... video footage was capable to show that in the voting places everyone was cleared out "including Republican observers", but 4 people stayed behind!!!, pull suitcases filled with ballots from under a table, & continued to count ballots in private from around 10:30 PM until 1 AM, if 6,000 ballots fit in each of those suitcases and there were four suitcases, those four individuals added some 24,000 votes all for Biden during that time!!!, etc., etc., etc., as I have said before, the information is getting more detailed and longer and longer as the days are passing, and for the 19th of this month of Dec., 2020, there where an alud of information regarding the voting fraud perpetrated for Biden is fully exposed...
The gifted author of the video declares: "...the evidence is pouring out and nothing can stop this. People are seeing it, they are now experiencing" the full exposure, in the US, of rampant "fraud for the first time. [DS] panics, sends a message, GA is in the crosshairs. Everything is about to change, the truth is about to come out. The tide is turning." To see more of the profound insight of David, go to: https://rumble.com/c/X22Report
2,506 felons voted.
66,248 underage registered.
2,423 voted w/out registration.
1,043 address a Post-Office.
4,926 registered late.
10,315 dead people.
395 cast ballots in another state.
15,700 filed national change of address.
40,279 moved.
100+ affidavits.
With the false pretense of a "Water Main Break at State Farm Arena"... video footage was capable to show that in the voting places everyone was cleared out "including Republican observers", but 4 people stayed behind!!!, pull suitcases filled with ballots from under a table, & continued to count ballots in private from around 10:30 PM until 1 AM, if 6,000 ballots fit in each of those suitcases and there were four suitcases, those four individuals added some 24,000 votes all for Biden during that time!!!, etc., etc., etc., as I have said before, the information is getting more detailed and longer and longer as the days are passing, and for the 19th of this month of Dec., 2020, there where an alud of information regarding the voting fraud perpetrated for Biden is fully exposed...
The gifted author of the video declares: "...the evidence is pouring out and nothing can stop this. People are seeing it, they are now experiencing" the full exposure, in the US, of rampant "fraud for the first time. [DS] panics, sends a message, GA is in the crosshairs. Everything is about to change, the truth is about to come out. The tide is turning." To see more of the profound insight of David, go to: https://rumble.com/c/X22Report
Additional evidence of fraud is what the hidden cameras of the voting places recorded, in Georgia, after the observers and the supervisors left, four individuals where authorized to stay, and they took under the desk big luggage containers... in the first place they had not legal business staying there... etc. Then a bold woman declares what she saw saying that she sworn signing her affidavit and that those coming forward denouncing fraud have a hard time in society because of ostracism and criticizing... and even with all those hindrances, people is coming forward to witness the truth! So, if you can, please read carefully the next book that explains how the same players managed to corrupt the information, to manipulate the history, and to bully anybody thinking differently as the way the bullies want you to think (but at least no more for the ones that already are aware!!!):
https://ia801304.us.archive.org/3/items/TheBadWarTheTruthNEVERTaughtAboutWorldWarII/TheBadWarTheTruthNeverTaughtAboutWorldWarIiversion2MikeKing.pdf |
Additional evidence of fraud is what the hidden cameras of the voting places recorded, in Georgia, after the observers and the supervisors left, four individuals where authorized to stay, and they took under the desk big luggage containers... in the first place they had not legal business staying there... etc. Then a bold woman declares what she saw saying that she sworn signing her affidavit and that those coming forward denouncing fraud have a hard time in society because of ostracism and criticizing... and even with all those hindrances, people is coming forward to witness the truth! So, if you can, please read carefully the next book that explains how the same players managed to corrupt the information, to manipulate the history, and to bully anybody thinking differently as the way the bullies want you to think (but at least no more for the ones that already are aware!!!):
https://ia801304.us.archive.org/3/items/TheBadWarTheTruthNEVERTaughtAboutWorldWarII/TheBadWarTheTruthNeverTaughtAboutWorldWarIiversion2MikeKing.pdf
https://ia801304.us.archive.org/3/items/TheBadWarTheTruthNEVERTaughtAboutWorldWarII/TheBadWarTheTruthNeverTaughtAboutWorldWarIiversion2MikeKing.pdf
Fernando Castro-Chavez posted in FerKat.
Getting longer day by days the evidence of rampant voting fraud in the US!!! And, remembering my Patriotic military friends and fellow citizens, the U.S. Army (a strong arm behind Q) posted today: "The calm before the storm: A team of Rangers silently hold their position before executing a platoon raid." Then O'Keefe is presenting his dosis of the two last months of secret meetings by CNN high executives where we discover that they do NOT report the real news, they attempt to MANIPULATE the "consensus" of the masses, now CNN is crying saying that such hidden recording "may be a felony. We've referred it to law enforcement". What a bunch of cowards those of CNN (and that is just the tip of the iceberg as all the corrupted mass media is the same)!!!, for that reason, Donald Trump Junior responded to those bastards of CNN: "It's amazing that CNN had no problem aggressively running with secretly recorded audio tapes of the First Lady non-stop for weeks, but has a serious problem when someone does the exact same thing to them! ...double standards... no standards at all"!!! Then, patriot Ivan Pentchoukov declares: "Is UPS supposed to carry official election material? Because I and three Dominion Watch volunteers saw a UPS truck picking up a ballet of boxes marked "official absentee" from the Secretary of State's warehouse"!!! Then Jesse Morgan, a truck driver with USPS subcontractor says he was suspicious of his cargo load of 280,000 COMPLETED ballots: "I was driving completed ballots from New York to Pennsylvania. I didn't know, so I decided to speak up." Also Ethan Pease, a former UMS temporary worker describes serious anomalies on the voting day(s)!!! And Ron adds: "Gwinnett County Official admits to taking data from the Election Management System, plugging it into laptop, then filtering it with excel. This circumvents the rules that external software isn't allowed on election machines!!"!!! And bold patriot, a woman that I wish to be as bold as, Sidney Powell declares, apart of boldly speaking to "STOP the steal rally in Georgia"!!!: "Not to mention we received a report that despite Federal Court order, machines were being removed from Gwinnett County elections offices and a shredder truck was there"!!! Then a witness, (a bold black woman, a Poll Challenger) denounces to the Oversight Committee that "Poll supervisor ILLEGALLY gave contested votes to Dem Candidates" (plus other anomalies), this in MI. Then, bold Catherine Herridge affirms: "The Department will continue to receive and vigorously pursue all specific and credible allegations of fraud as expeditiously as possible". Etc., etc. (Including, from past studies, something that I almost forgot, the old Durham metaphor of George Washington entering victorious on such a boat on the 24th of December!!!). If you are a Patriot of the Truth of this planet, I deeply request you to read this interview: https://files.secure.website/wscfus/10348600/7999579/interviewhitler.pdf, it will change forever your perspective of what you think you know during the last more than a hundred years (since the mass media attempted to control your way of thinking about history as per their conveniences and NOT the truth!!! Please read it and as such, retabulate all history in your head, what is true versus what the most dark forces at work in this world want you to "believe" trying even to harrass you if you do not believe as they want to impose you to do!) |
Getting longer day by days the evidence of rampant voting fraud in the US!!! And, remembering my Patriotic military friends and fellow citizens, the U.S. Army (a strong arm behind Q) posted today: "The calm before the storm: A team of Rangers silently hold their position before executing a platoon raid." Then O'Keefe is presenting his dosis of the two last months of secret meetings by CNN high executives where we discover that they do NOT report the real news, they attempt to MANIPULATE the "consensus" of the masses, now CNN is crying saying that such hidden recording "may be a felony. We've referred it to law enforcement". What a bunch of cowards those of CNN (and that is just the tip of the iceberg as all the corrupted mass media is the same)!!!, for that reason, Donald Trump Junior responded to those bastards of CNN: "It's amazing that CNN had no problem aggressively running with secretly recorded audio tapes of the First Lady non-stop for weeks, but has a serious problem when someone does the exact same thing to them! ...double standards... no standards at all"!!! Then, patriot Ivan Pentchoukov declares: "Is UPS supposed to carry official election material? Because I and three Dominion Watch volunteers saw a UPS truck picking up a ballet of boxes marked "official absentee" from the Secretary of State's warehouse"!!! Then Jesse Morgan, a truck driver with USPS subcontractor says he was suspicious of his cargo load of 280,000 COMPLETED ballots: "I was driving completed ballots from New York to Pennsylvania. I didn't know, so I decided to speak up." Also Ethan Pease, a former UMS temporary worker describes serious anomalies on the voting day(s)!!! And Ron adds: "Gwinnett County Official admits to taking data from the Election Management System, plugging it into laptop, then filtering it with excel. This circumvents the rules that external software isn't allowed on election machines!!"!!! And bold patriot, a woman that I wish to be as bold as, Sidney Powell declares, apart of boldly speaking to "STOP the steal rally in Georgia"!!!: "Not to mention we received a report that despite Federal Court order, machines were being removed from Gwinnett County elections offices and a shredder truck was there"!!! Then a witness, (a bold black woman, a Poll Challenger) denounces to the Oversight Committee that "Poll supervisor ILLEGALLY gave contested votes to Dem Candidates" (plus other anomalies), this in MI. Then, bold Catherine Herridge affirms: "The Department will continue to receive and vigorously pursue all specific and credible allegations of fraud as expeditiously as possible". Etc., etc. (Including, from past studies, something that I almost forgot, the old Durham metaphor of George Washington entering victorious on such a boat on the 24th of December!!!). If you are a Patriot of the Truth of this planet, I deeply request you to read this interview: https://files.secure.website/wscfus/10348600/7999579/interviewhitler.pdf, it will change forever your perspective of what you think you know during the last more than a hundred years (since the mass media attempted to control your way of thinking about history as per their conveniences and NOT the truth!!! Please read it and as such, retabulate all history in your head, what is true versus what the most dark forces at work in this world want you to "believe" trying even to harrass you if you do not believe as they want to impose you to do!)
And the findings of rampant fraud keep piling up: "Bill Posey is calling on The Justice Department to investigate election software & hardware, Giuliani says: "During the hearing yesterday on Voter Fraud the witnesses described over 400,000 illegal ballots entered under the direction of the Democrat officials in Maricopa and Pima Counties, Arizona. Another part of the biggest election fraud in American history", Expert witness (whom Twitter account was suspended for testifying!!!) says he believes the numbers in Arizona are fraudulent based on the data: "I'd rather resign than have certified those results"!!!; "Hard Drive Shredding Truck Shows up to Georgia Elections machines facility. It can shred machine parts, server drives, USBs etc. People are calling for the Arrest of Kemp & the FBI sleeps on the job. Judges & Kemp seem Complicit w' Crime", "Does anyone know or have a record of why Gwinnett Co Elections has PODS? What's inside them? 3 workers stayed late. The last one was out of the building around 22:48... Watch a Dominion Representative (Xavier Khouri, Quality Technician Support, GPS Trackit, Bufford, Georgia) at Gwinnett County Election Central, responsible for tabulating ballots and certifying results, download data to a USB from the Election Management Server, plug it into a laptop, manipulate the data, then palm the USB"; "We DON'T have "One Person, One Vote!" ", Dr. Shiva Ayyadural; also, ongoing electoral results were sent to Frankfurt, Germany; then, big Capital of the CCP of China is dirtily involved in the voting machines, etc., etc..." |
And the findings of rampant fraud keep piling up: "Bill Posey is calling on The Justice Department to investigate election software & hardware, Giuliani says: "During the hearing yesterday on Voter Fraud the witnesses described over 400,000 illegal ballots entered under the direction of the Democrat officials in Maricopa and Pima Counties, Arizona. Another part of the biggest election fraud in American history", Expert witness (whom Twitter account was suspended for testifying!!!) says he believes the numbers in Arizona are fraudulent based on the data: "I'd rather resign than have certified those results"!!!; "Hard Drive Shredding Truck Shows up to Georgia Elections machines facility. It can shred machine parts, server drives, USBs etc. People are calling for the Arrest of Kemp & the FBI sleeps on the job. Judges & Kemp seem Complicit w' Crime", "Does anyone know or have a record of why Gwinnett Co Elections has PODS? What's inside them? 3 workers stayed late. The last one was out of the building around 22:48... Watch a Dominion Representative (Xavier Khouri, Quality Technician Support, GPS Trackit, Bufford, Georgia) at Gwinnett County Election Central, responsible for tabulating ballots and certifying results, download data to a USB from the Election Management Server, plug it into a laptop, manipulate the data, then palm the USB"; "We DON'T have "One Person, One Vote!" ", Dr. Shiva Ayyadural; also, ongoing electoral results were sent to Frankfurt, Germany; then, big Capital of the CCP of China is dirtily involved in the voting machines, etc., etc..."
The unsettling antecedents of why humanity is being pushed into the current situation right now in our 2020s: https://ia801304.us.archive.org/3/items/TheBadWarTheTruthNEVERTaughtAboutWorldWarII/TheBadWarTheTruthNeverTaughtAboutWorldWarIiversion2MikeKing.pdf (and the same real info in a fictitious literary interview form easier to grasp: https://files.secure.website/wscfus/10348600/7999579/interviewhitler.pdf):
The Light for the Truth keeps on coming: "The Republic (US and the free world) is at stake. This is no game for us. There is a group in this state (Penn) and country (US) willing to throw away (the NWO Foreign Bankers that Bought the Dems and many Reps Plus the Press, TV, Movies, Univs., (and now the "Zoo-cial Media"), etc., etc...) our valuable and precious freedoms. We are HERE TO SHED LIGHT ON DARKNESS!". Senator Mastriano. "The recounts in Dane and Milwaukee Counties have revealed serious issues regarding the legality of ballots... fight for a free and fair election. Jenna Ellis. "...Forensic examination is going to show the alterations. Digital footprints are almost impossible to hide... All election records are required to be maintained for a minimum of 22 months. Any records altered or deleted, there will be evidence, will make people subject to criminal charges... the contract between Dominion and The State of Georgia... will name all those involved in the rushed deal in spite of obvious opposition from both lawmakers and voters... $107 million... Georgian taxpayer dollars... Georgians are entitled to know how every penny was spent... this could set further precedent on the transparency of government deal making and allow for expanded scrutiny of vendor contracts. The who, what, where, when, and why approach to government accountability. All of this should be public domain. Pray... fear not... PUT YOUR FOCUS ON GOD... Not on the storm..." ZultanPhysics. |
The Light for the Truth keeps on coming: "The Republic (US and the free world) is at stake. This is no game for us. There is a group in this state (Penn) and country (US) willing to throw away (the NWO Foreign Bankers that Bought the Dems and many Reps Plus the Press, TV, Movies, Univs., (and now the "Zoo-cial Media"), etc., etc...) our valuable and precious freedoms. We are HERE TO SHED LIGHT ON DARKNESS!". Senator Mastriano. "The recounts in Dane and Milwaukee Counties have revealed serious issues regarding the legality of ballots... fight for a free and fair election. Jenna Ellis. "...Forensic examination is going to show the alterations. Digital footprints are almost impossible to hide... All election records are required to be maintained for a minimum of 22 months. Any records altered or deleted, there will be evidence, will make people subject to criminal charges... the contract between Dominion and The State of Georgia... will name all those involved in the rushed deal in spite of obvious opposition from both lawmakers and voters... $107 million... Georgian taxpayer dollars... Georgians are entitled to know how every penny was spent... this could set further precedent on the transparency of government deal making and allow for expanded scrutiny of vendor contracts. The who, what, where, when, and why approach to government accountability. All of this should be public domain. Pray... fear not... PUT YOUR FOCUS ON GOD... Not on the storm..." ZultanPhysics.
Well, we have now thousands upon thousands of evidences that there was voting fraud to falsely claim that useless Biden was the supposed "President-elect", which is the real fake news, which is totally false, and he knows it and deceitfully goes along with that dirty game. Some bold citizen, a patriot pregnant mother, Candace Owens, needed to call a lawyer to correct the false "fact-check" on her post (for corrupt fact-checkers working also for "a Zucker", a real life loser at FB), and her original post was: "Joe Biden is literally and legally not the President-elect. So why is the media pretending he is?". She was fakely "fact-checked", so after her lawyer confronted "PolitiFact", this platform admitted that they LIED by rating her post "false", they needed to put a "Correction" that says: "PolitiFact originally labeled this video false in our capacity as a third-party fact-checker for Facebook. On Nov. 20, an appeal to that decision was made on behalf of Ms. Owens. PolitiFact approved the appeal on Nov. 20, determined that a correction was appropriate, and removed the false rating", CNN also needs to be called to justice and all the other lying arms of the "Mass Media" and their handlers, to correct their lying claims or to go to prison!!! And one Fareed Zakaria from CNN is already making the record straight in favor of Trump, at least for him not to go to jail for blatantly LYING as these corrupt little Social Media platforms, their perverted "fact-checkers", and as said, all the corrupted conglomerate of the Mass Media and their despicable owners have done! |
Well, we have now thousands upon thousands of evidences that there was voting fraud to falsely claim that useless Biden was the supposed "President-elect", which is the real fake news, which is totally false, and he knows it and deceitfully goes along with that dirty game. Some bold citizen, a patriot pregnant mother, Candace Owens, needed to call a lawyer to correct the false "fact-check" on her post (for corrupt fact-checkers working also for "a Zucker", a real life loser at FB), and her original post was: "Joe Biden is literally and legally not the President-elect. So why is the media pretending he is?". She was fakely "fact-checked", so after her lawyer confronted "PolitiFact", this platform admitted that they LIED by rating her post "false", they needed to put a "Correction" that says: "PolitiFact originally labeled this video false in our capacity as a third-party fact-checker for Facebook. On Nov. 20, an appeal to that decision was made on behalf of Ms. Owens. PolitiFact approved the appeal on Nov. 20, determined that a correction was appropriate, and removed the false rating", CNN also needs to be called to justice and all the other lying arms of the "Mass Media" and their handlers, to correct their lying claims or to go to prison!!! And one Fareed Zakaria from CNN is already making the record straight in favor of Trump, at least for him not to go to jail for blatantly LYING as these corrupt little Social Media platforms, their perverted "fact-checkers", and as said, all the corrupted conglomerate of the Mass Media and their despicable owners have done!
New evidence is being discovered on a daily basis, I had not checked during ten days the new discoveries but the one of today is shocking: "The final red flag is perhaps the greatest. Something occurred in Michigan that is physically impossible, indicating the results were manipulated on election night within the EMS. The event as reflected in the data are the 4 spikes totaling 384,733 ballots allegedly processed in a combined interval of only 2 hour and 38 minutes. This is physically impossible given the equipment available at the 4 reference locations (precincts/townships) we looked at for processing ballots, and cross referencing that with both the time it took at each location and the performance specifications we obtained using the serial numbers of the scanning devices used. (Model DRM16011 – 60/min. without accounting for paper jams, replacement cover sheets or loading time, so we assume 2,000 ballots/hr. in field conditions which is probably generous). This calculation yields a sum of 94,867 ballots as the maximum number of ballots that could be processed. And while it should be noted that in the event of a jam and the counter is not reset, the ballots can be run through again and effectively duplicated, this would not alleviate the impossibility of this event because duplicated ballots still require processing time. The existence of the spike is strongly indicative of a manual adjustment either by the operator of the system (see paragraph 12 above) or an attack by outside actors. In any event, there were 289,866 more ballots processed in the time available for processing in four precincts/townships, than there was capacity. A look at the graph below makes clear the This is not surprising because the system is highly vulnerable to a manual change in the ballot totals as observed here." From one of the thousand Affidavits of common citizens (this by Russell James Ramsland, Jr.) with some common sense and science, like you and I that have been realizing the impossibility of the "win" of the very corrupted career politician Biden: https://web.archive.org/web/20201120134722/https://principia-scientific.com/shocking-affidavit-how-big-tech-stole-the-u-s-presidential-election/, https://web.archive.org/web/20201120134441/https://www.courtlistener.com/recap/gov.uscourts.gand.283580/gov.uscourts.gand.283580.7.1_2.pdf, these are not even the strongest cases that the team of Trump is going to raise very soon, but are very compelling and clear on their points of the physical impossibility of the machines to process as many ballots pro-Biden in the short time that they supposedly did!!! |
New evidence is being discovered on a daily basis, I had not checked during ten days the new discoveries but the one of today is shocking: "The final red flag is perhaps the greatest. Something occurred in Michigan that is physically impossible, indicating the results were manipulated on election night within the EMS. The event as reflected in the data are the 4 spikes totaling 384,733 ballots allegedly processed in a combined interval of only 2 hour and 38 minutes. This is physically impossible given the equipment available at the 4 reference locations (precincts/townships) we looked at for processing ballots, and cross referencing that with both the time it took at each location and the performance specifications we obtained using the serial numbers of the scanning devices used. (Model DRM16011 – 60/min. without accounting for paper jams, replacement cover sheets or loading time, so we assume 2,000 ballots/hr. in field conditions which is probably generous). This calculation yields a sum of 94,867 ballots as the maximum number of ballots that could be processed. And while it should be noted that in the event of a jam and the counter is not reset, the ballots can be run through again and effectively duplicated, this would not alleviate the impossibility of this event because duplicated ballots still require processing time. The existence of the spike is strongly indicative of a manual adjustment either by the operator of the system (see paragraph 12 above) or an attack by outside actors. In any event, there were 289,866 more ballots processed in the time available for processing in four precincts/townships, than there was capacity. A look at the graph below makes clear the This is not surprising because the system is highly vulnerable to a manual change in the ballot totals as observed here." From one of the thousand Affidavits of common citizens (this by Russell James Ramsland, Jr.) with some common sense and science, like you and I that have been realizing the impossibility of the "win" of the very corrupted career politician Biden: https://web.archive.org/web/20201120134722/https://principia-scientific.com/shocking-affidavit-how-big-tech-stole-the-u-s-presidential-election/, https://web.archive.org/web/20201120134441/https://www.courtlistener.com/recap/gov.uscourts.gand.283580/gov.uscourts.gand.283580.7.1_2.pdf, these are not even the strongest cases that the team of Trump is going to raise very soon, but are very compelling and clear on their points of the physical impossibility of the machines to process as many ballots pro-Biden in the short time that they supposedly did!!!
https://www.whitehouse.gov/presidential-actions/proclamation-thanksgiving-day-2020: "On Thanksgiving Day, we thank God for the abundant blessings in our lives. As we gather with family and friends to celebrate this season of generosity, hope, and gratitude, we commemorate America’s founding traditions of faith, family, and friendship, and give thanks for the principles of freedom, liberty, and democracy that make our country exceptional in the history of the world. / This November marks 400 years since the Mayflower and its passengers faced the unknown and set sail across the Atlantic Ocean. Propelled by hope for a brighter future, these intrepid men and women endured... They forged friendships with the Wampanoag Tribe, fostered a spirit of common purpose among themselves, and trusted in God to provide for them... This Thanksgiving, we reaffirm our everlasting gratitude for all that we enjoy, and we commemorate the legacy of generosity bestowed upon us by our forbearers... I encourage all Americans to gather, in homes and places of worship, to offer a prayer of thanks to God for our many blessings... in the year of our Lord two thousand twenty..."
Updated Nov 26, 2020, 6:57 PM
In Brief: https://cdn.lbryplayer.xyz/api/v3/streams/free/Israel-and-the-assassinations-of-The-Kennedy-brothers-Trailer/5f9c8b0153a17c71161ba3f00908a95982def1c6/7cdf7d; In Full: https://cdn.lbryplayer.xyz/api/v3/streams/free/Israel-and-the-Assassinations-of-The-Kennedy-brothers/930e20a0c27317ca6829b1d703007618fee98ff3/b42938; Update: In Context: https://ia800405.us.archive.org/11/items/PlanetRothschildPart1/planet%20rothschild%20part1.pdf, https://ia800402.us.archive.org/9/items/PlanetrothschildPart2/planetrothschild%20part2.pdf
Fernando Castro-Chavez added a new photo to a timeline.
Nov 23, 2020, 1:24 PM
Key links to track on a daily basis the constant discoveries of the most ridiculous voting fraud perpetrated by Biden, are (the CCP repressive style FB did not allow me to put the links, I kept on hitting Post and nothing happened, one good day in the future they will pay for what they are doing on repressing information, on repressing freedom, on repressing the truth to be known, shame on them!!!):
The time will come where the fraudsters will be trapped, the liars will be caught, and some of them are already been put into evidence as per today: Once the most corrupt "Blue Bird" was found lying blatantly yesterday with its "fact-checking" false label of "Official sources called this election differently", in relation to the double statement by Trump about that he WON The Election, now they changed their absurd label with this other one also useless and with no authority whatsoever: "Multiple sources called this election differently" (yeah, all of them as part of the corrupt media, the corrupt social media, the members of the swamp, both local and international... none of them with real authority to call on nothing yet, until all is legally and lawfully recounted and certified, and right there, for the good people of the earth, it can be seen clearly who is lying and who wants the truth to come up!). Then, we see here that Trump knew where they were sending the results of the voting (to Germany, as we also saw yesterday), and he did a sting operation there to trap the culprits of that and to retrieve the original databases, there we can see a big landslide in favor of 410 Electoral Votes for Trump vs only 128 for the cheater scum called Biden. Plus multiple irrefutable proofs that keep on coming, like that CA sent thousands to ballots to "homeless" people who voted "Biden", and I forgot in one of the previous ones, all those unrequested ballots that were sent in abundance to people that do not requested them, including the, yes again the poor elderly people of the "nursing homes" (if you want further information, Lindsey Graham is pursuing that line of investigation)... but it is because there is so many evidence that really make the researchers sick to see how much evil really exists in this world... but the bad ones will fall, no matter how much lies are used to cover-up the truth! |
The time will come where the fraudsters will be trapped, the liars will be caught, and some of them are already been put into evidence as per today: Once the most corrupt "Blue Bird" was found lying blatantly yesterday with its "fact-checking" false label of "Official sources called this election differently", in relation to the double statement by Trump about that he WON The Election, now they changed their absurd label with this other one also useless and with no authority whatsoever: "Multiple sources called this election differently" (yeah, all of them as part of the corrupt media, the corrupt social media, the members of the swamp, both local and international... none of them with real authority to call on nothing yet, until all is legally and lawfully recounted and certified, and right there, for the good people of the earth, it can be seen clearly who is lying and who wants the truth to come up!). Then, we see here that Trump knew where they were sending the results of the voting (to Germany, as we also saw yesterday), and he did a sting operation there to trap the culprits of that and to retrieve the original databases, there we can see a big landslide in favor of 410 Electoral Votes for Trump vs only 128 for the cheater scum called Biden. Plus multiple irrefutable proofs that keep on coming, like that CA sent thousands to ballots to "homeless" people who voted "Biden", and I forgot in one of the previous ones, all those unrequested ballots that were sent in abundance to people that do not requested them, including the, yes again the poor elderly people of the "nursing homes" (if you want further information, Lindsey Graham is pursuing that line of investigation)... but it is because there is so many evidence that really make the researchers sick to see how much evil really exists in this world... but the bad ones will fall, no matter how much lies are used to cover-up the truth!
More evidences of the Biden electoral fraud: The voting machines and software were all rigged to favor Biden, even other countries, like the Philippines have denounced the bias of those machines. We have the clear evidence that "the blue bird" has NO authority whatsoever to put the warnings that it puts, and such warnings are completely false, they and the owners of this one, are the fakers and sooner or later they will pay for the deception that they are enacting. then you can see the miserable ANTIFA hitting unawares the good citizens that went to the million crowded event in support Trump in D.C., you can see another scum BLM lady stealing the cell phone of the one on the floor, and on the next video, you can see another of those sorts of scum hitting down another elderly patriot, and some of the D.C. police with helmets are seen doing absolutely nothing!, as if they were also advised by the corrupt government there, not to intervene in the beatings of patriots pro Trump, shame on them, and shame on the corrupt media that is not covering any of the crimes of these pieces of scum, is pampering them as they all are part of the deception. God, protect your good people and that the evil ones be exposed and processed accordingly. |
More evidences of the Biden electoral fraud: The voting machines and software were all rigged to favor Biden, even other countries, like the Philippines have denounced the bias of those machines. We have the clear evidence that "the blue bird" has NO authority whatsoever to put the warnings that it puts, and such warnings are completely false, they and the owners of this one, are the fakers and sooner or later they will pay for the deception that they are enacting. then you can see the miserable ANTIFA hitting unawares the good citizens that went to the million crowded event in support Trump in D.C., you can see another scum BLM lady stealing the cell phone of the one on the floor, and on the next video, you can see another of those sorts of scum hitting down another elderly patriot, and some of the D.C. police with helmets are seen doing absolutely nothing!, as if they were also advised by the corrupt government there, not to intervene in the beatings of patriots pro Trump, shame on them, and shame on the corrupt media that is not covering any of the crimes of these pieces of scum, is pampering them as they all are part of the deception. God, protect your good people and that the evil ones be exposed and processed accordingly.
More and plus more evidence of Fraud against the American people, not only in the 2020 U.S.A. Elections, but also in fake charities launched by the Bidens, you can see as well, excerpts of the amazing rally for Trump at DC (not covered by the corrupt "messengers"), and how the violent people that supports a fraudster such as Biden, resorted to the beatings in the night, when fewer people that supported Trump was around, you can see clearly who are the violent crews, and who are the pacific crews, also you can see how the media and the social media tries to deny these events that are really happening, the massive rallies for Trump, the violent beatings of ANTIFA & BLM to peaceful citizens, and how also that corrupt media did not cover the previous extreme violent acts of the same paid reefers. |
More and plus more evidence of Fraud against the American people, not only in the 2020 U.S.A. Elections, but also in fake charities launched by the Bidens, you can see as well, excerpts of the amazing rally for Trump at DC (not covered by the corrupt "messengers"), and how the violent people that supports a fraudster such as Biden, resorted to the beatings in the night, when fewer people that supported Trump was around, you can see clearly who are the violent crews, and who are the pacific crews, also you can see how the media and the social media tries to deny these events that are really happening, the massive rallies for Trump, the violent beatings of ANTIFA & BLM to peaceful citizens, and how also that corrupt media did not cover the previous extreme violent acts of the same paid reefers.
Now we are reaching the top, contrary to the baseless opinions of the deceived owners of this site (thinking that their money will determine the "winner"), here we have the Chair of the "Federal Election Commission", Trey Trainor saying today: "I do believe that there is voter fraud taking place in these places", and that is going on even TODAY! (13 Nov. 2020); he believes voter fraud is taking place in those states still counting ballots. During a Friday appearance on Newsmax TV's "National Report," Trainor said locations not granting observers access to watch the ballot counting process could be involved in VOTER FRAUD. The son of Trump, Don, indicates that: "Fact-Checkers" can not put that such is "fake news", coming directly from the "Chair of the Federal Election Commission"!!! Can they b/r...tards? Then an undeniable evidence that the top Election Chief of Milwaukee, Wisconsin was CAUGHT on camera illegally tabulating 169,000 mail-in ballots without legally appointed observers! Breaking the Legal Chain of Custody!!! Those criminals were stealing YOUR votes and giving them ILLEGALLY to an undeserving traitor of the USA!!! Good thing that concerned citizens in the back of the room were able to record such illicit activity!!! Because, whomever goes along with a fraud scheme, no matter whom that person is, with the end to deceive the Nation and the will of the American people, is a traitor of the Nation and do NOT deserve to lead that Nation (even if the corrupted big Social Media platforms, Google, etc., are in it for $$$, they will also fall on their lying "predictions", and will still be servants of the Citizens... unless they shut down their now filled with repressors of truth) that he has deceived, cheated, lied to... |
Now we are reaching the top, contrary to the baseless opinions of the deceived owners of this site (thinking that their money will determine the "winner"), here we have the Chair of the "Federal Election Commission", Trey Trainor saying today: "I do believe that there is voter fraud taking place in these places", and that is going on even TODAY! (13 Nov. 2020); he believes voter fraud is taking place in those states still counting ballots. During a Friday appearance on Newsmax TV's "National Report," Trainor said locations not granting observers access to watch the ballot counting process could be involved in VOTER FRAUD. The son of Trump, Don, indicates that: "Fact-Checkers" can not put that such is "fake news", coming directly from the "Chair of the Federal Election Commission"!!! Can they b/r...tards? Then an undeniable evidence that the top Election Chief of Milwaukee, Wisconsin was CAUGHT on camera illegally tabulating 169,000 mail-in ballots without legally appointed observers! Breaking the Legal Chain of Custody!!! Those criminals were stealing YOUR votes and giving them ILLEGALLY to an undeserving traitor of the USA!!! Good thing that concerned citizens in the back of the room were able to record such illicit activity!!! Because, whomever goes along with a fraud scheme, no matter whom that person is, with the end to deceive the Nation and the will of the American people, is a traitor of the Nation and do NOT deserve to lead that Nation (even if the corrupted big Social Media platforms, Google, etc., are in it for $$$, they will also fall on their lying "predictions", and will still be servants of the Citizens... unless they shut down their now filled with repressors of truth) that he has deceived, cheated, lied to...
As more evidence accumulates of the voting fraud, and the one that was already there is fine tuned and detailed, and as for the other side more censorship pours over those that are exposing the lies, we can see that the members of the swamp team together. Now it is Osterholm, the same one that at the very beginning of COVID-19 denied on a popular show that it was an artificial product of a laboratory; so, now, the same "creature" is spearheading the "Dark Winter" organized by Democrats and announced by Biden, promoting another upcoming month and a half of lockdowns. But WE THE PEOPLE will NOT let those criminals to get away with murder, with debunking the USA economy, with cheating, lying and committing every sort of crimes. With the help divine, we are protected and guided by our ever living Father! To see all the expanded insights by David, who alone is exposing a "Goliath", please go to: https://rumble.com/c/X22Report (Here I only put an excerpt of remarkable discoveries that he is putting together in a daily basis, and like him, thousands of Patriots of JUSTICE all over the world). |
As more evidence accumulates of the voting fraud, and the one that was already there is fine tuned and detailed, and as for the other side more censorship pours over those that are exposing the lies, we can see that the members of the swamp team together. Now it is Osterholm, the same one that at the very beginning of COVID-19 denied on a popular show that it was an artificial product of a laboratory; so, now, the same "creature" is spearheading the "Dark Winter" organized by Democrats and announced by Biden, promoting another upcoming month and a half of lockdowns. But WE THE PEOPLE will NOT let those criminals to get away with murder, with debunking the USA economy, with cheating, lying and committing every sort of crimes. With the help divine, we are protected and guided by our ever living Father! To see all the expanded insights by David, who alone is exposing a "Goliath", please go to: https://rumble.com/c/X22Report (Here I only put an excerpt of remarkable discoveries that he is putting together in a daily basis, and like him, thousands of Patriots of JUSTICE all over the world).
The endless evidence of total fraud by Biden keeps on pouring, here we see that Truman Black developed a computer script that identifies votes "switched" from Trump to Biden, and votes for Trump that just "disappeared", for example in PA there were 220,000 switched votes, and lost votes that belonged to Trump: 941,000; we also see how Biden is full of lies, he promised to Wallace that he will be waiting before proclaiming his victory until a certified count of valid votes will be done, and he did not keep his promise, then we see the ease where the "Dominion" voting machines can be accessed for anybody to gain "Administrator" privileges so as to alter the voting rates, and then how the voting process was detained with spurious pretexts like a long distance broken pipe, just to stop the counting of the votes for Trump and planning their needed votes for lying Biden to "win"... etc., etc... Happy VETERANS DAY today!!! I pray our Veterans will keep inspiring us and doing what is right to protect our dearly beloved USA, before is dismantled as it will happen sooner or later... but NOT while we are still here!!! An old veteran patriot of our Independence, reminds us today that it is Better to Die standing, than to Live on our knees!!! |
The endless evidence of total fraud by Biden keeps on pouring, here we see that Truman Black developed a computer script that identifies votes "switched" from Trump to Biden, and votes for Trump that just "disappeared", for example in PA there were 220,000 switched votes, and lost votes that belonged to Trump: 941,000; we also see how Biden is full of lies, he promised to Wallace that he will be waiting before proclaiming his victory until a certified count of valid votes will be done, and he did not keep his promise, then we see the ease where the "Dominion" voting machines can be accessed for anybody to gain "Administrator" privileges so as to alter the voting rates, and then how the voting process was detained with spurious pretexts like a long distance broken pipe, just to stop the counting of the votes for Trump and planning their needed votes for lying Biden to "win"... etc., etc... Happy VETERANS DAY today!!! I pray our Veterans will keep inspiring us and doing what is right to protect our dearly beloved USA, before is dismantled as it will happen sooner or later... but NOT while we are still here!!! An old veteran patriot of our Independence, reminds us today that it is Better to Die standing, than to Live on our knees!!!
Way far more evidences of fraud by Biden, here an hispanic patriot, Steve Cortes lays out in detail those things that started being studied yesterday, the total statistical impossibility of Biden-only ballots, with no other candidate of any other office checked, not even if Democrat (evidence that they rushed to fill more ballots than what they already had to "rig" the election), he demonstrates that such Democratic lie is exacerbated 11, 712 % just in the State of Georgia, when compared to the similar case for the Republicans, which is a Statistical impossibility!!! We also hear the words of Pompeo, who says: "There will be a smooth transition TO A SECOND TRUMP ADMINISTRATION", and more, thanks to David for his keen analysis of all of those things!!! And to D. J. T. for his honest postings to have a direct connection with the population that wishes to do so too. |
Way far more evidences of fraud by Biden, here an hispanic patriot, Steve Cortes lays out in detail those things that started being studied yesterday, the total statistical impossibility of Biden-only ballots, with no other candidate of any other office checked, not even if Democrat (evidence that they rushed to fill more ballots than what they already had to "rig" the election), he demonstrates that such Democratic lie is exacerbated 11, 712 % just in the State of Georgia, when compared to the similar case for the Republicans, which is a Statistical impossibility!!! We also hear the words of Pompeo, who says: "There will be a smooth transition TO A SECOND TRUMP ADMINISTRATION", and more, thanks to David for his keen analysis of all of those things!!! And to D. J. T. for his honest postings to have a direct connection with the population that wishes to do so too.
Fernando Castro-Chavez uploaded a file in the group: FerKat.
Most Precious Kat With NO Compare, Here Is My Essay for your sister.
Countless additional evidences of voting fraud by Biden, thus far 450K ballots nationally have only marked "Biden" with no other selection for any other position of the rest of aspiring ones, neither Democrats or Republicans, indicative of a precipitate fraudulent filing of all of those false ballots (even if the corrupt and prostituted media is also trying even to downplay that evidence, but that media will be buried for good in its own lies!, and really, nobody pays attention to them anymore!), then the discovery of Pelosi and Soros as the important individuals invested in the on purpose biased software systems to favor Biden, dead men voting, postal service workers ordered by their bosses to predate late ballots, etc., etc., etc. So, the alternative given by "The Constitution" of the USA, that Trump knows and upholds (contrary to Biden), indicates that the contested States need to resort NOT to the corrupt governors, but to their LEGISLATORS to do another LEGAL "one day" voting in only those States. Then, the animal "Rioters" have been all the time with Biden, not with Trump, and Trump fired that sold-out Mark Esper, the most corrupt character on the side of the cabal, and put in his place an honest man: Christopher C. Miller, the highly respected Director of the National Counterterrorism Center (unanimously confirmed by the Senate), who will be Acting Secretary of Defense, effective immediately, and he, indeed WILL USE THE MILITARY to prevent more of those lawless bestial Antifa - "BLM" riots paid by pervert Soros. |
Countless additional evidences of voting fraud by Biden, thus far 450K ballots nationally have only marked "Biden" with no other selection for any other position of the rest of aspiring ones, neither Democrats or Republicans, indicative of a precipitate fraudulent filing of all of those false ballots (even if the corrupt and prostituted media is also trying even to downplay that evidence, but that media will be buried for good in its own lies!, and really, nobody pays attention to them anymore!), then the discovery of Pelosi and Soros as the important individuals invested in the on purpose biased software systems to favor Biden, dead men voting, postal service workers ordered by their bosses to predate late ballots, etc., etc., etc. So, the alternative given by "The Constitution" of the USA, that Trump knows and upholds (contrary to Biden), indicates that the contested States need to resort NOT to the corrupt governors, but to their LEGISLATORS to do another LEGAL "one day" voting in only those States. Then, the animal "Rioters" have been all the time with Biden, not with Trump, and Trump fired that sold-out Mark Esper, the most corrupt character on the side of the cabal, and put in his place an honest man: Christopher C. Miller, the highly respected Director of the National Counterterrorism Center (unanimously confirmed by the Senate), who will be Acting Secretary of Defense, effective immediately, and he, indeed WILL USE THE MILITARY to prevent more of those lawless bestial Antifa - "BLM" riots paid by pervert Soros.
Further discoveries of cheating by Biden and the complicit and corrupt media, they used fractional percents!!! Did nobody ask: Why there were fractions on election day...? ...and the reason was to play with numbers in order to favor the criminals and to damage the rightful winners, just by playing with fractions!, cercenating hundreds of legitimate votes at every unit of change!; here you can see how when they brought to 0.5 percent a 0.4 percent by the Democrats, and brought to 0.5 percent a 0.6 percent of the Republicans, automatically in the same screen they robbed 560 votes of 560 persons to the Republicans and added that same number of 560 persons undeservedly to the Democrats, just by a biased programmed algorithm to play against the truth! It is the voting system of the "Dominion" software (based on the other corrupt one called "Gems"), and main Democrats are involved financially with that corrupted company (a wretched software used in 29 states, partnered up with Clinton Global Initiative and had on staff former employees of both Clinton Growth Initiative and Clinton Cash Cow TENEO; perverted Clintons!). So, every sort of cheating was enacted to make the fake win of Biden that is now being shouted by the most corrupt media... (Al Gore was also a "President-Elect" by 37 days, but there a bad one was replaced by a worst one, not on this case!) but they, cheating Democrats, will be caught on time and they will certainly pay for what they have done against the free will of WE THE PEOPLE OF THE USA!!! |
Further discoveries of cheating by Biden and the complicit and corrupt media, they used fractional percents!!! Did nobody ask: Why there were fractions on election day...? ...and the reason was to play with numbers in order to favor the criminals and to damage the rightful winners, just by playing with fractions!, cercenating hundreds of legitimate votes at every unit of change!; here you can see how when they brought to 0.5 percent a 0.4 percent by the Democrats, and brought to 0.5 percent a 0.6 percent of the Republicans, automatically in the same screen they robbed 560 votes of 560 persons to the Republicans and added that same number of 560 persons undeservedly to the Democrats, just by a biased programmed algorithm to play against the truth! It is the voting system of the "Dominion" software (based on the other corrupt one called "Gems"), and main Democrats are involved financially with that corrupted company (a wretched software used in 29 states, partnered up with Clinton Global Initiative and had on staff former employees of both Clinton Growth Initiative and Clinton Cash Cow TENEO; perverted Clintons!). So, every sort of cheating was enacted to make the fake win of Biden that is now being shouted by the most corrupt media... (Al Gore was also a "President-Elect" by 37 days, but there a bad one was replaced by a worst one, not on this case!) but they, cheating Democrats, will be caught on time and they will certainly pay for what they have done against the free will of WE THE PEOPLE OF THE USA!!!
More evidence of voting fraud committed by the Democrats, this time, deliberate "glitches" in the computers that gave votes to Biden that belonged to Trump, 6,000 x 47, and that just for one State, plus, dumping on the trash can ballots for Trump or addressed to communities pro-Trump, Biden "voters" with fake addresses, plus preventing the observers to supervise the counting process, and many other and endless more dirty tricks, they also are accountable to explain what happened with the Military Overseas Ballots, and if those were replaced with Biden-only votes, to indict all of the ones responsible for such actions... |
More evidence of voting fraud committed by the Democrats, this time, deliberate "glitches" in the computers that gave votes to Biden that belonged to Trump, 6,000 x 47, and that just for one State, plus, dumping on the trash can ballots for Trump or addressed to communities pro-Trump, Biden "voters" with fake addresses, plus preventing the observers to supervise the counting process, and many other and endless more dirty tricks, they also are accountable to explain what happened with the Military Overseas Ballots, and if those were replaced with Biden-only votes, to indict all of the ones responsible for such actions...
10 More minutes of the endless suppressed evidence by the corrupt prostituted "main" voices of the world, plus the acknowledgment by Biden and his snouted mouth at the start, since October, that they, Democrats, will commit voting fraud in a massive scale, as we see, by predating later ballots, by making the dead to vote, and not voting once but decens of times, plus the sharpie - magic marker that invalidates the votes as the majority of their own public statements declare... good that Trump has one and a half more months in office to call-in the Supreme Court with all of this evidence to indict most of the responsible ones of this massive fraud, on the open for everyone with eyes to see. Even the idiot Fernando del Rincón from CNN in Spanish, yesterday (06/11/20) declared: "More votes that are just arriving to the polling sites are still being counted.... I should correct, that were already there..." (what a moron, but like him, many reporters realize even in their subconscious that such is the case, ballots arriving late but being falsely pre-dated as if they were earlier... here or there, the real liars will need to pay... |
10 More minutes of the endless suppressed evidence by the corrupt prostituted "main" voices of the world, plus the acknowledgment by Biden and his snouted mouth at the start, since October, that they, Democrats, will commit voting fraud in a massive scale, as we see, by predating later ballots, by making the dead to vote, and not voting once but decens of times, plus the sharpie - magic marker that invalidates the votes as the majority of their own public statements declare... good that Trump has one and a half more months in office to call-in the Supreme Court with all of this evidence to indict most of the responsible ones of this massive fraud, on the open for everyone with eyes to see. Even the idiot Fernando del Rincón from CNN in Spanish, yesterday (06/11/20) declared: "More votes that are just arriving to the polling sites are still being counted.... I should correct, that were already there..." (what a moron, but like him, many reporters realize even in their subconscious that such is the case, ballots arriving late but being falsely pre-dated as if they were earlier... here or there, the real liars will need to pay...
In 10 Minutes, the mail-in democratic fraud at 4:00 AM announced by Trump two hours earlier, it is statistically impossible to have only-Biden votes from then on (do not let those ballots to be destroyed, they will be discovered as a fake ballot), and this is just the beginning of the evidences of fraud of every sort, as big-mouth Biden cynically himself said so in October: "We have put together I think the most extensive and inclusive voter fraud organization in the history of American politics": https://youtu.be/WGRnhBmHYN0 |
In 10 Minutes, the mail-in democratic fraud at 4:00 AM announced by Trump two hours earlier, it is statistically impossible to have only-Biden votes from then on (do not let those ballots to be destroyed, they will be discovered as a fake ballot), and this is just the beginning of the evidences of fraud of every sort, as big-mouth Biden cynically himself said so in October: "We have put together I think the most extensive and inclusive voter fraud organization in the history of American politics": https://youtu.be/WGRnhBmHYN0
Updated Nov 3, 2020, 9:59 PM
Bisabuelo Manuel Castro Carbajal, compositor de "El Carretero":
Updated Oct 31, 2020, 8:17 PM
Fernando Castro-Chavez shared a link to the group: FerKat.
I sent a job request to Yan, at NY: "Dear Team Li-Meng Yan,I am thankful with your two reports and looking forward to your response to those reefers sent by Fauci (Gallo) and by Gates (the Johns Hopkins ones).In my case I wrote one and as punishment the first one removed my three last articles I had on the Genetic Code and the I Ching, as seen in my Resume after the next one:Castro-Chavez F. Anticovidian v.2 COVID-19: Hypothesis of the Lab Origin Versus a Zoonotic Event which can also be of a Lab Origin.Glob. J. Sci. Front. Res.: I. 20(3): 9-53. 2020.Where I conclude: So, the evidence shown here clearly indicates the impossibility of the null hypothesis (Ho), because there is no history of a zoonotic event a prioriSo, my question is to know if I can find me a job in your institution and/or by working for you.Fernando Castro-Chavez | Baylor College of Medicine - Academia.edu📷Fernando Castro-Chavez | Baylor College of Medicine - Academia.edu
Academia.edu is a place to share and follow research.With My Best,Fernando.Third Sequence: COVID-19: AATGGTACTAAGAGG = HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene, sequence ID: GU455503.1Third Sequence: COVID-19: AATGGTACTAAGAGG = HIV-1 isolate 19663.24H9 fro...
Read 151 answers by scientists with 60 recommendations from their colleagues to the question asked by Fernando C...
Reply
,
Reply All
or
Forward
Send
21"
Academia.edu is a place to share and follow research.With My Best,Fernando.Third Sequence: COVID-19: AATGGTACTAAGAGG = HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene, sequence ID: GU455503.1Third Sequence: COVID-19: AATGGTACTAAGAGG = HIV-1 isolate 19663.24H9 fro...
Read 151 answers by scientists with 60 recommendations from their colleagues to the question asked by Fernando C...
Reply
,
Reply All
or
Forward
Send
21"
A year ago, a cold day, but a day of freedom still, and we valued our freedom as the most sacred right that today is being lost by the actions of a few and evil cabal of heartless animal humans.., such as in no more free worldwide tourism traveling, shame on them! I want them to... soon be held accountable...
Updated Oct 9, 2020, 3:35 PM
The most recent research on the ARTIFICIAL release of the current malady, by a defector: https://zenodo.org/record/4073131, and how the crappy botched censorship of the "fact-checkers" (shame on them, history will count them as the most despicable individuals over the face of the earth, in the same seat with the globalist ones who planed this whole tragedy), them of no value, demote her previous research when I post the link on here, as well as my ongoing analysis of it (with 18,780 viewers thus far, so the truth is not going away, you censors from hell, which just corroborates that the censors of the truth are in bed with the planners of the current worldwide situation): https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031
Fernando Castro-Chavez shared a memory.
1 Year Ago
Oct 8, 2019, 5:43 PM
The place where I am here in New York!
Place: BioInc at NYMC (41.082566433667, -73.814508921778)
Address: 7 Dana Rd, Valhalla, NY 10595
A day as today.... things change from day to the night... as I left there, I was able to meet my dream of a woman... God only knows what is next...
Updated Oct 8, 2020, 11:15 AM
You tagged 沈信學
A full month like this one of October, a year ago, enjoying the good company of Dr. Shen, at the NYMC, but also at Manhattan and Brooklyn, NY and at Philadelphia. |
Fernando and 學 are celebrating 1 year of friendship on Facebook!
A full month like this one of October, a year ago, enjoying the good company of Dr. Shen, at the NYMC, but also at Manhattan and Brooklyn, NY and at Philadelphia.
Libro acerca de la sólida evidencia histórica de la existencia, vida y resurrección de Jesucristo, de César Vidal, "Más Que un Rabino", el fragmento de video indica parte de la evidencia histórica de la resurrección de Jesucristo, la que aún sacudía al Imperio Romano Diez Años Después!!!:}:
Fernando Castro-Chavez shared a memory.
5 Years Ago
Oct 5, 2015, 10:34 AM
Con gusto presento este viernes (9 de oct., 2015) a las 7:50 PM de la noche mi estudio del “Testimonio de las Estrellas 2”: http://fdocc.ucoz.com/3/PC_7_02_testimonio_de_las_estrellas_2015.pdf Se verán 7 Signos del Zodiaco (de Leo a Acuario) según la Biblia. Aparecerá en el canal: https://www.youtube.com/c/catadoresdelapalabra1 (donde queda grabado), y desde antes, por el Skype desde las 7:30 PM para oraciones y manifestar espíritu santo, y después, esta vez para breve sobremesa...
Recordando la Sabiduría de Dios, la que excede toda estratagema humana
Updated Oct 5, 2020, 11:30 AM
Fernando Castro-Chavez shared a memory.
9 Years Ago
Fernando Castro-Chavez added a new photo.
Oct 4, 2011, 8:20 AM
Jesé le pidió que llevara comida a sus hermanos que estaban en el campo de batalla contra los Filisteos, David obedeció y sus hermanos lo menospreciaron creyendo que iba de mirón, pero el joven David era el único que le creyó a Dios para vencer.
Una de las más famosas historias de la Biblia: David venciendo al monstruo Goliat, evocativa de confiar en Dios en tiempos imposibles!!!
Updated Oct 4, 2020, 8:37 AM
THE SCREW: History From the USA Battleship at San Jacinto, TX, let's go with all we have for the freedom of Our Nation, and with it, for the rest of the Still Free World!!! For God, Family and Country!!!
Fernando Castro-Chavez posted in FerKat.
Fernando Castro-Chavez shared a link to the group: FerKat.
This is the answer of the Germany persons: Incomings <incomings@international.uni-mainz.de>
To:
fdocc@yahoo.com
Thu, Oct 1 at 8:28 AM
Dear Fernando Castro-Chavez,
first of all, the application for the recognition has to be submitted. This process is done via JOGU-StINe. Please see the following link for information on this process as well as a YouTube-Tutorial. No application period exists for this process: https://www.studying.uni-mainz.de/certification-of-recognition-validation-of-foreign-certificates/
After receiving the certificate of recognition, the application for the admission can be handed in – also via JOGU-StINe. Since the application period for desired master program has not started yet,
you will not find it on the platform (application starts October, 15th). Again, the certificate of recognition needs to be at hand for this application since it contains inevitable data for this step.
In case both of you – if understood correctly – are intending to study the master program, everything related to your PhD-degree can be neglected (Online_Registration.pdf. etc.).
https://www.studying.uni-mainz.de/online-application/
The attached screenshot of JOGU-StINe (Externe Feststellungsprüfung, 247658) appears to be an outdated application since it cannot not be found in our system any longer.
In order to apply for the recognition, you have to select “recognition of foreign certificate” (my data, section 2) while starting the application (application/registration on JOGU-StINe).
We cannot provide any information on the job prospects after the degree has been received. Please contact the faculty in charge for information on this topic.
For future requests, please write separate inquiries to avoid confusion about the application process since they may differ in some details.
Kind regards,
pp Florian Herm.
To:
fdocc@yahoo.com
Thu, Oct 1 at 8:28 AM
Dear Fernando Castro-Chavez,
first of all, the application for the recognition has to be submitted. This process is done via JOGU-StINe. Please see the following link for information on this process as well as a YouTube-Tutorial. No application period exists for this process: https://www.studying.uni-mainz.de/certification-of-recognition-validation-of-foreign-certificates/
After receiving the certificate of recognition, the application for the admission can be handed in – also via JOGU-StINe. Since the application period for desired master program has not started yet,
you will not find it on the platform (application starts October, 15th). Again, the certificate of recognition needs to be at hand for this application since it contains inevitable data for this step.
In case both of you – if understood correctly – are intending to study the master program, everything related to your PhD-degree can be neglected (Online_Registration.pdf. etc.).
https://www.studying.uni-mainz.de/online-application/
The attached screenshot of JOGU-StINe (Externe Feststellungsprüfung, 247658) appears to be an outdated application since it cannot not be found in our system any longer.
In order to apply for the recognition, you have to select “recognition of foreign certificate” (my data, section 2) while starting the application (application/registration on JOGU-StINe).
We cannot provide any information on the job prospects after the degree has been received. Please contact the faculty in charge for information on this topic.
For future requests, please write separate inquiries to avoid confusion about the application process since they may differ in some details.
Kind regards,
pp Florian Herm.
Vote, vote, vote if you are out of your Country, the USA, by request your ballot by email, Fax, regular mail...: https://travel.state.gov/content/travel/en/international-travel/while-abroad/voting.html
The First Debate: https://youtu.be/wW1lY5jFNcQ
Updated Sep 29, 2020, 8:34 PM
https://youtu.be/MLJoa4F1VK0 Traduciendo al español la primera parte de "La Gran Represión", por el "Ético Escéptico", con los aspectos básicos del manejo amañado de los datos relacionados con COVID-19, así como con el haber ignorado una gran cantidad de conocimientos de virología, epidemiología, inmunología, infectología, etc...
Se observa la tendencia corrupta de unos cuantos con el fin de obtener su dominio sobre el mundo y ganancias políticas a expensas de una humanidad doliente. Pero NO los dejaremos mientras aquí estemos!!! Continuará...
Se observa la tendencia corrupta de unos cuantos con el fin de obtener su dominio sobre el mundo y ganancias políticas a expensas de una humanidad doliente. Pero NO los dejaremos mientras aquí estemos!!! Continuará...
Updated Sep 29, 2020, 6:46 AM
Fernando Castro-Chavez shared a link to the group: FerKat.
The solution of problem 10 as it should be, is a division not a sum!!!: https://www.algebra.com/algebra/homework/absolute-value/absolute-value.faq.question.905303.html ;)
To Her, Because of Her...: https://youtu.be/LGi6Q5WsvtM
Updated Sep 28, 2020, 10:55 AM
Fernando Castro-Chavez shared a link to the group: FerKat.
https://www.skillsyouneed.com/num/percent-change.htm, right way: Increase = New Number - Original Number
Read more at: https://www.skillsyouneed.com/num/percent-change.html and % increase = Increase ÷ Original Number × 100 then Decrease = Original Number - New Number and % Decrease = Decrease ÷ Original Number × 100, to correct the book on the signs.
Read more at: https://www.skillsyouneed.com/num/percent-change.html and % increase = Increase ÷ Original Number × 100 then Decrease = Original Number - New Number and % Decrease = Decrease ÷ Original Number × 100, to correct the book on the signs.
Fernando Castro-Chavez shared a memory.
9 Years Ago
Fernando Castro-Chavez added a new photo.
Sep 28, 2011, 8:09 AM
En el tiempo de los Jueces, cuando aún no había rey en Israel, Sansón se destacó por su fuerza que estaba ligada a su pelo. Su debilidad eran las mujeres y la enemiga Filistea Dalila le sacó el secreto de su fuerza, y le cortó el pelo.
En el último esfuerzo de su vida, ciego y a pesar de todos sus errores, invocó de todo corazón a Dios para que le ayudase a vencer a las fuerzas de las tinieblas... del libro ilustrado que más me impresionó en mi más temprana infancia, y me encarriló a buscar a ese Dios de Poder Verdadero... a pesar de mí mismo hasta el día de hoy:
Updated Sep 28, 2020, 7:07 AM
Fernando Castro-Chavez posted in FerKat.
Fernando Castro-Chavez posted in FerKat.
I got the Exercise 3 of the "Investment Problems" (page 36) by trial and error! Again at my second guess, that was off by almost twice the amount! So, the solution that I got in that way, like in three minutes, is: 60,000.00 x 0.08 = 4,800.00; while 40,000.00 x 0.05 = 2,000.00. The way to verify the second is that is (2 x 2,000.00) + 800.00 = 4,800.00. So, she invested $ 100,000.00 and gets an extra in interests of $ 6,800.00 from both of her accounts.
Fernando Castro-Chavez shared a link to the group: FerKat.
Here are listed 175 MSc degrees in NY: https://www.findamasters.com/masters-degrees/new-york/?c00lSSP0, let us find the best for you to go back to where we belong!!! (God first!).
Fernando Castro-Chavez shared a link to the group: FerKat.
What about this message for the Sports Sci. Lab. https://nysportssciencelab.com/ at NY: Sports Sci. Lab, Having born in Guadalajara as well as Juan Delgado, I am an MSc and PhD from the U, de G. as well, seeking for an intense and prosperous job in New York, specializing myself in Anti-Obesity and Anti-Atherosclerosis: https://pubmed.ncbi.nlm.nih.gov/?term=%22Castro-Chavez+F%22, with a completed Postdoctoral at the Baylor College of Medicine (Dr. Ballantyne, TX), and with a suspended one in the NYMC (with Dr. Nader G. Abraham, Valhalla, NY), currently in my native land (place of my home phone). My most recent work is: Anti-Covidian: https://zenodo.org/record/3988139, I can do every kind of research, and my female friend from the Philippines who referred me to you is a recently graduated BSc from UST, Manila, in Sports Science and can also be of help as she is a very dynamic instructor and researcher as well. With my best regards. and looking forward to hear from you, Fernando.
Fernando Castro-Chavez shared a link to the group: FerKat.
Here are the key documents to apply for the Recognition of foreign certificates: https://www.studying.uni-mainz.de/files/2019/04/Click-instructions-for-the-application-for-recognition.pdf, and the key statements there;
1. Payment of the processing fee
Please transfer the processing fee (60,-€) to the following German bank account:
Empfänger Universität Mainz, Abt. INT
Name der Bank Sparkasse Mainz
Swiftcode MALADE51MNZ
IBAN DE60 5505 0120 0000 0108 68
Verwendungszweck Nachname, Geburtsdatum Antragsteller/in
2. Application process via Jogustine
Please apply online (https:\\jogustine.uni-mainz.de/) for the recognition of foreign certificates. The
application for recognition of foreign certificates can be filed at any time.
Fill out the complete form conscientiously. As soon as you have completed all sections, you can send
the application electronically.
Attention: You cannot make any changes to your application after it has been sent electronically!
3. Submission of the application
Please print out your application for recognition from Jogustine and submit the printed application
form together with all necessary documents to Student Services – International Admissions. Please
note your checklist, which you download together with your application for recognition.
Attention: All school and study certificates must be submitted in the original language and in the
translation (except English or French certificates) as officially certified copies
We will notify you by e-mail as soon as we receive your application by post,
And here is the detailed information: https://www.studying.uni-mainz.de/document-authentication-certification/
In my case, I thin that I will need to go to the Guadalajara University in the big city to certify my copies of MSc and of PhD.
1. Payment of the processing fee
Please transfer the processing fee (60,-€) to the following German bank account:
Empfänger Universität Mainz, Abt. INT
Name der Bank Sparkasse Mainz
Swiftcode MALADE51MNZ
IBAN DE60 5505 0120 0000 0108 68
Verwendungszweck Nachname, Geburtsdatum Antragsteller/in
2. Application process via Jogustine
Please apply online (https:\\jogustine.uni-mainz.de/) for the recognition of foreign certificates. The
application for recognition of foreign certificates can be filed at any time.
Fill out the complete form conscientiously. As soon as you have completed all sections, you can send
the application electronically.
Attention: You cannot make any changes to your application after it has been sent electronically!
3. Submission of the application
Please print out your application for recognition from Jogustine and submit the printed application
form together with all necessary documents to Student Services – International Admissions. Please
note your checklist, which you download together with your application for recognition.
Attention: All school and study certificates must be submitted in the original language and in the
translation (except English or French certificates) as officially certified copies
We will notify you by e-mail as soon as we receive your application by post,
And here is the detailed information: https://www.studying.uni-mainz.de/document-authentication-certification/
In my case, I thin that I will need to go to the Guadalajara University in the big city to certify my copies of MSc and of PhD.
The Eight Key Moments of the Research By Ethical Skeptic Demonstrating That COVID-19 Has Clearly for Everyone Been Used For Sinister Purposes To Control and Manipulate in Every Single and Mean Aspect Humanity!!! Say NO to their Plans to Violate your FREEDOM!!! Fly Like a Bird!!! Escape from their Nets!!! (In Every Single Sense of the XXI Century Meaning of these Sentences!!!) |
The Eight Key Moments of the Research By Ethical Skeptic Demonstrating That COVID-19 Has Clearly for Everyone Been Used For Sinister Purposes To Control and Manipulate in Every Single and Mean Aspect Humanity!!! Say NO to their Plans to Violate your FREEDOM!!! Fly Like a Bird!!! Escape from their Nets!!! (In Every Single Sense of the XXI Century Meaning of these Sentences!!!)
Fernando Castro-Chavez shared a memory.
Fernando Castro-Chavez shared a link to the group: FerKat.
https://docs.google.com/document/d/1VOadkDt6GvmUlb7QYkXJE-OCj9l202F47Uh3ANYzV8A/edit?fbclid=IwAR3zAXy6lXn0D1ZMJgV9CfXRw1QCBU2_Y00MDczld9NuGpjitykuWNJg6MI
All enrolled students have to pay the so-called “Semesterbeitrag” - regardless the program. Currently, the fee is 326,11€ (387.25 Dlls) for the upcoming winter semester 2020/21.
https://www.studium.uni-mainz.de/kosten-2/
In some cases, additional costs (“Studiengebühren”) may be raised. This has to be reviewed individually:
https://www.studium.uni-mainz.de/studiengebuehren/
Before completing all the steps, the application for the recognition has to be submitted, in order to review your formal qualification to study at our university:
https://www.studying.uni-mainz.de/certification-of-recognition-validation-of-foreign-certificates/ (60.00 Euros equals 72.00 Dollars)
After receiving the certificate of recognition, the application for the admission can be handed in:
https://www.studying.uni-mainz.de/online-application/
Kindly note the current information on the application process:
https://www.studying.uni-mainz.de/corona-applicants/
https://www.studying.uni-mainz.de/jogu-stine/
If it is currently not possible to have your certificates officially notarized; your online application and the uploaded documents are sufficient for processing. Please make sure that you upload all the documents required for evaluation (original language and, if necessary, translation) in the application. You will receive a preliminary certificate of recognition with limited validity.
You will have to submit the printed and signed application including all necessary documents as soon as possible. You will then receive a final certificate. If the submitted documents do not match the uploaded documents, we will not issue the final certificate and the validity of the preliminary certificate will be cancelled immediately.
You are an applicant with a non-European citizenship
For applicants* from abroad, this confirmation will be provided with the letter of admission in the download area in Jogustine. You do not need to submit an application.
In financial emergencies that occur through no fault of your own, JGU’s AStA offers interest-free loans and subsidies through a relief fund for support paying the semester fee, for rent, or for health insurance, for example.
The Studierendenwerk Mainz can help in financial crises through its Emergency Aid Fund, as well. You can find information for quick help and financial support during the corona crisis here (link in German). It’s best to take up contact to the Studierendenwerk via e-mail:
For subsidies, contact schreiber@studierendenwerk-mainz.de
For loans and advice on student loans, contact junga@studierendenwerk-mainz.de
You can find a number of part-time jobs using the employment agency’s job exchange. Those looking for work can also contact the job-seeker hotline +49-800-4 5555 00 or +49 6131-248 777. A search for employment can also be filled out online (link in German).
Many sectors, such as grocery stores, delivery services, or distribution centers are looking for temporary help especially now, during the corona pandemic.
Agricultural businesses, too, have called on students to work as harvesters. You can find relevant offers in the following job exchanges (in German):
www.saisonarbeit-in-deutschland.de
www.daslandhilft.de
www.land-arbeit.com
www.cleverackern.de
www.agrarjobboerse.de
All enrolled students have to pay the so-called “Semesterbeitrag” - regardless the program. Currently, the fee is 326,11€ (387.25 Dlls) for the upcoming winter semester 2020/21.
https://www.studium.uni-mainz.de/kosten-2/
In some cases, additional costs (“Studiengebühren”) may be raised. This has to be reviewed individually:
https://www.studium.uni-mainz.de/studiengebuehren/
Before completing all the steps, the application for the recognition has to be submitted, in order to review your formal qualification to study at our university:
https://www.studying.uni-mainz.de/certification-of-recognition-validation-of-foreign-certificates/ (60.00 Euros equals 72.00 Dollars)
After receiving the certificate of recognition, the application for the admission can be handed in:
https://www.studying.uni-mainz.de/online-application/
Kindly note the current information on the application process:
https://www.studying.uni-mainz.de/corona-applicants/
https://www.studying.uni-mainz.de/jogu-stine/
If it is currently not possible to have your certificates officially notarized; your online application and the uploaded documents are sufficient for processing. Please make sure that you upload all the documents required for evaluation (original language and, if necessary, translation) in the application. You will receive a preliminary certificate of recognition with limited validity.
You will have to submit the printed and signed application including all necessary documents as soon as possible. You will then receive a final certificate. If the submitted documents do not match the uploaded documents, we will not issue the final certificate and the validity of the preliminary certificate will be cancelled immediately.
You are an applicant with a non-European citizenship
For applicants* from abroad, this confirmation will be provided with the letter of admission in the download area in Jogustine. You do not need to submit an application.
In financial emergencies that occur through no fault of your own, JGU’s AStA offers interest-free loans and subsidies through a relief fund for support paying the semester fee, for rent, or for health insurance, for example.
The Studierendenwerk Mainz can help in financial crises through its Emergency Aid Fund, as well. You can find information for quick help and financial support during the corona crisis here (link in German). It’s best to take up contact to the Studierendenwerk via e-mail:
For subsidies, contact schreiber@studierendenwerk-mainz.de
For loans and advice on student loans, contact junga@studierendenwerk-mainz.de
You can find a number of part-time jobs using the employment agency’s job exchange. Those looking for work can also contact the job-seeker hotline +49-800-4 5555 00 or +49 6131-248 777. A search for employment can also be filled out online (link in German).
Many sectors, such as grocery stores, delivery services, or distribution centers are looking for temporary help especially now, during the corona pandemic.
Agricultural businesses, too, have called on students to work as harvesters. You can find relevant offers in the following job exchanges (in German):
www.saisonarbeit-in-deutschland.de
www.daslandhilft.de
www.land-arbeit.com
www.cleverackern.de
www.agrarjobboerse.de
Fernando Castro-Chavez shared a link to the group: FerKat.
The status of our possible travel to study at Germany is for this career: https://www.studying.uni-mainz.de/sport-science-m-sc-movement-and-wellbeing/, the only pay done per semester per person is: 387.25 Dlls, plus 72.00 Dollars extra for the validation of your documents, a process that takes 6 weeks, the application process for this MSc stats on the first of October, very soon, and ends on the 15th of November; the page for the submission of the documents is this one: https://www.studying.uni-mainz.de/certification-of-recognition-validation-of-foreign-certificates/ and after receiving the certificate of recognition, the application for the admission can be handed in:
https://www.studying.uni-mainz.de/online-application/, the required English skills need to be proven: https://www.studying.uni-mainz.de/range-of-courses-2/, Kindly note the current information on the application process:
https://www.studying.uni-mainz.de/corona-applicants/
https://www.studying.uni-mainz.de/online-application/, the required English skills need to be proven: https://www.studying.uni-mainz.de/range-of-courses-2/, Kindly note the current information on the application process:
https://www.studying.uni-mainz.de/corona-applicants/
Fernando Castro-Chavez shared a memory.
5 Years Ago
Sep 23, 2015, 2:48 PM
Por la gracia divina, los estudios del poder de Dios hoy, continúan:
La Administración del Secreto Revelado, Administración de la Gracia de Dios:
https://www.youtube.com/watch?v=qTGj2-dyoSI
Caminando en el Nuevo Nacimiento: A) Recibiendo Revelación, B) Renovando la Mente:
https://www.youtube.com/watch?v=Y1sFL66NaEo
Pasado: Salvación en Romanos, Corintios y Gálatas; PRESENTE: AMOR en Efesios, Filipenses y Colosenses; Futuro: Esperanza en Tesalonicenses!!! Oh Grandeza Suprema de la Multiforme Revelación de Dios!!!
Updated Sep 23, 2020, 10:02 AM
Fernando Castro-Chavez shared a link to the group: FerKat.
Kat,
I just received the partial answer to my questions, and as this had been processed before, if it works, it may be worth to be pursued by the both of us:
MY QUESTIONS:
To the Administrator,
1) Can we, international students (MX: PhD Mol. Biol., PHP: BSc Sports Science) have it as Tuition Free (or at least one of us)?
2) But, if that is not the case, what is the cost of this MSc?
3) Regarding the B-2 exam, as the classes are in English, which is the document needed and from whom?
4) Is it also a requirement to do a B-1 exam for German for this particular MSc, and where can it be taken?
5) In the given case, what do we need to put as "Hosting Chair" as host and eMail?
THEIR RESPONSE:
Dear Fernando Castro-Chavez,
thank you for your interest in studying at JGU Mainz!
1/2) All enrolled students have to pay the so-called “Semesterbeitrag” - regardless the program. Currently, the fee is 326,11€ for the upcoming winter semester 2020/21.
https://www.studium.uni-mainz.de/kosten-2/
In some cases, additional costs (“Studiengebühren”) may be raised. This has to be reviewed individually:
https://www.studium.uni-mainz.de/studiengebuehren/
Further, there is the possibility to opt for a PhD-program without becoming an enrolled (only registered) student. On the downside, you will not receive the “Semesterticket” which enables
you to use the public transportation system for free (as well as other benefits): https://www.studying.uni-mainz.de/costs-funding-and-aid/
3/4) Depending on your choice of studies the requirements differ. In case a proof of German language proficiency is not specified, it does not have to be submitted.
Instead, the required English skills need to be proven: https://www.studying.uni-mainz.de/range-of-courses-2/
If a proof of German language competence is necessary for the application, we accept the following certificates as an equivalent
to the DSH-exam: https://www.studying.uni-mainz.de/german-language-requirements/
A provisional admission might be issued by handing in a language proof that does not match the requirements (recommended: B2-certificate/confirmation of participation C1-course).
5) Please clarify this question.
Before completing all the steps, the application for the recognition has to be submitted, in order to review your formal qualification to study at our university:
https://www.studying.uni-mainz.de/certification-of-recognition-validation-of-foreign-certificates/
After receiving the certificate of recognition, the application for the admission can be handed in:
https://www.studying.uni-mainz.de/online-application/
Kindly note the current information on the application process:
https://www.studying.uni-mainz.de/corona-applicants/
Kind regards,
pp Florian Herm
*********************************************************
Student Services - International Admissions
Johannes Gutenberg-University Mainz
D-55099 Mainz
e-mail: incomings@international.uni-mainz.de
(Due to the large number of individual requests, the replies to e-mails can be delayed.
Please do not send multiple e-mails with the same content.
*********************************************************
Internet: www.uni-mainz.de/incoming
With Best,
Fernando Castro-Chavez, PhD.
I just received the partial answer to my questions, and as this had been processed before, if it works, it may be worth to be pursued by the both of us:
MY QUESTIONS:
To the Administrator,
1) Can we, international students (MX: PhD Mol. Biol., PHP: BSc Sports Science) have it as Tuition Free (or at least one of us)?
2) But, if that is not the case, what is the cost of this MSc?
3) Regarding the B-2 exam, as the classes are in English, which is the document needed and from whom?
4) Is it also a requirement to do a B-1 exam for German for this particular MSc, and where can it be taken?
5) In the given case, what do we need to put as "Hosting Chair" as host and eMail?
THEIR RESPONSE:
Dear Fernando Castro-Chavez,
thank you for your interest in studying at JGU Mainz!
1/2) All enrolled students have to pay the so-called “Semesterbeitrag” - regardless the program. Currently, the fee is 326,11€ for the upcoming winter semester 2020/21.
https://www.studium.uni-mainz.de/kosten-2/
In some cases, additional costs (“Studiengebühren”) may be raised. This has to be reviewed individually:
https://www.studium.uni-mainz.de/studiengebuehren/
Further, there is the possibility to opt for a PhD-program without becoming an enrolled (only registered) student. On the downside, you will not receive the “Semesterticket” which enables
you to use the public transportation system for free (as well as other benefits): https://www.studying.uni-mainz.de/costs-funding-and-aid/
3/4) Depending on your choice of studies the requirements differ. In case a proof of German language proficiency is not specified, it does not have to be submitted.
Instead, the required English skills need to be proven: https://www.studying.uni-mainz.de/range-of-courses-2/
If a proof of German language competence is necessary for the application, we accept the following certificates as an equivalent
to the DSH-exam: https://www.studying.uni-mainz.de/german-language-requirements/
A provisional admission might be issued by handing in a language proof that does not match the requirements (recommended: B2-certificate/confirmation of participation C1-course).
5) Please clarify this question.
Before completing all the steps, the application for the recognition has to be submitted, in order to review your formal qualification to study at our university:
https://www.studying.uni-mainz.de/certification-of-recognition-validation-of-foreign-certificates/
After receiving the certificate of recognition, the application for the admission can be handed in:
https://www.studying.uni-mainz.de/online-application/
Kindly note the current information on the application process:
https://www.studying.uni-mainz.de/corona-applicants/
Kind regards,
pp Florian Herm
*********************************************************
Student Services - International Admissions
Johannes Gutenberg-University Mainz
D-55099 Mainz
e-mail: incomings@international.uni-mainz.de
(Due to the large number of individual requests, the replies to e-mails can be delayed.
Please do not send multiple e-mails with the same content.
*********************************************************
Internet: www.uni-mainz.de/incoming
With Best,
Fernando Castro-Chavez, PhD.
"...Make me brave, so I can stand and fight the spiritual battles in my life and in our world. Give me your wisdom and discernment so I won't be caught off guard. Together, Lord, we'll win, because in truth, you already have. While evil still roams, the power of Your name and Your blood rises up to defeat and bring us victory against every evil planned against us. While malicious actions may disturb us, we use the armor of God You have given us to stand firm. You will bring justice in due time for all the harm and needless violence aimed at Your children. Until then, we remain in Your presence, aligned with Your purposes, and we look to You as our Supreme Commander and Protector. Help us to avoid temptation, and deliver us from evil, Lord. You are the Mighty One, the One Who will ultimately bring all evil to light. With You, Jesus, we are safe. Amen." Found at QAlerts dot app
Fernando Castro-Chavez updated his status.
Say NO to a Compulsory Vaccination with Maiming Venoms! Against You and Your Offspring!!
My Video of Today on "The Great Repression", reading and commenting the work of The Ethical Skeptic: https://youtu.be/U9BEozUfX4w
Updated Sep 20, 2020, 11:11 AM
Fernando Castro-Chavez shared a memory.
1 Year Ago
Sep 20, 2019, 9:05 AM
The Gospel roots in the Christian Foundation of Country Music in the USA!!!: Bristol, Virginia, its "Sessions" of 1927-28!!! With the song most characteristic of those recordings, dealing with the Mighty return of Jesus Christ for his own!!!: https://www.youtube.com/watch?v=36xj-2B_ZBQ (Added later: Some more photos presented in a great video at the place)
Exactly One Year Ago, Driving With the Freedom of a Bird Passing Through Bristol, Virginia, from Texas on My Way To New York!!! Oh, God, I Wish to Do All Free Traveling All Over Again, Here and There, and All Over The Planet, But Not Alone This Time!!! Will it be Possible, Dear God?
Updated Sep 20, 2020, 11:06 AM
August was a busy month, but even more busy the current month and the months ahead... fighting for truth and justice according to my understanding, profession and as God inspires me!!! |
August was a busy month, but even more busy the current month and the months ahead... fighting for truth and justice according to my understanding, profession and as God inspires me!!!
A Very Important posting of today at the RG to my already 18K readers there, make the research of The Ethic Skeptic widely known, please, your offspring is at stake: "The Great Repression": A report on the criminal activities performed by those that organized the current Plandemic of COVID-19, and the informed ways to stop them!!! (Excerpts from TES: https://archive.vn/Doptk).
"I began to apply my skills in order to see if the media and agency-bearing academics were indeed telling the truth. As it turned out, in critical significance, they were not."
"The Great Repression – the period of severe depression economic fallout greater than that of the Great Depression, characterized by 38 million jobs (11.5%) and 500,000 or more lockdown lives lost and 6 million famine lives lost, which resulted from an over-reaction to and/or incompetent understanding of coronaviruses and Covid-19 in particular. Marketing disinformation as an academic, governmental or media authority, in order to compel despair, panic or compliance inside a population under duress of epidemic, war or economic collapse – these things are indistinguishable from war crimes. They are a violation of basic human rights, and as such constitute acts of class harm, scienter, racketeering and oppression."
"Lockdown/Great Repression Fatality – a fatality reported by a state department of health and cataloged by the CDC in which the person’s death was caused by lack of access to medical services (diabetes, heart disease, stroke, other illnesses, etc.), lack of adequate diagnosis (cancer, etc.) or Suicide Addiction Abandonment & Abuse."
"...Covid directly or indirectly precipitated an increase in deaths attributable to known natural causes (9,079 fatalities overage versus normal)... these additional deaths served to also create a hole in the death rate starting 8 weeks later and onward (13,429 fatality deficit versus normal). In this instance, Covid-19 impacted death rates by ‘pulling forward’ deaths which would have occurred in July and August, and forced those to occur in April and May... it is estimated that we have experienced possibly 40-45% of the pull-forward deficit. The full pull-forward deficit will not be known until as far out as May of 2021."
Oh Patriotic Citizens of the USA and of the World, you are The Owners of The: "Stakeholder Ethics – a principle or condition wherein those who bear the negative impact of a decision can hold those who make that decision, accountable. Further then may dissent, and reverse that decision or remove the decision maker, even if they claim to be an ‘expert’. A claim to science is not a free pass to tyranny."
"NiCFR – net infectious case-fatality rate (risk). The total ‘died of’ and ‘died with’ fatalities from a given pathogen, minus those who died as a result of over-reaction or ignorance around that pathogen, divided by the estimated total population which was infected by that pathogen. Has nothing to do with symptomatic rates."
"...data must be denatured of its noise, into information... then... into intelligence... the only basis from which to infer or take action..."
For the first graphic shown here: "...US Covid-19 progression...: The blue vertical column bars indicate case arrivals each day in the northern 37 states, while the orange vertical bar arrivals show the patterns in the southerly hot 50 border counties or hot 13 states (seen here in Figure 6)... This surge in cases peaked on July 16th, 13 or 14 weeks after the north latitude peak (one quarter of the year)... each case peak adhered to Farr’s Law (https://archive.vn/N1QsO: "...epidemic events rise and fall in a roughly symmetrical pattern. The time-evolution behavior could be captured by a single mathematical formula that could be approximated by a bell-shaped curve")... this latter surge in cases was not a ‘second wave’ as much as it was a sympathetic overflow from southerly latitude patterns of the same virus... This latitudinal effect is called a Hope-Simpson subtropical latitude effect (https://archive.vn/1X7xC). This should have been known before we decided policy. Most predictive models for the pandemic were merely regression models, with high and low banding. None of them predicted the distinct Farr’s Law shape of this latitudinal surge.... this surge in cases formed a peak around July 16th (2020), which was immediately called by The Ethical Skeptic by means of the charts to the lower right, but took a full 3 weeks to be acknowledged by official channels and media, most of whom still did not even mention the tail off by early September (2020)... The curve continued an upward progression until it lost that momentum on 16 July (2020) and never recovered it. The Ethical Skeptic was watching for a confirmatory rise in fatalities 28 days after the initial rise in cases – and indeed a mild rise in fatalities formed, confirming that this reported rise in cases was about 37% real, (and) 63% salting through new practices of case detection ...(this means in blunt terms, that:) the gentle rise in percent positive ...was 37% real cases in our 50 hottest counties composing the July 16th surge, while 63% of that rise was crafted through salting/juking of reported cases"!!!
From a related graph, also applicable to all: "...curves should move in a given ratio throughout the horizon, unless an exception has occurred such as Legacy Data Laundering LDL-1 or Lockdown Death Laundering LDL-2." (See below the definitions of these criminal statistical lies imposed over humanity by the killers-that-be). "...The degree of Lockdown Death Laundering (LDL-2) can be ascertained by comparing the height of each day’s ...column, versus the ...CDC excess all-cause deaths line... adjusted for (the) documented CDC lag..."
"SupraLag – that CDC lag in posting of actual deaths (shortfall in all-cause death count) by date in the MMWR weekly data, which exceeded by a large amount, the typical lag which the CDC had historically exhibited for that same week (current week minus x MMWR weeks). Ideally if both the CDC and analyst tracking them are performing well in their duties, SupraLag should be minimal."
"Death ‘from’/Death ‘with’ Covid – an important principle in that there are those who died of Covid, who simply/trivially had Covid RNA in the nostrils while they were already dying of something else, as opposed to actually dying from Covid as a primary or secondary cause of death. The reason this is important is that the former group causes a ‘pull forward’ effect which will artificially make it appear that suddenly Americans are not dying of other diseases any longer, either now or in the future. This effect as raw data, will serve to mislead."
"...the parody ‘Lemming Cycle of Continuous Impairment’ is also a satirical commentary upon how panicked state level government officials served to foment continued panic and despair around Covid-19. Also derived from the allegory of fictitious lemmings who run off a mythical cliff en masse, in their hysteria to achieve a given inductively derived or panic-fueled goal. The cycle wherein panic over perceived cases of Covid-19, drove demands inside certain state government levels for more testing and track-and-trace team funding, which resulted in increased PCR tests run and false/3-month-old positives being generated, which resulted in ever higher positive case-detects being reported as raw data by the states, which resulted in more panic/despair. Incompetence. Forgetting the data grooming methods employed with annual flu analytics and opting instead to simply report raw data – a scientific error." And I may say a deliberate one, and a crime!!!
"The Lemming Cycle (boosted as well by false positive PCR testing results which were left unchallenged), fueled a feedback cycle of panic inside the media and administrative government decision-makers, regarding Covid-19."
"RNA/Virus Detection Half-Life – the period after which half of those who were infected at one time, can no longer present detectable dead or inactive Covid-19 RNA. The half-life period has been evaluated to be as much as 7 weeks. The entire period of detectability is 14 weeks. This noise in data collection was exploited by nefarious political and power hungry forces during the pandemic."
"Salting/Juking Reported Cases – one or more of a variety of methods of boosting reported cases of Covid-19 in order to make the pandemic seem hotter, growing when actually in decline or larger than is its reality. Includes methods such as
legacy data laundering,
backlog stuffing,
AB testing results mixed with PCR testing,
focus on hot spots,
posting track and trace %-pos results only,
testing prisons care facilities and factories only,
temperature screening selected testing,
report of ‘suspected’ cases,
non-reporting of negative tests,
delay or lag exploitation,
multiple tests on one person,
cross-border cases,
hospital comprehensive screening,
nosocomial cases,
paying people who (or TO) test positive,
batch swab testing followed by individual testing, etc."
"The comparative between ICU Census and deaths allows the astute analyst to observe that reported deaths can contain legacy data up to 12 weeks old in some cases, and most often in excess of 3 weeks old... key in estimating Legacy Death Laundering (LDL2)..."
https://omny.fm/shows/the-todd-herman-show/independent-data-analyst-ethical-skeptic-joins-the
And for those assholes self-deemed as "fact-checkers": "...every person has a right, responsibility or qualification as a victim/stakeholder to make their voice heard..."!!!
"Agency" (y note: Such as the NIH of Collins, Hehee): "...when a denial is involved, the incentive to double-down on that denial, in order to preserve office, income or celebrity – is larger than either bias or nominal conflict of interest... A "tendentious" person holds their position from a compulsion which they cannot overcome through objective evaluation. One cannot be reasoned out of, a position which they did not reason themselves into to begin with... catch-phrases that a person will employ to demonstrate that they are inside the approved club or academic circle around a particular topic..." (and talking about Francis S. Collins): "...A blindly devoted official, follower, or organization member... One who either ignorantly or obdurately lacks any concern or circumspection ability which might prompt them to examine the harm their position may serve to cause..", from elsewhere in the article: "...Be wary of agency which exploits the appearance of raw data...", and before: "..raw data – which most often will serve to dis-inform..."
"in order to comprehend the risk entailed to the general stakeholding public – and the hazard presented by those who wish to exploit the tragedy as a means to abuse..."
And about Fauci, Gates, CDC (again and again, as the criminal par excelence which that one indeed is) and Birx and the WHO (to all of them felons belong the information below)...: "Catalyseur – ...A conflict exploitation specialist, or any entity which stands to gain under the outcome of a lose-lose conflict scenario which they have served to create, abet or foment. Someone who acts as a third party to two sides in an argument or conflict, who advises about the ‘truth’ of the other party involved, respectively and urges an escalation of factors which drove the conflict to begin with."
"Shopcraft – traits, arrival forms and distributions of data which exhibit characteristics of having been produced by a human organization, policy or mechanism. A result which is touted to be natural, random or unconstrained, however which features patterns or mathematics which indicate (that) human intervention is at play inside its dynamics. A method of detecting agency, and not mere bias, inside a system."
"Slapping the Grizzly/Bear – if someone implies to you that they know exactly the outcome of slapping a grizzly bear in order to get it to go away – they themselves are more dangerous than a virus by far – no matter how many risk PhD’s they may hold. The act of becoming robust to a constrained small-risk of harm/death bearing sound epistemic precedent (a virus with 4 months of observation and multiple precedents) – while exposing (the USA) to an unconstrained large-risk of ruin/death, derived from our actions (an economic Great Repression), which bears no epistemic precedent …is like slapping a grizzly bear to compel it to go away."
"Mobsensus – the inferential will of media, club, mafia, cabal or cartel – in which a specific conclusion is enforced upon the rest of society, by means of threat, violence, social excoriation or professional penalty; further then the boasting of or posing such insistence as ‘scientific consensus’."
And as the WHO and CDC do under the higher-bidder$ orders: "...through sleight-of-hand, changing the context of its employment without the soundness..."
"...never ascribe to happenstance or incompetence, that which coincidentally, consistently ...supports a preexisting agency... a handful of the clever manipulating the ignorance of the millions."
"Marketing disinformation as an academic, governmental or media authority, in order to compel despair, panic or compliance inside a population under duress of epidemic, war or economic collapse – these things are indistinguishable from war crimes. They are a violation of basic human rights, and as such constitute acts of class harm, scienter, racketeering and oppression."
"Indigo Point (Inflection Point) – ...event or mechanism which is manipulated early in a process... which will alter/tip subsequent events towards a specific final outcome. It is the magician’s unremarkable sleeve"!!!
"ingens vanitatum Argument – citing a great deal of expert irrelevance. A posing of ‘fact’ or ‘evidence’ framed inside an appeal to expertise... which serves to dis-inform as to the nature of the argument being vetted or the critical evidence or question being asked."
"Laundering (of Legacy Cases and Fatalities) – partly a term from data management and partly coined for the Covid-19 response. Legacy data is any form of old data which involves work in transcribing into a new system, approach or context. "Laundering" is the process of removing the old undesirable context for an item transacted in a market (information is a market!), and fabricating a new beneficial context of use – free of the old one. Inside the context of a pandemic, this constitutes a method of misrepresentation to at-risk stakeholders. When conducted inside the context of a population under risk, or when exploited by media to incite panic or despair, it is a human rights crime as well."
"Legacy Data Laundering (LDL1) – state departments of health (CDC) may unilaterally, or through direction by higher agency or political intermediaries (WHO), choose to report cases or fatalities over 7-days in age, as if they occurred on the day of reasonable reporting. In this manner, a sufficient amount of old data or newly converted old data (cases or fatalities), can be exploited to craft the appearance a false trend, rise or level."
"Lockdown Death Laundering (LDL2) – state departments of health may unilaterally, or through direction by higher agency or political intermediaries, choose to designate past CDC excess all cause mortality deaths which were not attributed to Covid-19 on a death certificate, as ‘suspected’ or ‘probable’ Covid-19 deaths. In this manner, deaths from lockdown, access and despair can be attributed either as direct Covid deaths or ‘death from Covid upheaval’ – and be reported at a later date as a current Covid-19 fatality. A sufficient amount of these fatality conversions can be exploited to craft the appearance of a false trend, rise or level of fatality."
"Law of Large Numbers – a fallacy wherein an arguer does not perceive that a perceptibly large effect on a small population might serve to produce rather small numbers of outcomes, while a very small or subtle effect on a very large population, may well serve to produce surprisingly large numbers in outcome."
"Lag/Delay/Lag Curve – a delay is the period of time between when something actually occurs and when it is reported or cataloged as data..."
"...It is dishonest for a man deliberately to shut his eyes to principles/intelligence which he would prefer not to know. If he does so, he is taken to have actual knowledge of the facts to which he shut his eyes. Such knowledge has been described as ‘Nelsonian knowledge’, meaning knowledge which is attributed to a person as a consequence of his ‘willful blindness’ or (as American legal analysts describe it) ‘contrived ignorance’."
"Eristic Argument – an argument which is posed with the goal of winning and embarrassing an opposing arguer, as opposed to seeking clarity, value or common ground. Usually stems from the arguer’s past psychological injury, narcissism and combative habituation."
"Attentodemic – a pandemic or other social malady which arises statistically for the most part from an increase in testing and observation activity. From the two Latin roots attento (test, tamper with, scrutinize) and dem (the people). A pandemic/tragedy, whose curve arises solely from increases in statistical examination and testing, posting of latent cases or detected immunity as ‘current new cases’, as opposed to true increases in fact..."
"Backlog Stuffing (BS) – State departments of health may unilaterally, or through direction by higher agency or political intermediaries, choose to delay reporting of data inside one week’s period, and further then report several days of data as if it occurred in a single day. In this manner, a sufficient amount of backlog or infrequent report arrivals, can be exploited to craft the appearance a false trend, rise or record in data. When exploited by media to incite panic or despair inside the context of a population under risk, it is a human rights crime as well."
"Bridgman Point – the point at which a principle can no longer be dumbed-down any further, without sacrifice of its coherency, accuracy, salience or context."
So, Fauci et al., are a: "Scienter – ...a legal term that refers to intent or knowledge of wrongdoing while in the act of executing it. An offending party then has knowledge of the ‘wrongness’ of their dealings, methods or data, but choose to turn a blind eye to the issue, commensurate to executing or employing such dealings, methods or data. This is typically coupled with a failure to follow up on the impacts of the action taken, a failure of science called "ignoro eventum"."
"Wittgenstein Error (Contextual) – employment of words in such as fashion as to craft rhetoric, in the form of persuasive or semantic abuse, by means of shift in word or concept definition by emphasis, modifier, employment or context."
"Wittgenstein Error (Descriptive) – the contention or assumption that science has no evidence for or ability to measure a proposition or contention, when in fact it is only a flawed crafting of language and definition, limitation of language itself or lack of a cogent question or (willful) ignorance... I cannot observe it because I refuse to describe it... Science cannot observe it because I have crafted (a) language and definition so as to preclude its description... "
These one is more specific for Gates and for his employee, the WHO: "melochi kupets (Russian: мелочи купец) – trivia merchant. One who feigns competence or intimidates curious outsiders... One who cannot differentiate the distinction between a peripheral or irrelevant detail and a critical path element or principle."
"Principle of Peerhood – ...I shall not tell an epidemiologist his business... (Otherwise) The stakeholder placed at risk is the peer review... "armchair intelligence"..."
"missam singuli – ...risk being measured as an effect on the whole, while benefit is only evaluated in terms of how it benefits the individual or a single person."
"quo facto malo – Latin for ‘having done this evil’. When a person desires to do evil to another, they will manufacture or fantasize in their mind, (such as with) offenses their target has committed, which serve to therefore justify their actions; harm which they had conducted or intended to conduct from (the) very beginning, but were simply waiting for the right excuse to blame it upon..."
"nulla infantis – a pseudo-argument, sometimes cleverly disguised or hidden inside pleonasm, which basically is the equivalent of saying ‘nuh-uhhh’… Latin for (a) child’s ‘no’. Usually followed by an appeal to have the opponent shut-up or be silenced in some manner." But, now that his Dad is gone (maybe from the very same malady that his own "criature" unleashed under his orders); so, now "baby criminal brat" is almost desolate, as the forces of evil have lost one of their avid participants...
This one even goes to Cuomo and felons in crime up north, those that went with deliberate policies to kill the elderly to inflate the numbers, Cuomo you say? "Nosocomial – an illness which is contracted or occurs while one is a patient in a hospital, having been admitted for a completely separate condition"
And this this one goes to the usual reefers paid by Fauci (Lipkin, Andersen, Cohen, et al): "Ockham’s Razor – ...also means that once there exists a sufficient threshold of evidence to warrant attention (plurality), then science should seek to address the veracity of a counter claim."
"Omega Hypothesis (HΩ) – the argument which is foisted to end all argument, period. A conclusion promoted under such an insistent guise of virtue or importance, that protecting it has become imperative over even the integrity of science itself."
This one goes for the Criminal-Career Demon-Crafts, including its candidate and its Majo-Lead: "Paradox of Virtue (Covid-19) – if leadership had not shut down, all 150 k Covid deaths would be blamed on that mistake. This flawed virtue signal argument, then forces us to conduct activity which is 5 – 10 x more damaging. Like a bad SAW movie. We are exploited by evil"!!! (His words).
This goes to all those coward scientists that have not taken a position for the Truth, even if their attitude goes in detriment of their future generations: "Pluralistic Ignorance – most often, a situation in which a majority of scientists and researchers privately reject a norm, but incorrectly assume that most other scientists and researchers accept it, often because of a misleading portrayal of consensus by agenda carrying... Therefore they choose to go along with something with which they privately dissent or are neutral."
And, "Except" for this artificially made in a Lab COVID-19: "...coronaviruses are considered to be ‘sharply seasonal’... (https://archive.vn/AI8xF)"
Epidemic Threshold – when a virus is ‘in season’ – the point at which fatalities from that virus exceed 7.2% of all fatalities in a given week."
"Covid-19 Reaction Fatalities – or ‘lockdown deaths’..."
"‘Lockdown Deaths’ are estimated separately by means of the Full Covid Death Accountability Chart each week..."
"...the broken window parable ...proposes that even in disaster, an economy profits on the repair and recovery... The Bastiat Fallacy... states that... The economic benefit of war is never compared to what was lost as a result of the war"
"...baseline (solid beige line), a modified average of each week from 2014 – 2017 (2018 was an exception year and threw the average off to a mis-representative level)."
"Close-Hold Embargo – is a common form of dominance lever exerted by scientific and government agencies to control the behavior of the science press... model of coercion... under the condition that the media outlet not seek any dissenting input, nor critically question the decree, nor seek its originating authors for in-depth query."
"Net Accident Reduction – reduction in auto fatalities and iatrogenic accidental deaths."
"6. Scientific American: COVID-19 Is Likely to Lead to an Increase in Suicides; https://blogs.scientificamerican.com/observations/covid-19-is-likely-to-lead-to-an-increase-in-suicides/‘Cries for help’: Drug overdoses are soaring during the coronavirus pandemic: https://www.washingtonpost.com/health/2020/07/01/coronavirus-drug-overdose/"
"10. Dierenbach: The coronavirus response has been deadly: https://pagetwo.completecolorado.com/2020/06/11/dierenbach-the-coronavirus-response-has-been-deadly/"
"Cultivated Ignorance... such that it serves and sustains ignorance on the part of the general population – a dismissal of the necessity to seek what is unknown... its purpose is to socially minimize the number of true experts within a given field of study."
"...new Covid-19 cases per day (are mis-) reported by China to the international community. A green dotted line is fitted as an estimate of a more likely case level, based upon the rates of transmission observed by other nations..."
For the still deceived millions of the world: "5. An ignorance of risk or absence of risk strategy, is itself a risk strategy"
"...false positive outcomes as part of their assay design. When a population is tested by PCR tests, and 99% of that population is well, then there will be a high number of false positives arising from the testing of that population, even and especially compared to false negatives. In addition, beside the issue of test design, is the reality that testing labs may suffer from laxity in procedure, kit contamination or employee error or malfeasance..."
"If we have a 1% rate of false positives, inside a population which is testing at 1% prevalence, in theory almost all of the positives being detected, are indeed false. As of late August the US was conducting on average about 680,000 (COVID-19) tests per day. A 2.3% false positive rate would yield 15,640 false positives per day. The average positives detected during that same time was around 45,000 positives per day. Thus, potentially 35% of those reported positives in late August 2020, were indeed false. A study by Cohen and Kessel, updated and re-printed (18 August 2020), cited a measured median false positive rate of 2.3% for Covid RT-PCR testing. They confirmed the reality that “the likely sources of these false positives (contamination, human error) are more directly connected to laboratory practices and layouts than to which particular assay is used” (https://www.medrxiv.org/content/10.1101/2020.04.26.20080911v3)... positive case detects reported by the states and tallied at "The Covid Tracking Project"... a significant issue of concern, and citizens should be highly upset that this raw data, was passed to the media as ‘truth’."
"False Tail (The Principle of) ...it was estimated that 42% of the reported cases... were from either:
1. The 12 week shadow of RNA PCR detectability/trivial dead RNA, or
2. The lower-band rate of false positives at 0.8 – 2.3% (avg = .0155, see Cohen-Kessel Study in ‘False Positive Rate’)
This amplified caseload lent false support to the notion of keeping society partially shut down – a condition which was fatal to small and medium-sized businesses in the US, but not (to) their conglomerate competitors."
"...those who were dying of Covid in Florida were dying much later in life than the average person in the US dies, by age tier for all causes. This demonstrated that the vast majority of those dying of Covid-19, were indeed dying only months earlier than they normally would have. This is still tragic, but constituted critical information we should have had early in the Covid response effort. This allows for the calculation of life-years lost comparatives between Covid-19 fatalities and fatalities from overreaction to Covid-19."
"Gaussian Blindness (see medium fallax) – ...I’ve got my head in the oven, and my ass in the fridge, so I’m OK"
"Gompertz Curve – ...bureaucratic effect – producing a unique form which hints at a blending of a natural arrival distribution, combined with a human arrival distribution (shopcraft)." (Note: Also called: Photoshopped or for the WHO: "Theoretical models are prime over real data"!!! SOBtchs!!!).
"Asymptomatic – those cases who detected positive for Covid-19 by antibody or PCR testing, however who do not recall being sick."
"RNA-Dirty – those who detected positive for Covid-19 however never really were infected with the virus at all, rather simply carried dead fragments in their mucus or clothing. Also those who were infected up to 12 weeks earlier and still shed the dead RNA fragments."
"False Positive – a false detection of Covid-19 by
– sensitivity error
– excessive CT threshold >35
– failures of process and lab design
– individual errors/contamination
– malfeasance/maliciousness"
"...herd resistance ranging from 5% in farming communities, all the way to 70% in prisons, for instance."
Please, quote as: "The Ethical Skeptic, “The Definitive Guide to Ethical Skeptic’s (TES/ES) Coronavirus SARS-CoV-2 (2019) Analysis”; The Ethical Skeptic, WordPress, 9 Aug 2020; Web, https://theethicalskeptic.com/?p=44989" (There attached a PDF with en Edited view that made more sense to me...): https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031
"I began to apply my skills in order to see if the media and agency-bearing academics were indeed telling the truth. As it turned out, in critical significance, they were not."
"The Great Repression – the period of severe depression economic fallout greater than that of the Great Depression, characterized by 38 million jobs (11.5%) and 500,000 or more lockdown lives lost and 6 million famine lives lost, which resulted from an over-reaction to and/or incompetent understanding of coronaviruses and Covid-19 in particular. Marketing disinformation as an academic, governmental or media authority, in order to compel despair, panic or compliance inside a population under duress of epidemic, war or economic collapse – these things are indistinguishable from war crimes. They are a violation of basic human rights, and as such constitute acts of class harm, scienter, racketeering and oppression."
"Lockdown/Great Repression Fatality – a fatality reported by a state department of health and cataloged by the CDC in which the person’s death was caused by lack of access to medical services (diabetes, heart disease, stroke, other illnesses, etc.), lack of adequate diagnosis (cancer, etc.) or Suicide Addiction Abandonment & Abuse."
"...Covid directly or indirectly precipitated an increase in deaths attributable to known natural causes (9,079 fatalities overage versus normal)... these additional deaths served to also create a hole in the death rate starting 8 weeks later and onward (13,429 fatality deficit versus normal). In this instance, Covid-19 impacted death rates by ‘pulling forward’ deaths which would have occurred in July and August, and forced those to occur in April and May... it is estimated that we have experienced possibly 40-45% of the pull-forward deficit. The full pull-forward deficit will not be known until as far out as May of 2021."
Oh Patriotic Citizens of the USA and of the World, you are The Owners of The: "Stakeholder Ethics – a principle or condition wherein those who bear the negative impact of a decision can hold those who make that decision, accountable. Further then may dissent, and reverse that decision or remove the decision maker, even if they claim to be an ‘expert’. A claim to science is not a free pass to tyranny."
"NiCFR – net infectious case-fatality rate (risk). The total ‘died of’ and ‘died with’ fatalities from a given pathogen, minus those who died as a result of over-reaction or ignorance around that pathogen, divided by the estimated total population which was infected by that pathogen. Has nothing to do with symptomatic rates."
"...data must be denatured of its noise, into information... then... into intelligence... the only basis from which to infer or take action..."
For the first graphic shown here: "...US Covid-19 progression...: The blue vertical column bars indicate case arrivals each day in the northern 37 states, while the orange vertical bar arrivals show the patterns in the southerly hot 50 border counties or hot 13 states (seen here in Figure 6)... This surge in cases peaked on July 16th, 13 or 14 weeks after the north latitude peak (one quarter of the year)... each case peak adhered to Farr’s Law (https://archive.vn/N1QsO: "...epidemic events rise and fall in a roughly symmetrical pattern. The time-evolution behavior could be captured by a single mathematical formula that could be approximated by a bell-shaped curve")... this latter surge in cases was not a ‘second wave’ as much as it was a sympathetic overflow from southerly latitude patterns of the same virus... This latitudinal effect is called a Hope-Simpson subtropical latitude effect (https://archive.vn/1X7xC). This should have been known before we decided policy. Most predictive models for the pandemic were merely regression models, with high and low banding. None of them predicted the distinct Farr’s Law shape of this latitudinal surge.... this surge in cases formed a peak around July 16th (2020), which was immediately called by The Ethical Skeptic by means of the charts to the lower right, but took a full 3 weeks to be acknowledged by official channels and media, most of whom still did not even mention the tail off by early September (2020)... The curve continued an upward progression until it lost that momentum on 16 July (2020) and never recovered it. The Ethical Skeptic was watching for a confirmatory rise in fatalities 28 days after the initial rise in cases – and indeed a mild rise in fatalities formed, confirming that this reported rise in cases was about 37% real, (and) 63% salting through new practices of case detection ...(this means in blunt terms, that:) the gentle rise in percent positive ...was 37% real cases in our 50 hottest counties composing the July 16th surge, while 63% of that rise was crafted through salting/juking of reported cases"!!!
From a related graph, also applicable to all: "...curves should move in a given ratio throughout the horizon, unless an exception has occurred such as Legacy Data Laundering LDL-1 or Lockdown Death Laundering LDL-2." (See below the definitions of these criminal statistical lies imposed over humanity by the killers-that-be). "...The degree of Lockdown Death Laundering (LDL-2) can be ascertained by comparing the height of each day’s ...column, versus the ...CDC excess all-cause deaths line... adjusted for (the) documented CDC lag..."
"SupraLag – that CDC lag in posting of actual deaths (shortfall in all-cause death count) by date in the MMWR weekly data, which exceeded by a large amount, the typical lag which the CDC had historically exhibited for that same week (current week minus x MMWR weeks). Ideally if both the CDC and analyst tracking them are performing well in their duties, SupraLag should be minimal."
"Death ‘from’/Death ‘with’ Covid – an important principle in that there are those who died of Covid, who simply/trivially had Covid RNA in the nostrils while they were already dying of something else, as opposed to actually dying from Covid as a primary or secondary cause of death. The reason this is important is that the former group causes a ‘pull forward’ effect which will artificially make it appear that suddenly Americans are not dying of other diseases any longer, either now or in the future. This effect as raw data, will serve to mislead."
"...the parody ‘Lemming Cycle of Continuous Impairment’ is also a satirical commentary upon how panicked state level government officials served to foment continued panic and despair around Covid-19. Also derived from the allegory of fictitious lemmings who run off a mythical cliff en masse, in their hysteria to achieve a given inductively derived or panic-fueled goal. The cycle wherein panic over perceived cases of Covid-19, drove demands inside certain state government levels for more testing and track-and-trace team funding, which resulted in increased PCR tests run and false/3-month-old positives being generated, which resulted in ever higher positive case-detects being reported as raw data by the states, which resulted in more panic/despair. Incompetence. Forgetting the data grooming methods employed with annual flu analytics and opting instead to simply report raw data – a scientific error." And I may say a deliberate one, and a crime!!!
"The Lemming Cycle (boosted as well by false positive PCR testing results which were left unchallenged), fueled a feedback cycle of panic inside the media and administrative government decision-makers, regarding Covid-19."
"RNA/Virus Detection Half-Life – the period after which half of those who were infected at one time, can no longer present detectable dead or inactive Covid-19 RNA. The half-life period has been evaluated to be as much as 7 weeks. The entire period of detectability is 14 weeks. This noise in data collection was exploited by nefarious political and power hungry forces during the pandemic."
"Salting/Juking Reported Cases – one or more of a variety of methods of boosting reported cases of Covid-19 in order to make the pandemic seem hotter, growing when actually in decline or larger than is its reality. Includes methods such as
legacy data laundering,
backlog stuffing,
AB testing results mixed with PCR testing,
focus on hot spots,
posting track and trace %-pos results only,
testing prisons care facilities and factories only,
temperature screening selected testing,
report of ‘suspected’ cases,
non-reporting of negative tests,
delay or lag exploitation,
multiple tests on one person,
cross-border cases,
hospital comprehensive screening,
nosocomial cases,
paying people who (or TO) test positive,
batch swab testing followed by individual testing, etc."
"The comparative between ICU Census and deaths allows the astute analyst to observe that reported deaths can contain legacy data up to 12 weeks old in some cases, and most often in excess of 3 weeks old... key in estimating Legacy Death Laundering (LDL2)..."
https://omny.fm/shows/the-todd-herman-show/independent-data-analyst-ethical-skeptic-joins-the
And for those assholes self-deemed as "fact-checkers": "...every person has a right, responsibility or qualification as a victim/stakeholder to make their voice heard..."!!!
"Agency" (y note: Such as the NIH of Collins, Hehee): "...when a denial is involved, the incentive to double-down on that denial, in order to preserve office, income or celebrity – is larger than either bias or nominal conflict of interest... A "tendentious" person holds their position from a compulsion which they cannot overcome through objective evaluation. One cannot be reasoned out of, a position which they did not reason themselves into to begin with... catch-phrases that a person will employ to demonstrate that they are inside the approved club or academic circle around a particular topic..." (and talking about Francis S. Collins): "...A blindly devoted official, follower, or organization member... One who either ignorantly or obdurately lacks any concern or circumspection ability which might prompt them to examine the harm their position may serve to cause..", from elsewhere in the article: "...Be wary of agency which exploits the appearance of raw data...", and before: "..raw data – which most often will serve to dis-inform..."
"in order to comprehend the risk entailed to the general stakeholding public – and the hazard presented by those who wish to exploit the tragedy as a means to abuse..."
And about Fauci, Gates, CDC (again and again, as the criminal par excelence which that one indeed is) and Birx and the WHO (to all of them felons belong the information below)...: "Catalyseur – ...A conflict exploitation specialist, or any entity which stands to gain under the outcome of a lose-lose conflict scenario which they have served to create, abet or foment. Someone who acts as a third party to two sides in an argument or conflict, who advises about the ‘truth’ of the other party involved, respectively and urges an escalation of factors which drove the conflict to begin with."
"Shopcraft – traits, arrival forms and distributions of data which exhibit characteristics of having been produced by a human organization, policy or mechanism. A result which is touted to be natural, random or unconstrained, however which features patterns or mathematics which indicate (that) human intervention is at play inside its dynamics. A method of detecting agency, and not mere bias, inside a system."
"Slapping the Grizzly/Bear – if someone implies to you that they know exactly the outcome of slapping a grizzly bear in order to get it to go away – they themselves are more dangerous than a virus by far – no matter how many risk PhD’s they may hold. The act of becoming robust to a constrained small-risk of harm/death bearing sound epistemic precedent (a virus with 4 months of observation and multiple precedents) – while exposing (the USA) to an unconstrained large-risk of ruin/death, derived from our actions (an economic Great Repression), which bears no epistemic precedent …is like slapping a grizzly bear to compel it to go away."
"Mobsensus – the inferential will of media, club, mafia, cabal or cartel – in which a specific conclusion is enforced upon the rest of society, by means of threat, violence, social excoriation or professional penalty; further then the boasting of or posing such insistence as ‘scientific consensus’."
And as the WHO and CDC do under the higher-bidder$ orders: "...through sleight-of-hand, changing the context of its employment without the soundness..."
"...never ascribe to happenstance or incompetence, that which coincidentally, consistently ...supports a preexisting agency... a handful of the clever manipulating the ignorance of the millions."
"Marketing disinformation as an academic, governmental or media authority, in order to compel despair, panic or compliance inside a population under duress of epidemic, war or economic collapse – these things are indistinguishable from war crimes. They are a violation of basic human rights, and as such constitute acts of class harm, scienter, racketeering and oppression."
"Indigo Point (Inflection Point) – ...event or mechanism which is manipulated early in a process... which will alter/tip subsequent events towards a specific final outcome. It is the magician’s unremarkable sleeve"!!!
"ingens vanitatum Argument – citing a great deal of expert irrelevance. A posing of ‘fact’ or ‘evidence’ framed inside an appeal to expertise... which serves to dis-inform as to the nature of the argument being vetted or the critical evidence or question being asked."
"Laundering (of Legacy Cases and Fatalities) – partly a term from data management and partly coined for the Covid-19 response. Legacy data is any form of old data which involves work in transcribing into a new system, approach or context. "Laundering" is the process of removing the old undesirable context for an item transacted in a market (information is a market!), and fabricating a new beneficial context of use – free of the old one. Inside the context of a pandemic, this constitutes a method of misrepresentation to at-risk stakeholders. When conducted inside the context of a population under risk, or when exploited by media to incite panic or despair, it is a human rights crime as well."
"Legacy Data Laundering (LDL1) – state departments of health (CDC) may unilaterally, or through direction by higher agency or political intermediaries (WHO), choose to report cases or fatalities over 7-days in age, as if they occurred on the day of reasonable reporting. In this manner, a sufficient amount of old data or newly converted old data (cases or fatalities), can be exploited to craft the appearance a false trend, rise or level."
"Lockdown Death Laundering (LDL2) – state departments of health may unilaterally, or through direction by higher agency or political intermediaries, choose to designate past CDC excess all cause mortality deaths which were not attributed to Covid-19 on a death certificate, as ‘suspected’ or ‘probable’ Covid-19 deaths. In this manner, deaths from lockdown, access and despair can be attributed either as direct Covid deaths or ‘death from Covid upheaval’ – and be reported at a later date as a current Covid-19 fatality. A sufficient amount of these fatality conversions can be exploited to craft the appearance of a false trend, rise or level of fatality."
"Law of Large Numbers – a fallacy wherein an arguer does not perceive that a perceptibly large effect on a small population might serve to produce rather small numbers of outcomes, while a very small or subtle effect on a very large population, may well serve to produce surprisingly large numbers in outcome."
"Lag/Delay/Lag Curve – a delay is the period of time between when something actually occurs and when it is reported or cataloged as data..."
"...It is dishonest for a man deliberately to shut his eyes to principles/intelligence which he would prefer not to know. If he does so, he is taken to have actual knowledge of the facts to which he shut his eyes. Such knowledge has been described as ‘Nelsonian knowledge’, meaning knowledge which is attributed to a person as a consequence of his ‘willful blindness’ or (as American legal analysts describe it) ‘contrived ignorance’."
"Eristic Argument – an argument which is posed with the goal of winning and embarrassing an opposing arguer, as opposed to seeking clarity, value or common ground. Usually stems from the arguer’s past psychological injury, narcissism and combative habituation."
"Attentodemic – a pandemic or other social malady which arises statistically for the most part from an increase in testing and observation activity. From the two Latin roots attento (test, tamper with, scrutinize) and dem (the people). A pandemic/tragedy, whose curve arises solely from increases in statistical examination and testing, posting of latent cases or detected immunity as ‘current new cases’, as opposed to true increases in fact..."
"Backlog Stuffing (BS) – State departments of health may unilaterally, or through direction by higher agency or political intermediaries, choose to delay reporting of data inside one week’s period, and further then report several days of data as if it occurred in a single day. In this manner, a sufficient amount of backlog or infrequent report arrivals, can be exploited to craft the appearance a false trend, rise or record in data. When exploited by media to incite panic or despair inside the context of a population under risk, it is a human rights crime as well."
"Bridgman Point – the point at which a principle can no longer be dumbed-down any further, without sacrifice of its coherency, accuracy, salience or context."
So, Fauci et al., are a: "Scienter – ...a legal term that refers to intent or knowledge of wrongdoing while in the act of executing it. An offending party then has knowledge of the ‘wrongness’ of their dealings, methods or data, but choose to turn a blind eye to the issue, commensurate to executing or employing such dealings, methods or data. This is typically coupled with a failure to follow up on the impacts of the action taken, a failure of science called "ignoro eventum"."
"Wittgenstein Error (Contextual) – employment of words in such as fashion as to craft rhetoric, in the form of persuasive or semantic abuse, by means of shift in word or concept definition by emphasis, modifier, employment or context."
"Wittgenstein Error (Descriptive) – the contention or assumption that science has no evidence for or ability to measure a proposition or contention, when in fact it is only a flawed crafting of language and definition, limitation of language itself or lack of a cogent question or (willful) ignorance... I cannot observe it because I refuse to describe it... Science cannot observe it because I have crafted (a) language and definition so as to preclude its description... "
These one is more specific for Gates and for his employee, the WHO: "melochi kupets (Russian: мелочи купец) – trivia merchant. One who feigns competence or intimidates curious outsiders... One who cannot differentiate the distinction between a peripheral or irrelevant detail and a critical path element or principle."
"Principle of Peerhood – ...I shall not tell an epidemiologist his business... (Otherwise) The stakeholder placed at risk is the peer review... "armchair intelligence"..."
"missam singuli – ...risk being measured as an effect on the whole, while benefit is only evaluated in terms of how it benefits the individual or a single person."
"quo facto malo – Latin for ‘having done this evil’. When a person desires to do evil to another, they will manufacture or fantasize in their mind, (such as with) offenses their target has committed, which serve to therefore justify their actions; harm which they had conducted or intended to conduct from (the) very beginning, but were simply waiting for the right excuse to blame it upon..."
"nulla infantis – a pseudo-argument, sometimes cleverly disguised or hidden inside pleonasm, which basically is the equivalent of saying ‘nuh-uhhh’… Latin for (a) child’s ‘no’. Usually followed by an appeal to have the opponent shut-up or be silenced in some manner." But, now that his Dad is gone (maybe from the very same malady that his own "criature" unleashed under his orders); so, now "baby criminal brat" is almost desolate, as the forces of evil have lost one of their avid participants...
This one even goes to Cuomo and felons in crime up north, those that went with deliberate policies to kill the elderly to inflate the numbers, Cuomo you say? "Nosocomial – an illness which is contracted or occurs while one is a patient in a hospital, having been admitted for a completely separate condition"
And this this one goes to the usual reefers paid by Fauci (Lipkin, Andersen, Cohen, et al): "Ockham’s Razor – ...also means that once there exists a sufficient threshold of evidence to warrant attention (plurality), then science should seek to address the veracity of a counter claim."
"Omega Hypothesis (HΩ) – the argument which is foisted to end all argument, period. A conclusion promoted under such an insistent guise of virtue or importance, that protecting it has become imperative over even the integrity of science itself."
This one goes for the Criminal-Career Demon-Crafts, including its candidate and its Majo-Lead: "Paradox of Virtue (Covid-19) – if leadership had not shut down, all 150 k Covid deaths would be blamed on that mistake. This flawed virtue signal argument, then forces us to conduct activity which is 5 – 10 x more damaging. Like a bad SAW movie. We are exploited by evil"!!! (His words).
This goes to all those coward scientists that have not taken a position for the Truth, even if their attitude goes in detriment of their future generations: "Pluralistic Ignorance – most often, a situation in which a majority of scientists and researchers privately reject a norm, but incorrectly assume that most other scientists and researchers accept it, often because of a misleading portrayal of consensus by agenda carrying... Therefore they choose to go along with something with which they privately dissent or are neutral."
And, "Except" for this artificially made in a Lab COVID-19: "...coronaviruses are considered to be ‘sharply seasonal’... (https://archive.vn/AI8xF)"
Epidemic Threshold – when a virus is ‘in season’ – the point at which fatalities from that virus exceed 7.2% of all fatalities in a given week."
"Covid-19 Reaction Fatalities – or ‘lockdown deaths’..."
"‘Lockdown Deaths’ are estimated separately by means of the Full Covid Death Accountability Chart each week..."
"...the broken window parable ...proposes that even in disaster, an economy profits on the repair and recovery... The Bastiat Fallacy... states that... The economic benefit of war is never compared to what was lost as a result of the war"
"...baseline (solid beige line), a modified average of each week from 2014 – 2017 (2018 was an exception year and threw the average off to a mis-representative level)."
"Close-Hold Embargo – is a common form of dominance lever exerted by scientific and government agencies to control the behavior of the science press... model of coercion... under the condition that the media outlet not seek any dissenting input, nor critically question the decree, nor seek its originating authors for in-depth query."
"Net Accident Reduction – reduction in auto fatalities and iatrogenic accidental deaths."
"6. Scientific American: COVID-19 Is Likely to Lead to an Increase in Suicides; https://blogs.scientificamerican.com/observations/covid-19-is-likely-to-lead-to-an-increase-in-suicides/‘Cries for help’: Drug overdoses are soaring during the coronavirus pandemic: https://www.washingtonpost.com/health/2020/07/01/coronavirus-drug-overdose/"
"10. Dierenbach: The coronavirus response has been deadly: https://pagetwo.completecolorado.com/2020/06/11/dierenbach-the-coronavirus-response-has-been-deadly/"
"Cultivated Ignorance... such that it serves and sustains ignorance on the part of the general population – a dismissal of the necessity to seek what is unknown... its purpose is to socially minimize the number of true experts within a given field of study."
"...new Covid-19 cases per day (are mis-) reported by China to the international community. A green dotted line is fitted as an estimate of a more likely case level, based upon the rates of transmission observed by other nations..."
For the still deceived millions of the world: "5. An ignorance of risk or absence of risk strategy, is itself a risk strategy"
"...false positive outcomes as part of their assay design. When a population is tested by PCR tests, and 99% of that population is well, then there will be a high number of false positives arising from the testing of that population, even and especially compared to false negatives. In addition, beside the issue of test design, is the reality that testing labs may suffer from laxity in procedure, kit contamination or employee error or malfeasance..."
"If we have a 1% rate of false positives, inside a population which is testing at 1% prevalence, in theory almost all of the positives being detected, are indeed false. As of late August the US was conducting on average about 680,000 (COVID-19) tests per day. A 2.3% false positive rate would yield 15,640 false positives per day. The average positives detected during that same time was around 45,000 positives per day. Thus, potentially 35% of those reported positives in late August 2020, were indeed false. A study by Cohen and Kessel, updated and re-printed (18 August 2020), cited a measured median false positive rate of 2.3% for Covid RT-PCR testing. They confirmed the reality that “the likely sources of these false positives (contamination, human error) are more directly connected to laboratory practices and layouts than to which particular assay is used” (https://www.medrxiv.org/content/10.1101/2020.04.26.20080911v3)... positive case detects reported by the states and tallied at "The Covid Tracking Project"... a significant issue of concern, and citizens should be highly upset that this raw data, was passed to the media as ‘truth’."
"False Tail (The Principle of) ...it was estimated that 42% of the reported cases... were from either:
1. The 12 week shadow of RNA PCR detectability/trivial dead RNA, or
2. The lower-band rate of false positives at 0.8 – 2.3% (avg = .0155, see Cohen-Kessel Study in ‘False Positive Rate’)
This amplified caseload lent false support to the notion of keeping society partially shut down – a condition which was fatal to small and medium-sized businesses in the US, but not (to) their conglomerate competitors."
"...those who were dying of Covid in Florida were dying much later in life than the average person in the US dies, by age tier for all causes. This demonstrated that the vast majority of those dying of Covid-19, were indeed dying only months earlier than they normally would have. This is still tragic, but constituted critical information we should have had early in the Covid response effort. This allows for the calculation of life-years lost comparatives between Covid-19 fatalities and fatalities from overreaction to Covid-19."
"Gaussian Blindness (see medium fallax) – ...I’ve got my head in the oven, and my ass in the fridge, so I’m OK"
"Gompertz Curve – ...bureaucratic effect – producing a unique form which hints at a blending of a natural arrival distribution, combined with a human arrival distribution (shopcraft)." (Note: Also called: Photoshopped or for the WHO: "Theoretical models are prime over real data"!!! SOBtchs!!!).
"Asymptomatic – those cases who detected positive for Covid-19 by antibody or PCR testing, however who do not recall being sick."
"RNA-Dirty – those who detected positive for Covid-19 however never really were infected with the virus at all, rather simply carried dead fragments in their mucus or clothing. Also those who were infected up to 12 weeks earlier and still shed the dead RNA fragments."
"False Positive – a false detection of Covid-19 by
– sensitivity error
– excessive CT threshold >35
– failures of process and lab design
– individual errors/contamination
– malfeasance/maliciousness"
"...herd resistance ranging from 5% in farming communities, all the way to 70% in prisons, for instance."
Please, quote as: "The Ethical Skeptic, “The Definitive Guide to Ethical Skeptic’s (TES/ES) Coronavirus SARS-CoV-2 (2019) Analysis”; The Ethical Skeptic, WordPress, 9 Aug 2020; Web, https://theethicalskeptic.com/?p=44989" (There attached a PDF with en Edited view that made more sense to me...): https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031
Updated Sep 19, 2020, 4:40 PM
Fernando Castro-Chavez shared a memory.
2 Years Ago
Fernando Castro-Chavez added a new photo.
Oct 14, 2018, 1:09 PM
Uno de los textos que más le agradan a Axel, "El lay de Aristóteles", fue cubierto por el profesor Sánchez Ocampo, señalando que es un estilo olvidado que Arreola revivió, siendo esta tan sólo una de sus poligrafías, que según he encontrado, suman ya casi 120 en sus obras. Este "lay" escrito por Arreola describe el imposible romance entre Armonía y Aristóteles, quien aunque fue arrasado por la "ineludibilidad" (palabra que erróneamente Word me marca como errónea) de la poesía, al final intentó, ficticiamente, desde luego, desmenuzar en todos sus detalles a todo esto en su "Tratado sobre Armonía" (la cual cabalga literalmente sobre él en los altorrelieves medievales, y sobre su prosa torpe y burda en el texto de Arreola), uno más de los miles de libros que fueran quemados por los musulmanes de la desaparecida "Biblioteca de Alejandría"; fue precisamente en estas conferencias que tuve el honor de conocer a mi amigo Rilj Herschel, y luego a su hermana en nuestro evento del 20 en Educem Ciudad Guzman
Place: Casa del Arte CUSUR (19.706604646923, -103.46244911615)
Address: Avenida Cristobal Colón 143, Centro, 49000 Ciudad Guzmán, Jalisco, Mexico
Two years ago, a room full! Today, tracking the roots of a virus that is being used by every bully that be to subjugate its neighbor... God, stop them!
Updated Sep 18, 2020, 1:26 PM
The Artificial Origins of "Plandemic COVID-19" Revealed Since Two Months Ago: https://archive.vn/Brufs, and its press coverage (but not on the currently corrupted TV): https://archive.vn/zERqY, https://archive.vn/SJwtx, https://archive.vn/uhLDP, https://archive.vn/4usX7, etc..., etc..., what can be done by the ones that can do something???
Where the LIBERTY Bell is: "The Constitution cannot accept the concept of a "new normal" where the basic liberties of the people can be subordinated to open-ended emergency mitigation measures. Rather, the Constitution sets certain lines that may not be crossed, even in an emergency." Judge Rules COVID-19 Lockdown Unconstitutional (Please, Go On, All Nations!!!): https://web.archive.org/web/20200917232739/https://renzlaw.files.wordpress.com/2020/09/pa-butler-v.-wolf1.pdf, https://archive.vn/VerUZ
Para que no se quede en el olvido, el testimonio del descubridor del método CRISPR (un recordatorio del escritor y economista Alex Spin, quien también escribe de las bellezas naturales: https://archive.vn/LAfm2): https://www.informacion.es/alicante/2020/01/31/francis-mojica-apunta-coronavirus-mutante-4897007.html (https://archive.vn/ds84v), la pregunta es sencilla: "¿Queremos ganarnos al mundo al tiempo que lo perdemos como era antes, o buscamos la verdad para llegar con ella hasta donde ella tope?"
A "record breaker", in just few hours of its publication today, it already reached the 157,000 views: Unusual Features of the SARS-CoV-2 Genome Suggesting Sophisticated Laboratory Modification Rather Than Natural Evolution and Delineation of Its Probable Synthetic Route, by bold Yan, Li-Meng; Kang, Shu; Guan, Jie; Hu, Shanchang. https://zenodo.org/record/4028830; and its download: https://zenodo.org/record/4028830/files/The_Yan_Report.pdf?download=1
You tagged Stefano Macedo Reyes
On studying one of the references of the great book by my student Stefano Macedo Reyes: https://www.amazon.com.au/DNA-Diet-Hack-Your-Genes-ebook/dp/B087X1JKSX, I found the next vital link, about Yourself Being Mindful: https://www.huffpost.com/entry/meditation-health-benefits_n_3178731, the related video is the amazing one about "Neurotheology": https://www.facebook.com/HuffPost/videos/next-level-living-episode-5-what-are-the-benefits-of-meditation/10153680138496130/, and the extra links there reported (many of them broken,are): Meditation: https://archive.vn/aMQLw
https://web.archive.org/web/20141228103237/http://psyphz.psych.wisc.edu/web/News/Meditation_Alters_Brain_WSJ_11-04.htm
https://web.archive.org/web/20130820064317/http://www.time.com:80/time/magazine/article/0,9171,1147167-2,00.html (https://archive.vn/Xtvej)
https://archive.vn/xvGhv (same as the previous one, but used twice in the illustrative images)
https://archive.vn/U7gt0
https://archive.vn/D7Xey
https://www.sciencedaily.com/releases/2008/07/080724215644.htm (https://web.archive.org/web/20190720020305/https://www.sciencedaily.com/releases/2008/07/080724215644.htm, https://archive.vn/R4bq1)
https://web.archive.org/web/20140621163608/http://phys.org/news/2011-04-demystifying-meditation-brain-imaging.html (https://web.archive.org/web/20181229082847/https://medicalxpress.com/news/2011-04-demystifying-meditation-brain-imaging.html), an amazing dive into the power of purposeful PRAYER, both including our understanding and without our understanding!!!
https://web.archive.org/web/20141228103237/http://psyphz.psych.wisc.edu/web/News/Meditation_Alters_Brain_WSJ_11-04.htm
https://web.archive.org/web/20130820064317/http://www.time.com:80/time/magazine/article/0,9171,1147167-2,00.html (https://archive.vn/Xtvej)
https://archive.vn/xvGhv (same as the previous one, but used twice in the illustrative images)
https://archive.vn/U7gt0
https://archive.vn/D7Xey
https://www.sciencedaily.com/releases/2008/07/080724215644.htm (https://web.archive.org/web/20190720020305/https://www.sciencedaily.com/releases/2008/07/080724215644.htm, https://archive.vn/R4bq1)
https://web.archive.org/web/20140621163608/http://phys.org/news/2011-04-demystifying-meditation-brain-imaging.html (https://web.archive.org/web/20181229082847/https://medicalxpress.com/news/2011-04-demystifying-meditation-brain-imaging.html), an amazing dive into the power of purposeful PRAYER, both including our understanding and without our understanding!!!
Fernando Castro-Chavez shared a link to the group: FerKat.
Diabetes Diet acording to my student Estefano Macedo: Food: A Diet Based on Plants MODERATE on Carbohydrates.
❤
1
Nutraceuticals: Acid R-Lipoic, Omega 3 from Seaweed, and CoQ10
Herbs: Cinnamon, Ginger, Nopal (Opuntia sp.), Salvia (Lamiaceae from the mint family)
This is his book:
https://www.amazon.com.au/DNA-Diet-Hack-Your-Genes-ebook/dp/B087X1JKSX
And the advised link on Meditation: geti.in/1lwwnxW, which is: https://www.huffpost.com/entry/meditation-health-benefits_n_3178731
❤
1
Nutraceuticals: Acid R-Lipoic, Omega 3 from Seaweed, and CoQ10
Herbs: Cinnamon, Ginger, Nopal (Opuntia sp.), Salvia (Lamiaceae from the mint family)
This is his book:
https://www.amazon.com.au/DNA-Diet-Hack-Your-Genes-ebook/dp/B087X1JKSX
And the advised link on Meditation: geti.in/1lwwnxW, which is: https://www.huffpost.com/entry/meditation-health-benefits_n_3178731
Fernando Castro-Chavez posted in FerKat.
Fernando Castro-Chavez posted in FerKat.
"Give your love and help to others when they deserve it the least, because it's then when they need it the most." https://www.facebook.com/TheKindnessGuy/videos/687325898465275/
You tagged Kent Heckenlively and John L Mikovits III
Search results of today, using the same words, between an every day more and more trustless by the biased, minimal, or limited "results" that Google provides, versus a still open search engine (Search saved to freeze a moment in time, today, where similar deceptive strategies as then, are been used by evil minds for their private and ulterior motives), only God can help, and inspire His own to act for the good while there is still time to do it!: https://archive.vn/WJuKu compared to https://archive.vn/MUkMg, below I indicate how all of this confirms before and today the wise words of Mikovits and of Kent Heckenlively, of us being punished for working hard on things that are unpleasant for the NIH, but beneficial for humanity!, which just confirms their involvement on the financing and launching of the current and malicious Plandemic!!!
The current press conference by Trump going on right now: https://youtu.be/P1NZJoAijZs
Updated Sep 10, 2020, 3:48 PM
Fernando Castro-Chavez updated his status.
Suing every single head of corruption that is ordering in the USA the injection of venomous substances against the will of adults, and worst of all, of defenseless children that got chronic diseases out of the v.a.c.c.i.n.e.s of hell, absolutely NOT necessary as God developed for us our enduring immune system, we do not need to "help" it at all (it is documented at least 1500 times, that are ignored by the corrupted money that Big Pharma pours on the hypnotic and corrupted mass media):
Fernando Castro-Chavez updated his status.
Just say NO to the preplanned hell in the cover of COVID-19 and a completely useless and unnecessary "v.a.c.c.i.n.e" from hell:
Fernando Castro-Chavez updated his status.
Robert F. Kennedy Jr., one of the very FEW patriots of the planet for good doing something from his area of influence:
Fernando Castro-Chavez posted in FerKat.
Fernando Castro-Chavez wrote on Lidia Ruiz Gomez's timeline.
Una muy feliz cercanía al retorno de Nuestro Señor!!!
Remembering Once More the Original Revelation of Matthew 28:19 for Those Still With Eyes To See: https://web.archive.org/web/20081229235917/http://www.geocities.com/fdocc3/in-my-name.htm (including one PDF by one of the big scholars that studied this: https://www.geocitiesarchive.org/arclc/f/d/fdocc3/conybeare.pdf), and the incomplete index from another of my many sites that is preserving few of my endless pages posted in the good ol' Geocities times! (see some remembrances below):
Also protesting in Australia against the insane "protocols" by the globalists to submit the world population to their heartless plans: https://www.facebook.com/BenSwannRealityCheck/videos/646531375995807/
Updated Sep 7, 2020, 6:31 PM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Fernando Castro-Chavez added a new photo.
Sep 7, 2015, 12:07 PM
Para los amados santos de habla hispana: La presentación en vivo de la "Astronomía del Nacimiento de Jesús" será este viernes a las 7:50 P.M., hora de Houston, TX, en: https://www.youtube.com/c/catadoresdelapalabra1 Sus transparencias: http://fdocc.ucoz.com/2/06_estrella_de_belen_2015.pdf Comenzamos a las 7:30 por Skype para oraciones y manifestar espíritu santo, y después para la sobremesa!!! En Cristo, Fernando.
Moon memories from the astronomy in the arrival of Jesus our Christ, the eclipse of Regulus when in conjunction to Jupiter twice, representing respectively the transfer of the Scepter and of the Legal Authorization to rule: The Legislator.
Updated Sep 7, 2020, 10:25 AM
The Best Moment Spiritually and Emotionally of "Fireproof", about Love with NO Conditions: https://youtu.be/t0-hF-8fei8
Updated Sep 7, 2020, 9:25 AM
Fernando Castro-Chavez posted in FerKat.
Almost ten months ago, I started learning in the practice that: https://youtu.be/Hsw7yaFGNQw, Slanted Girl: "Brainstorm, take me away from the norm... you ought to know what brings me here... You live too far away... nothing good comes easily sometimes you gotta fight... still it's fine from afar, and you know that..."!!! With all of my beaten heart, for the one that captured my heart, the one that teaches me about it on a daily basis in the practice, the one that leads me to discover the real meaning of (Since the 18th of Nov., 2019): https://www.azlyrics.com/lyrics/311/amber.html
Updated Sep 6, 2020, 10:40 AM
Fernando Castro-Chavez shared a memory.
8 Years Ago
Fernando Castro-Chavez added a new photo.
Sep 6, 2012, 5:17 PM
Este es el grupo de artistas que nos hicieron bailar por 3 h con sus ~40 canciones en inglés de los 50's y 60's; Ethan nos consiguió el poster firmado por ellos (en fotos de mi esposa) y su última sudadera disponible (donada por Jamie Harden!). Ellen nos recibió en su casa y nos transportó.
Tenn saw
Updated Sep 6, 2020, 8:24 AM
Parody of an imbecile who is willing to remove GOD from our PLEDGE of ALLEGIANCE TO GOD!!!: https://www.youtube.com/watch?v=n2lTIh536jY
Updated Sep 5, 2020, 7:48 AM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Fernando Castro-Chavez added a new photo.
Sep 4, 2015, 4:18 PM
So, if you are around and want to come, tomorrow Saturday 09/05/15 at 7:00 PM we'll study the astounding 'Astronomy of the Birth of Jesus', also possible to be seen at: https://www.youtube.com/c/CatadoresDeLaPalabra1 (live and afterwards); and its slides: http://fdocc.ucoz.com/2/03_star_bethlehem_1_2015.pdf (the same info. will be shared in Spanish next Friday 11 at 7:50 PM) See ya!
The Astronomy Created by God Bending all of its Knees Like a Giant to Honor the Birth of Jesus our Christ!!!! How much more an insignificant invisible virus designed on a bench and released to harm first the weakest
Updated Sep 4, 2020, 1:32 PM
There are no words to describe the JOY...: https://youtu.be/gI2eNnoJaBs
Updated Sep 4, 2020, 10:47 AM
Fernando Castro-Chavez shared a link to the group: FerKat.
Fernando Castro-Chavez posted in FerKat.
Ah!, before I forget, the quotation of the subatomic particles from PBS, and its very good teacher (she forgot to put ARE, as in: "Quarks ARE the building blocks"), let us get a traveling Van for our traveling dream, yeah!!! One season of traveling all over the USA to live its motor-home culture, and then settle in the ONE dream place that we liked the most!!!!:
Fernando Castro-Chavez shared a link to the group: FerKat.
My Job application of today was for the California Institute of Technology at Pasadena, CA, 45 min. to the LA Airport, to go an pick you there (if I get the job as Postdoc in DNA Repair), through the Research Gate. With your BSc, you may be able to subscribe there to help finding the best jobs and to apply for them: https://www.researchgate.net/jobs
Recuerdos del 2018, cuando aún existía la "Sana Interacción", la "Sana Inmunidad Natural", el "Convive Con Otros", el "No Andes Asustado", el "Dí NO al Bozal", el "Ignora a la Prensa Corrupta", etc., etc... esperando con todas las ganas volver a la "Antigua y Humana NORMALIDAD"!!! Di NO a los malditos globalistas que intentan capturar por sorpresa y marcar bajo pretexto a toda la humanidad!!!: https://fdocc2.wordpress.com/2018/12/12/dos-periodicos-del-sur-de-jalisco-narran-nuestra-arreolanza-del-27-de-nov-2018-en-la-cabana-de-arreola/ (Gracias a @[100000848899034:2048:Lila Nieta De Epifanio Zuñiga Chavez], disculpas que me tardé cuatro meses en responder, estaba según yo intentando colaborar en el rescate de la humanidad con mi "Anticovidiana": https://zenodo.org/record/3988139); video, lectura a cargo de @[1586841892:2048:Say Renrod], filmado por @[100000186697386:2048:Adriana Cecilia Vargas Alzaga]
Updated Sep 3, 2020, 10:19 AM
It just takes "A Leap of Faith"!!! The Spider VERSE!!! Inspired while looking at NY!!!: |
It just takes "A Leap of Faith"!!! The Spider VERSE!!! Inspired while looking at NY!!!:
The words that did not make it in the re-posting are as follows: Robin L. Armstrong "was invited to come and testify in an Arkansas Senate Committee discussing COVID-19 and treatment options.
America will remain free, only when there is an open discussion about how we solve the pressing problems of our day."
Armstrong "will be discussing our use of Hydroxychloroquine in a nursing facility, and how lives were saved."
If you want to watch, click on this link below:"
America will remain free, only when there is an open discussion about how we solve the pressing problems of our day."
Armstrong "will be discussing our use of Hydroxychloroquine in a nursing facility, and how lives were saved."
If you want to watch, click on this link below:"
Updated Sep 1, 2020, 4:29 PM
Here, putting on the open as PDFs the files that have been given by whistleblowers or consistently removed by the criminals-that-be, the same criminals that are as usual playing with fake numbers and doctored statistics: https://www.facebook.com/BenSwannRealityCheck/posts/3463278647070394, the saved files are at: https://fdocc2.wordpress.com/2020/09/01/in-pdf-raw-cdc-files-005-by-william-thompson-whistleblower-to-brian-s-hooker-and-15-of-bsh-articles-about-the-link-of-vaccines-and-autism-deliberately-erased-by-cdc/, https://fdocc2.wordpress.com/2020/08/31/here-in-pdf-the-full-set-of-zach-vorhies-released-from-google-dont-be-evil-files-a-whistleblower-denouncing-the-current-criminal-removal-of-truths/, https://fdocc2.wordpress.com/2020/08/24/the-poisoned-needle-by-eleanor-mcbean-1957-is-a-classic-that-you-need-to-know-to-be-medically-informed/
Updated Sep 1, 2020, 4:02 PM
Updated Aug 31, 2020, 8:56 AM
Updated Aug 31, 2020, 8:56 AM
Fernando Castro-Chavez posted in FerKat.
Vorhies: https://fdocc2.wordpress.com/2020/08/31/here-in-pdf-the-full-set-of-zach-vorhies-released-from-google-dont-be-evil-files-a-whistleblower-denouncing-the-current-criminal-removal-of-truths, a bold whistleblower from Google (to take back the power from those bastards, he recommends to dismiss all their services, this is war people, such as: Not Chrome anymore, but rather the Brave browser, Not the Google "engine" but DuckDuckGo (or any other search engine); Not gMail but ProtonMail; Not YouTube but Any Other Independent Video Platform (as I am using Lbry and Minds, and they also recommend me "Float"), Not Android
But iPhone or BlackBerry, so, I will hearken at him!!! If you wish to take back the power that Google stole from you... I invite you to do the same), here is his webpage: https://www.zachvorhies.com/, here are some of the internal documents (another link with all the documents in my last post of this subject below): https://pv-uploads1.s3.amazonaws.com/uploads/2019/06/SS1DocDump.pdf (the very corrupt owner of YouTube, the one deleting Mikovits, 9/11, The Highwire, Dan Dicks, Infowars and many other persons and videos, Zach says that even before May 2019, multitudes of YouTube Channels of mothers questioning vaccines due to the damages of their children were deleted, as if "they" already "knew" that COVID-19 was coming later!!!) that explains how they are biasing their algorithms to censor the truth: https://www.facebook.com/HighWireTalk/videos/google-whistleblower-tells-all/2539648299653942/, and (slower as its traffic saturates) https://thehighwire.com/videos/google-whistleblower-tells-all/
But iPhone or BlackBerry, so, I will hearken at him!!! If you wish to take back the power that Google stole from you... I invite you to do the same), here is his webpage: https://www.zachvorhies.com/, here are some of the internal documents (another link with all the documents in my last post of this subject below): https://pv-uploads1.s3.amazonaws.com/uploads/2019/06/SS1DocDump.pdf (the very corrupt owner of YouTube, the one deleting Mikovits, 9/11, The Highwire, Dan Dicks, Infowars and many other persons and videos, Zach says that even before May 2019, multitudes of YouTube Channels of mothers questioning vaccines due to the damages of their children were deleted, as if "they" already "knew" that COVID-19 was coming later!!!) that explains how they are biasing their algorithms to censor the truth: https://www.facebook.com/HighWireTalk/videos/google-whistleblower-tells-all/2539648299653942/, and (slower as its traffic saturates) https://thehighwire.com/videos/google-whistleblower-tells-all/
Updated Aug 30, 2020, 6:28 PM
Updated Aug 30, 2020, 11:37 AM
The bold speech of Robert F. Kennedy Jr. at Berlin yesterday: https://www.youtube.com/watch?v=1DfW8k6BRXA, https://www.youtube.com/watch?v=mu90-9MKGk0, https://childrenshealthdefense.org/news/robert-f-kennedy-jr-speaks-at-berlin-rally-for-freedom-and-peace/, https://www.youtube.com/watch?v=0ubiHyuezyo, https://www.youtube.com/watch?v=FjlK_Ef094o, https://www.facebook.com/rfkjr/posts/2725699684423430, etc...
Updated Aug 30, 2020, 11:32 AM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Fernando Castro-Chavez added a new photo.
Aug 30, 2015, 9:31 PM
This coming Saturday at Seven we are going to remember the amazing and all-wise Father we have! One that organized the Heavens and His old Laws in a way as to announce the precise hour of the birth of His precious son, our Lord and Savior Jesus Christ!
The Wonders of The Message of Salvation of God written in the stars:
Updated Aug 30, 2020, 10:24 AM
My last posting at the RG: "One of the references for my article: Karl Sirotkin (former NIH Data expert):
Article https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7435492/,
with Dan Sirotkin, father and son, in an out-of-the-ordinary and thorough article (where they basically update their amazing blog posts), fully ignored, as well as most of the methodologies described there by the deceivers-that-be, called "Might SARS‐CoV‐2 Have Arisen via Serial Passage through an Animal Host or Cell Culture? A potential explanation for much of the novel coronavirus’ distinctive genome", published on the 12 of Aug., 2020, provide the details of how even cell passage, and not only a zoonotic event is sufficient for a deliberate design and release of Sars-CoV-2, excerpts of this informative article are (but before I want to say that here we have in Acknowledgements another whistleblower that works directly at the NIAID of Fauci (https://archive.vn/8JhJE), being that pesky Fauci one of the prime suspects on deliberately orchestrating this whole Plandemic in company of Gates, the CCP, WEF. J. Hopkins, CDC, and the WHO amongst several others):
"Without knowing the true nature of a disease, it is impossible for clinicians to appropriately shape their care, for policy‐makers to correctly gauge the nature and extent of the threat, and for the public to appropriately modify their behavior."
"...the dual‐use gain‐of‐function research practice of viral serial passage should be considered a viable route by which the novel coronavirus arose"
"...molecular clues raise further questions, all of which warrant full investigation into the novel coronavirus's origins and a re‐examination of the risks and rewards of dual‐use gain‐of‐function research."
"SARS‐CoV‐2 ...has been reported that “the virus acts like no microbe humanity has ever seen.”"
http://scholar.google.com/scholar?hl=en&q=M.+Wadman%2C+J.+Couzin‐Frankel%2C+J.+Kaiser%2C+C.+Matacic%2C+Science+2020.
"The long‐standing practice of serial passage is a form of gain‐of‐function research that forces zoonosis between species, and requires the same molecular adaptations necessary for a natural zoonotic jump to occur within a laboratory, leaving the same genetic signatures behind as a natural jump but occurring in a much shorter period of time."
"...every highly pathogenic avian influenza virus, defined by having a furin cleavage site, has either been found on commercial poultry farms that create the pseudo‐natural conditions necessary for serial passage, or created in laboratories with gain‐of‐function serial passage experiments...they only emerge under artificial conditions in influenza viruses..."
"...SARS‐CoV‐2 is the only lineage B coronavirus found with one, and the only other coronaviruses known to have them are only at most 60% identical to this novel coronavirus."
"...It is possible that this novel coronavirus gained its furin cleavage site through recombination in an intermediate host species, however there are also two laboratory processes that may have imbued SARS‐CoV‐2 with its furin cleavage site..."
"...serial passage through a live animal host simply forces the same molecular processes that occur in nature to happen during a zoonotic jump, and in vitro passage through cell culture mimics many elements of this process—and neither necessarily leaves any distinguishing genetic traces..."
"The dual‐use gain‐of‐function research tool of serial passage was first applied to a strain of H1N1 Swine Flu, a variant of the pandemic influenza virus that was genetically modified before it either leaked out of a Soviet lab or was introduced as part of an attenuated vaccine trial in 1977."
"Then in 1979, just 2 years after the introduction of this modified H1N1 Swine Flu, a different Soviet lab leaked weaponized anthrax... Soviet authorities convincingly blamed the deaths on contaminated local meat...was not revealed to be a fabrication until 1992, when an analysis of dispersion patterns revealed that the victims were not those working with the supposedly contaminated meat, but instead all lived downwind from the Sverdlovsk weapons lab..."
"The Soviet strain of serially passaged H1N1 Swine Flu was likely being developed as part of a vaccine program, one of the humane goals of gain‐of‐function research that exist alongside riskier and more troublesome ones like developing bioweapons... ignited the debate between the risks and rewards of dual‐use gain‐of‐function research—causing it to became the poster virus for the dangers this protocol posed."
"...two separate teams used genetic manipulation followed by serial passage between ferrets to create mammal‐transmissible H5N1 Bird Flu strains of influenza virus in 2011 (which contributed to the NIH imposing a moratorium on dual‐use gain‐of‐function research from 2014 until 2017) that had the gain‐of‐function of being transmissible by aerosol. The first team was led by Dr. Ron Fouchier and conducted at the Erasmus Medical Center in the Netherlands..."
"...Yoshihiro Kawaoka of the Universities of Tokyo and Wisconsin used genetic engineering to combine genes from the H1N1 Swine Flu as well as the H5N1 Bird Flu", producing artificially: "a chimeric virus that was then serially passed through ferrets, creating another airborne virus with potentially pandemic properties"!!!
Both, Fouchier and Kawaoka produced "...a modified genome that appeared to be the result of natural, albeit accelerated, selection..." (This of course was deliberately ignored by the reefer authors of "The Proximal origin..."), and "were viewed by many as being sufficiently dangerous that they should not be published... however they were both eventually released with certain methodological and sequence details left out"
"In the years that followed, gain‐of‐function serial passage through ferrets was used to increase the virulence of the H7N1 Bird Flu as well as allowing for its aerosol transmission without first introducing any mutations."
"...the H1N1 Bird Flu was also found to become airborne and increase in virulence after in vivo passage through swine..."
"...highly pathogenic influenza viruses all contain furin cleavage sites... which only emerge after serial passage in laboratories or pseudo‐naturally on commercial animal farms"!!!
"The process of sequential passage through animal hosts or cell cultures leaves a genome that appears natural and not purposefully manipulated since it effectively mimics the natural process of zoonosis..."
"...the artificial generations added by forced serial passage creates the artificial appearance of evolutionary distance, which was the characteristic of the H1N1 Swine Flu Soviet leak in the 1970s... exactly what is found with SARS‐CoV‐2, which is distant enough from any other virus that it has been placed in its own clade"!!!
"...other viruses have been observed to acquire furin cleavage sites by passage under experimental laboratory conditions, then such a mechanism is theoretically possible for SARS‐CoV‐2 as well":
1) "...either nucleotide insertions or substitutions... able to be rescued and then eventually selected for, due to the high multiplicity of infection found in serial passage protocols."
2) "...the recombination of multiple viral RNAs inside a host cell..."
"...a molecular pathway for their emergence (of a furin site, also called polybasic) must exist..."
"...the infectious bronchitis coronavirus (IBV) is serially passed through chickens it developed notable mutations along its spike‐protein genes..."
"...when a lineage A (of a) bovine coronavirus was subject to in vitro serial passage through cell lines, a 12‐nucleotide insert found within only a small minority of the pooled viruses spike‐protein region was strongly selected for and quickly emerged as the dominate strain..."!!!
"...just like influenza viruses are only able to preserve their furin cleavages in artificial environments since the heightened virulence they impart kills their hosts... lineage B coronaviruses do not appear to be able to support furin cleavages in nature"!!!
"...(also the furin site) could have been spliced directly into the novel coronavirus's backbone in a laboratory using classic recombinant DNA technology that has been available for nearly 20 years..."
"...the removal of the restriction site junctions (is achieved by)... using the aptly named “No See'm technology.” (Yount, ...Baric, J. Virol. 2002, 76, 11065)... urin cleavages already have been successfully spliced into other coronaviruses, including the IBV ...and even into SARS‐CoV, where it increased cell‐to‐cell fusion in in vitro experiments... to impart it with increased lethality..."
"...Vero cells often used in serial passage are derived from kidney epithelial cells extracted from African green monkeys, which have ACE2 receptors very similar to those found in humans..."
"A coronavirus that targets the ACE2 receptor like SARS‐CoV‐2 was first isolated from a wild bat in 2013 by a team out of Wuhan. This research was funded in part by EcoHealth Alliance... and set the stage for the manipulation of bat‐borne coronavirus genomes that target this receptor and can become airborne... one research expedition captured as many as 400 wild viruses... (Aizenman, NPR 2020)...a private repository that has since grown to over 1500 strains of virus... meaning that the Wuhan Center for Disease Control and Prevention has a massive catalogue of largely undisclosed viruses..."!!!
"...in subsequent years, EcoHealth Alliance received funding for project proposals outlining gain‐of‐function research to be done in Wuhan... (all) needed to engineer this novel coronavirus in a laboratory..."
"...(and just as taking the full guilt,) the Wuhan Institute of Virology has refused to release the lab notebooks of its researchers... despite the fact that these notebooks would likely be enough to exonerate the lab from having any role..." producing COVID-19.
"...(all of this is also possible) isolating a progenitor coronavirus from civets and then serially passing it through mammalian ACE2 receptor‐expressing cells—serial passage through host cell lines..." (And none of these methods have been addressed by the same reefers denying the lab origin, while at the same time are the ones with the highest conflict of interests: Daszak, Zheng-Li, Fauci...)
Next we find an interesting phrase integrated by the two first words: "2.3 Ferreting Out the Signs of Serial Passage: / ...studies examining SARS‐CoV‐2's infectivity in ferrets found that it spreads readily among them, and also appears airborne in that animal model... (in) the Netherlands... the novel coronavirus had spread among thirteen different mink (varieties of ferrets, with a fertile interbreeding) farms there, and also to at least one farm in Denmark[39] and to another in Spain where 87% of the mink were infected"!!! (Just as if Sars-CoV-2 were seeking for its "originators"), so: "...the virus spread to fifteen different farms in three countries, but also appears to have spread from minks into farm workers... (so) the fact that SARS‐CoV‐2 (with a from bat viral backbone) spreads from humans to minks and then back to humans demonstrates a high affinity for both species..."!!! Furthermore, similarly demonstrating this: "...an April 2020 preprint: https://archive.vn/i1RDN, quoted in: https://archive.vn/d5PZC, which appears to have been retracted after Chinese authorities implemented the censorship of any papers relating to the origins of the novel coronavirus: "!!!!!!! "This paper found that coronaviruses that target the ACE2 receptor bind with ferret cells more tightly than any other species except the treeshrew (cheaper, smaller, and easier to handle), which only scored about 2% higher... also... used for serial viral passage..."
"...SARS‐CoV‐2 was perfectly adapted to infect humans since its first contact with us, and had no apparent need to for any adaptive evolution at all"!!!: https://archive.vn/xObt8
"...SARS‐CoV‐2 appeared just as adapted to humans at the very start of its epidemic as SARS‐CoV was in the latest stages of its emergence... (both) unexpected finding(s) since viruses are expected to mutate substantially as they acclimate to a new species": http://www.biorxiv.org/content/10.1101/2020.05.01.073262v1.full
"...there is very little serological evidence of any exposure to these coronaviruses even in Chinese villagers living in close proximity to bat caves, and at the epicenter of the current outbreak—no previous exposure was found at all... natural jumps leave wide serological footprints in their new host populations as early variants of a prospective virus make limited and unsuccessful jumps into individuals of the new host species..."!!! this in itself is enough for a reasonable researcher that has not vested interests to realize that COVID-19 is a totally artificial Pandemic.
"However these results do not rule out a much earlier jump into humans somewhere outside Hubei province, an alternative that is awaiting empirical support." And this is where things get really weird as Latham and Wilson have shown, that a deliberate inoculation into humans may have been on their way since 2012-13 out of those fateful six miners!!! So in this case the zoonotic event that I postulated in my article could have happened in HUMANS and not in animals!!!
"...the examination of all past gain‐of‐function serial passage research by the scientific community at large should occur to determine what other definitive genomic signatures serial passage leaves besides the creation of furin cleavage sites, in case more of those (signatures, such as the 22 INSERTIONS of segments of the HIV (the coronavirus was pinpointed back in 2006 as a viable vector for an HIV vaccine and research into a pan‐coronavirus vaccine has been ongoing for decades), as per my, and Perez and Montagnier's research) can be found in this novel coronavirus...: ...SARS‐CoV‐2 possesses a genomic region not found in other coronaviruses that appears to cloak the novel coronavirus from white blood cells, a characteristic also found with HIV": http://www.biorxiv.org/content/10.1101/2020.05.24.111823v1, an interesting article already reviewed here (see above).
"...the second preprint identifies a region on the spike‐protein gene found in no other bat‐borne coronavirus that is nearly identical to superantigenic and neurotoxic motifs found in some bacteria, which may contribute to the immune overreaction that leads to the Kawasaki‐like multisystem inflammatory syndrome in children, and cytokine storms in adults"!!!: https://www.biorxiv.org/content/10.1101/2020.05.21.109272v1.full.pdf: "An insertion unique to SARS-CoV-2 exhibits superantigenic character strengthened by recent mutations"!!!, and their supplementary material: https://www.biorxiv.org/content/biorxiv/early/2020/05/21/2020.05.21.109272/DC1/embed/media-1.pdf (which is the also great part here illustrated).
"(So, Engineered and Zoonotic (that can also be originated from a Lab)): Both avenues should be robustly investigated by the scientific community"!!!
"It seems ill‐advised to rule out the possibility that gain‐of‐function techniques such as serial passage may have played a role in the creation of SARS‐CoV‐2..."
"...(like it was said in the pre-planned 9/11 for the bewildered military then, now in the pre-planned COVID-19 it is concluded that:) the emergence of this novel coronavirus has demonstrated that the international public health community is not prepared to handle the leak of a pandemic virus."
"...none of the gain‐of‐function research conducted since 2014 has provided humanity with any tools at all to fight back against the ongoing pandemic caused by this novel coronavirus"!!!!!!!!!!
Their blogs that were the source of the current and excellent article are (mainly the first one. which I proudly quote in my own article are):
Sirotkin, K. & Sirotkin D.: https://harvardtothebighouse.com/2020/01/31/logistical-and-technical-analysis-of-the-origins-of-the-wuhan-coronavirus-2019-ncov/, https://harvardtothebighouse.com/2020/03/23/no-monkey-ever-reheated-a-frozen-burrito-what-the-expanse-tells-us-about-the-covid-19-pandemic/, https://harvardtothebighouse.com/2020/03/19/china-owns-nature-magazines-ass-debunking-the-proximal-origin-of-sars-cov-2-claiming-covid-19-wasnt-from-a-lab/, 2020a, b and c (Web).
And remembering that ANY alternative to the perverted vaccine that Gates, Fauci, Schwab and all of those crooked minds are attempting to implant in us, is very welcome, such as this recent one:" https://chemrxiv.org/articles/preprint/Natures_Therapy_for_COVID-19_Targeting_the_Vital_Non-Structural_Proteins_NSP_from_SARS-CoV-2_with_Phytochemicals_from_Indian_Medicinal_Plants/12661214/2, from my: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031
Article https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7435492/,
with Dan Sirotkin, father and son, in an out-of-the-ordinary and thorough article (where they basically update their amazing blog posts), fully ignored, as well as most of the methodologies described there by the deceivers-that-be, called "Might SARS‐CoV‐2 Have Arisen via Serial Passage through an Animal Host or Cell Culture? A potential explanation for much of the novel coronavirus’ distinctive genome", published on the 12 of Aug., 2020, provide the details of how even cell passage, and not only a zoonotic event is sufficient for a deliberate design and release of Sars-CoV-2, excerpts of this informative article are (but before I want to say that here we have in Acknowledgements another whistleblower that works directly at the NIAID of Fauci (https://archive.vn/8JhJE), being that pesky Fauci one of the prime suspects on deliberately orchestrating this whole Plandemic in company of Gates, the CCP, WEF. J. Hopkins, CDC, and the WHO amongst several others):
"Without knowing the true nature of a disease, it is impossible for clinicians to appropriately shape their care, for policy‐makers to correctly gauge the nature and extent of the threat, and for the public to appropriately modify their behavior."
"...the dual‐use gain‐of‐function research practice of viral serial passage should be considered a viable route by which the novel coronavirus arose"
"...molecular clues raise further questions, all of which warrant full investigation into the novel coronavirus's origins and a re‐examination of the risks and rewards of dual‐use gain‐of‐function research."
"SARS‐CoV‐2 ...has been reported that “the virus acts like no microbe humanity has ever seen.”"
http://scholar.google.com/scholar?hl=en&q=M.+Wadman%2C+J.+Couzin‐Frankel%2C+J.+Kaiser%2C+C.+Matacic%2C+Science+2020.
"The long‐standing practice of serial passage is a form of gain‐of‐function research that forces zoonosis between species, and requires the same molecular adaptations necessary for a natural zoonotic jump to occur within a laboratory, leaving the same genetic signatures behind as a natural jump but occurring in a much shorter period of time."
"...every highly pathogenic avian influenza virus, defined by having a furin cleavage site, has either been found on commercial poultry farms that create the pseudo‐natural conditions necessary for serial passage, or created in laboratories with gain‐of‐function serial passage experiments...they only emerge under artificial conditions in influenza viruses..."
"...SARS‐CoV‐2 is the only lineage B coronavirus found with one, and the only other coronaviruses known to have them are only at most 60% identical to this novel coronavirus."
"...It is possible that this novel coronavirus gained its furin cleavage site through recombination in an intermediate host species, however there are also two laboratory processes that may have imbued SARS‐CoV‐2 with its furin cleavage site..."
"...serial passage through a live animal host simply forces the same molecular processes that occur in nature to happen during a zoonotic jump, and in vitro passage through cell culture mimics many elements of this process—and neither necessarily leaves any distinguishing genetic traces..."
"The dual‐use gain‐of‐function research tool of serial passage was first applied to a strain of H1N1 Swine Flu, a variant of the pandemic influenza virus that was genetically modified before it either leaked out of a Soviet lab or was introduced as part of an attenuated vaccine trial in 1977."
"Then in 1979, just 2 years after the introduction of this modified H1N1 Swine Flu, a different Soviet lab leaked weaponized anthrax... Soviet authorities convincingly blamed the deaths on contaminated local meat...was not revealed to be a fabrication until 1992, when an analysis of dispersion patterns revealed that the victims were not those working with the supposedly contaminated meat, but instead all lived downwind from the Sverdlovsk weapons lab..."
"The Soviet strain of serially passaged H1N1 Swine Flu was likely being developed as part of a vaccine program, one of the humane goals of gain‐of‐function research that exist alongside riskier and more troublesome ones like developing bioweapons... ignited the debate between the risks and rewards of dual‐use gain‐of‐function research—causing it to became the poster virus for the dangers this protocol posed."
"...two separate teams used genetic manipulation followed by serial passage between ferrets to create mammal‐transmissible H5N1 Bird Flu strains of influenza virus in 2011 (which contributed to the NIH imposing a moratorium on dual‐use gain‐of‐function research from 2014 until 2017) that had the gain‐of‐function of being transmissible by aerosol. The first team was led by Dr. Ron Fouchier and conducted at the Erasmus Medical Center in the Netherlands..."
"...Yoshihiro Kawaoka of the Universities of Tokyo and Wisconsin used genetic engineering to combine genes from the H1N1 Swine Flu as well as the H5N1 Bird Flu", producing artificially: "a chimeric virus that was then serially passed through ferrets, creating another airborne virus with potentially pandemic properties"!!!
Both, Fouchier and Kawaoka produced "...a modified genome that appeared to be the result of natural, albeit accelerated, selection..." (This of course was deliberately ignored by the reefer authors of "The Proximal origin..."), and "were viewed by many as being sufficiently dangerous that they should not be published... however they were both eventually released with certain methodological and sequence details left out"
"In the years that followed, gain‐of‐function serial passage through ferrets was used to increase the virulence of the H7N1 Bird Flu as well as allowing for its aerosol transmission without first introducing any mutations."
"...the H1N1 Bird Flu was also found to become airborne and increase in virulence after in vivo passage through swine..."
"...highly pathogenic influenza viruses all contain furin cleavage sites... which only emerge after serial passage in laboratories or pseudo‐naturally on commercial animal farms"!!!
"The process of sequential passage through animal hosts or cell cultures leaves a genome that appears natural and not purposefully manipulated since it effectively mimics the natural process of zoonosis..."
"...the artificial generations added by forced serial passage creates the artificial appearance of evolutionary distance, which was the characteristic of the H1N1 Swine Flu Soviet leak in the 1970s... exactly what is found with SARS‐CoV‐2, which is distant enough from any other virus that it has been placed in its own clade"!!!
"...other viruses have been observed to acquire furin cleavage sites by passage under experimental laboratory conditions, then such a mechanism is theoretically possible for SARS‐CoV‐2 as well":
1) "...either nucleotide insertions or substitutions... able to be rescued and then eventually selected for, due to the high multiplicity of infection found in serial passage protocols."
2) "...the recombination of multiple viral RNAs inside a host cell..."
"...a molecular pathway for their emergence (of a furin site, also called polybasic) must exist..."
"...the infectious bronchitis coronavirus (IBV) is serially passed through chickens it developed notable mutations along its spike‐protein genes..."
"...when a lineage A (of a) bovine coronavirus was subject to in vitro serial passage through cell lines, a 12‐nucleotide insert found within only a small minority of the pooled viruses spike‐protein region was strongly selected for and quickly emerged as the dominate strain..."!!!
"...just like influenza viruses are only able to preserve their furin cleavages in artificial environments since the heightened virulence they impart kills their hosts... lineage B coronaviruses do not appear to be able to support furin cleavages in nature"!!!
"...(also the furin site) could have been spliced directly into the novel coronavirus's backbone in a laboratory using classic recombinant DNA technology that has been available for nearly 20 years..."
"...the removal of the restriction site junctions (is achieved by)... using the aptly named “No See'm technology.” (Yount, ...Baric, J. Virol. 2002, 76, 11065)... urin cleavages already have been successfully spliced into other coronaviruses, including the IBV ...and even into SARS‐CoV, where it increased cell‐to‐cell fusion in in vitro experiments... to impart it with increased lethality..."
"...Vero cells often used in serial passage are derived from kidney epithelial cells extracted from African green monkeys, which have ACE2 receptors very similar to those found in humans..."
"A coronavirus that targets the ACE2 receptor like SARS‐CoV‐2 was first isolated from a wild bat in 2013 by a team out of Wuhan. This research was funded in part by EcoHealth Alliance... and set the stage for the manipulation of bat‐borne coronavirus genomes that target this receptor and can become airborne... one research expedition captured as many as 400 wild viruses... (Aizenman, NPR 2020)...a private repository that has since grown to over 1500 strains of virus... meaning that the Wuhan Center for Disease Control and Prevention has a massive catalogue of largely undisclosed viruses..."!!!
"...in subsequent years, EcoHealth Alliance received funding for project proposals outlining gain‐of‐function research to be done in Wuhan... (all) needed to engineer this novel coronavirus in a laboratory..."
"...(and just as taking the full guilt,) the Wuhan Institute of Virology has refused to release the lab notebooks of its researchers... despite the fact that these notebooks would likely be enough to exonerate the lab from having any role..." producing COVID-19.
"...(all of this is also possible) isolating a progenitor coronavirus from civets and then serially passing it through mammalian ACE2 receptor‐expressing cells—serial passage through host cell lines..." (And none of these methods have been addressed by the same reefers denying the lab origin, while at the same time are the ones with the highest conflict of interests: Daszak, Zheng-Li, Fauci...)
Next we find an interesting phrase integrated by the two first words: "2.3 Ferreting Out the Signs of Serial Passage: / ...studies examining SARS‐CoV‐2's infectivity in ferrets found that it spreads readily among them, and also appears airborne in that animal model... (in) the Netherlands... the novel coronavirus had spread among thirteen different mink (varieties of ferrets, with a fertile interbreeding) farms there, and also to at least one farm in Denmark[39] and to another in Spain where 87% of the mink were infected"!!! (Just as if Sars-CoV-2 were seeking for its "originators"), so: "...the virus spread to fifteen different farms in three countries, but also appears to have spread from minks into farm workers... (so) the fact that SARS‐CoV‐2 (with a from bat viral backbone) spreads from humans to minks and then back to humans demonstrates a high affinity for both species..."!!! Furthermore, similarly demonstrating this: "...an April 2020 preprint: https://archive.vn/i1RDN, quoted in: https://archive.vn/d5PZC, which appears to have been retracted after Chinese authorities implemented the censorship of any papers relating to the origins of the novel coronavirus: "!!!!!!! "This paper found that coronaviruses that target the ACE2 receptor bind with ferret cells more tightly than any other species except the treeshrew (cheaper, smaller, and easier to handle), which only scored about 2% higher... also... used for serial viral passage..."
"...SARS‐CoV‐2 was perfectly adapted to infect humans since its first contact with us, and had no apparent need to for any adaptive evolution at all"!!!: https://archive.vn/xObt8
"...SARS‐CoV‐2 appeared just as adapted to humans at the very start of its epidemic as SARS‐CoV was in the latest stages of its emergence... (both) unexpected finding(s) since viruses are expected to mutate substantially as they acclimate to a new species": http://www.biorxiv.org/content/10.1101/2020.05.01.073262v1.full
"...there is very little serological evidence of any exposure to these coronaviruses even in Chinese villagers living in close proximity to bat caves, and at the epicenter of the current outbreak—no previous exposure was found at all... natural jumps leave wide serological footprints in their new host populations as early variants of a prospective virus make limited and unsuccessful jumps into individuals of the new host species..."!!! this in itself is enough for a reasonable researcher that has not vested interests to realize that COVID-19 is a totally artificial Pandemic.
"However these results do not rule out a much earlier jump into humans somewhere outside Hubei province, an alternative that is awaiting empirical support." And this is where things get really weird as Latham and Wilson have shown, that a deliberate inoculation into humans may have been on their way since 2012-13 out of those fateful six miners!!! So in this case the zoonotic event that I postulated in my article could have happened in HUMANS and not in animals!!!
"...the examination of all past gain‐of‐function serial passage research by the scientific community at large should occur to determine what other definitive genomic signatures serial passage leaves besides the creation of furin cleavage sites, in case more of those (signatures, such as the 22 INSERTIONS of segments of the HIV (the coronavirus was pinpointed back in 2006 as a viable vector for an HIV vaccine and research into a pan‐coronavirus vaccine has been ongoing for decades), as per my, and Perez and Montagnier's research) can be found in this novel coronavirus...: ...SARS‐CoV‐2 possesses a genomic region not found in other coronaviruses that appears to cloak the novel coronavirus from white blood cells, a characteristic also found with HIV": http://www.biorxiv.org/content/10.1101/2020.05.24.111823v1, an interesting article already reviewed here (see above).
"...the second preprint identifies a region on the spike‐protein gene found in no other bat‐borne coronavirus that is nearly identical to superantigenic and neurotoxic motifs found in some bacteria, which may contribute to the immune overreaction that leads to the Kawasaki‐like multisystem inflammatory syndrome in children, and cytokine storms in adults"!!!: https://www.biorxiv.org/content/10.1101/2020.05.21.109272v1.full.pdf: "An insertion unique to SARS-CoV-2 exhibits superantigenic character strengthened by recent mutations"!!!, and their supplementary material: https://www.biorxiv.org/content/biorxiv/early/2020/05/21/2020.05.21.109272/DC1/embed/media-1.pdf (which is the also great part here illustrated).
"(So, Engineered and Zoonotic (that can also be originated from a Lab)): Both avenues should be robustly investigated by the scientific community"!!!
"It seems ill‐advised to rule out the possibility that gain‐of‐function techniques such as serial passage may have played a role in the creation of SARS‐CoV‐2..."
"...(like it was said in the pre-planned 9/11 for the bewildered military then, now in the pre-planned COVID-19 it is concluded that:) the emergence of this novel coronavirus has demonstrated that the international public health community is not prepared to handle the leak of a pandemic virus."
"...none of the gain‐of‐function research conducted since 2014 has provided humanity with any tools at all to fight back against the ongoing pandemic caused by this novel coronavirus"!!!!!!!!!!
Their blogs that were the source of the current and excellent article are (mainly the first one. which I proudly quote in my own article are):
Sirotkin, K. & Sirotkin D.: https://harvardtothebighouse.com/2020/01/31/logistical-and-technical-analysis-of-the-origins-of-the-wuhan-coronavirus-2019-ncov/, https://harvardtothebighouse.com/2020/03/23/no-monkey-ever-reheated-a-frozen-burrito-what-the-expanse-tells-us-about-the-covid-19-pandemic/, https://harvardtothebighouse.com/2020/03/19/china-owns-nature-magazines-ass-debunking-the-proximal-origin-of-sars-cov-2-claiming-covid-19-wasnt-from-a-lab/, 2020a, b and c (Web).
And remembering that ANY alternative to the perverted vaccine that Gates, Fauci, Schwab and all of those crooked minds are attempting to implant in us, is very welcome, such as this recent one:" https://chemrxiv.org/articles/preprint/Natures_Therapy_for_COVID-19_Targeting_the_Vital_Non-Structural_Proteins_NSP_from_SARS-CoV-2_with_Phytochemicals_from_Indian_Medicinal_Plants/12661214/2, from my: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031
In these movie clips from 2004 (4 x 1), the globalists reflected their plans for the ID2020 (4 x 5), you can see microchips inserted in three parts of the body: back, head, etc...; the grand irony is that those S.O.B. are using right now the brain-wash even before even implanting or RFIDing humanity a.la Five-Gee (which sooner or later seems to be coming over the humanity for the evil peoples of this word to have an even most personalized and targeted control over every individual human at their disposal, more than the control that they have already taken by themselves without any of them involved having been elected by any of us!!!, they just snatched the power over us by themselves, but they are NOT going to get away with it at this time, at least not while Christians with guts and open ears to God are still over this earth), by the invasive use of the controlled Social Media and their extremely annoying WHO liar messages that I have never opened that keep on popping up in every platform, and of course the Mass Media complicit with the ones that planned, designed and released deliberately the current calamity for humanity: That Plandemic of COVID-19: The second movie (2012, 4 x 3 in function of its two extremes) deals with a gigantic set of files denouncing the high corruption of the CIA, if the NIAID is very corrupt, way far more the CIA, so the main "criminal" was indeed the good guy that had the information, the database hidden in a chip that he injected in his leg, but that was in that movie something that had not an effect "per se" over him or over his brain. |
In these movie clips from 2004 (4 x 1), the globalists reflected their plans for the ID2020 (4 x 5), you can see microchips inserted in three parts of the body: back, head, etc...; the grand irony is that those S.O.B. are using right now the brain-wash even before even implanting or RFIDing humanity a.la Five-Gee (which sooner or later seems to be coming over the humanity for the evil peoples of this word to have an even most personalized and targeted control over every individual human at their disposal, more than the control that they have already taken by themselves without any of them involved having been elected by any of us!!!, they just snatched the power over us by themselves, but they are NOT going to get away with it at this time, at least not while Christians with guts and open ears to God are still over this earth), by the invasive use of the controlled Social Media and their extremely annoying WHO liar messages that I have never opened that keep on popping up in every platform, and of course the Mass Media complicit with the ones that planned, designed and released deliberately the current calamity for humanity: That Plandemic of COVID-19: The second movie (2012, 4 x 3 in function of its two extremes) deals with a gigantic set of files denouncing the high corruption of the CIA, if the NIAID is very corrupt, way far more the CIA, so the main "criminal" was indeed the good guy that had the information, the database hidden in a chip that he injected in his leg, but that was in that movie something that had not an effect "per se" over him or over his brain.
CDC changes policies saying that in reality "Masks" should only be used by medical personnel and when a sick person is around, so that right there, once more corroborates that to make them mandatory is just a useless poitical agenda to condition the brains to submission https://thehighwire.com/videos/fauci-silent-as-cdc-makes-sweeping-changes-to-covid-policy/, which is also what the WHO said after once more time changing its stupid policies of mind control as the perverted globalist advise went berserk all over the world in order to submit, to "stupidify" humans: https://www.businessinsider.com/who-no-need-for-healthy-people-to-wear-face-masks-2020-4?r=MX&IR=T
Updated Aug 29, 2020, 11:05 AM
Updated Aug 29, 2020, 9:43 AM
Updated Aug 29, 2020, 9:42 AM
This is why I see Trump as the one that can straighten the boat of the USA, and with it of the whole world, taking it away of the hands of the globalists that are trying to take over the control of the whole world. He has defended, not only my freedom of free expression, even when some key components of my work on the artificial origins of the COVID-19 have been removed from this platform of the Facebook, and from the YouTube amongst other sites (ResearchGate, Twitter, etc.), but also my freedom to pray every beginning of my classes!!! And that for me is worth the Universe!!!
Updated Aug 28, 2020, 2:06 PM
Updated Aug 27, 2020, 8:59 PM
Another song, whose title I was seeking for years, as it was the case for "Kalimba" by D'oa and "7 Minutes" by Youssou N'Dour, is this one: "Wanted" by Doogy Degli Armonium!!! Go, figure that one (or all of those!) out!!!: http://youtube.com/watch?v=074CX4sPppg, found with the help of: https://www.watzatsong.com/en/found/Doogy+Degli+Armonium-Wanted-667257.html?has-confirmed=1, I hope you like it as I did in my early childhood when it was played by the "Stereo Soul" of my City!!!
Updated Aug 27, 2020, 8:08 PM
While the crazy globalist non-doctors Gates with doctor of schemes Fauci, and their friends keep on terrorizing humanity with the multiple Pandemics panic, & also promoting their "Population Control" in more than one sense, Trump is defying their prospects, and sticking to support the life of the minors, and of course, of the unborn, and of the American citizens, and with them to all of the good peoples of the word!!! (The problem is that he is not a doctor either, and even when he has "outsmarted" them in many aspects, he may fall in their trap of a mandatory but totally unnecessary "vaccine", as he fell in their trap of finding endless "masks" and "ventilators"..., so Open His Eyes God, it will be very upsetting to me to realize that he has fallen under their "vaccination" game, pray in the spirit for our good governing system, as Paul himself required us to do, so that we may continue having the freedom to proclaim God and everything that He inspires us, even if many are still willingly asleep..., I pray for Trump and Pence, for us to continue having a quiet and peaceful life to proclaim the Greatness of God no matter what!!): |
While the crazy globalist non-doctors Gates with doctor of schemes Fauci, and their friends keep on terrorizing humanity with the multiple Pandemics panic, & also promoting their "Population Control" in more than one sense, Trump is defying their prospects, and sticking to support the life of the minors, and of course, of the unborn, and of the American citizens, and with them to all of the good peoples of the word!!! (The problem is that he is not a doctor either, and even when he has "outsmarted" them in many aspects, he may fall in their trap of a mandatory but totally unnecessary "vaccine", as he fell in their trap of finding endless "masks" and "ventilators"..., so Open His Eyes God, it will be very upsetting to me to realize that he has fallen under their "vaccination" game, pray in the spirit for our good governing system, as Paul himself required us to do, so that we may continue having the freedom to proclaim God and everything that He inspires us, even if many are still willingly asleep..., I pray for Trump and Pence, for us to continue having a quiet and peaceful life to proclaim the Greatness of God no matter what!!):
Uno de los héroes originales de los Derechos Civiles en EE UU habla: https://youtu.be/1L7JuIEtL7A (the image for this video kept on coming blank over and over, so I just cropped a scene of it and put it here), como otros han hablado durante estos cuatro días. Estelita me pregunta:"Murió mucha gente en Estados Unidos de Covid según las noticias, por culpa de Trump... ¿Podemos confiar en El ?" Ésta es mi respuesta parcial: "El único realmente 100% confiable es Jesús, pero de las dos opciones que se tienen, Trump es el que se está oponiendo a los deseos globalistas que soltaron a la Pandemia con el propósito de una ganancia política internacional. Los mismos Medios Masivos corruptos que bloquean la difusión de la verdad del origen artificial del virus del COVID-19 (y del 9/11, etc.), son los que han estado criticando a Trump desde hace cuatro años por todo el mundo para desvirtuar su imagen, él fue el que decidió cerrar las llegadas de vuelos desde China a un tiempo temprano para evitar un aún mayor esparcimiento del virus en los EE UU, que es lo que los que Planearon esta pandemia querían, por lo tanto ellos ahora quieren negar que eso haya sido importante o bueno hace SEIS meses, simplemente con eso se comprueba que los que supuestamente checan los hechos están vendidos a los globalistas, aquí los mismos Chinos reconocen con quejas que Trump hizo eso tempranamente (y en ese entonces lo criticaban también falsamente de "racista" por cerrar las fronteras): https://www.youtube.com/watch?v=_KJkgaK2NNA, https://www.youtube.com/watch?v=jmXJcBIcuYg, más en https://www.youtube.com/results?search_query=Early+Closing+of+flights+from+China+to+the+USA. Se puede ver en la convención republicana que negros de calidad que se han querido superar son buenos líderes, y no como aquellos causando destrozos (BLM, Antifa, Black Bloc (esos ni Americanos son, son "porros" importados para causar caos), etc...) por ser directamente pagados por Soros y por los políticos Demócratas de carrera (también usando del dinero que Soros y que la campaña BLM les proporciona, y espero que muy pronto se detenga a los financiadores de esos desórdenes pre-planeados y fabricados contra los Estados Unidos). Recordemos que Trump es el único que ha sido anti-guerra hasta ahora, el único con valor para ir, arriesgando su vida a hablar con el loco de Corea del Norte para aplacarlo, y el único que fue a la ONU y al WEF a decirles sus verdades de que el globalismo va a ser aplastado por su gobierno, por eso los globalistas de Biden (político de carrera demócrata que vive del "sistema" como los Clinton, Pelosi, etc., porque hay otros demócratas a los que yo admiro porque NO se corrompen con los intereses ajenos de los globalistas como Robert F. Kennedy Jr., Vernon Jones, y otros pocos), y otras basuras globalistas reales a las que Trump se opone lo son Soros, Gates, la OMS (a la que él sabiamente ha dejado de financiar), Fauci, Redfield, Birx, Daszak, Baric, etc,, etc..."
On doing our daily studies the girl I like and I, I found from our subject topics this video: https://youtu.be/ow05B4bjGWQ, this is his encouraging educational proposal: https://web.archive.org/web/20160508213007/https://www.uv.es/genomica/spa/inves/Sternberg.pdf, https://www.cs.tufts.edu/~nr/cs257/archive/robert-sternberg/Successful%20Intelligence.pdf; and his equally encouraging proposal for a successful relation of man-woman love: https://www.tes.com/lessons/VxoN3JJoSqPE-w/sternberg-s-triarchic-theory, https://psychcentral.com/quizzes/sternberg-triangular-love-test/; https://www.robertjsternberg.com/love (https://archive.vn/cHVx4), and his most current GREAT site: https://lovemultiverse.com/ (a frozen shot saved: https://archive.vn/PjWGL)
Updated Aug 27, 2020, 11:05 AM
Fernando Castro-Chavez posted in FerKat.
Fernando Castro-Chavez posted in FerKat.
The Book of Daniel reminds us of battles amongst dark angels for the control of nations and of humanity, and the angels of God also intervening for the preservation of the good nations against such spiritual forces of darkness (Dn. 10:13: Mike, then a Messenger (maybe Gabe), Perses, etc...); well, a battle of such sorts is going on today in the heavenly realm... as well as here on earth!!!: |
The Book of Daniel reminds us of battles amongst dark angels for the control of nations and of humanity, and the angels of God also intervening for the preservation of the good nations against such spiritual forces of darkness (Dn. 10:13: Mike, then a Messenger (maybe Gabe), Perses, etc...); well, a battle of such sorts is going on today in the heavenly realm... as well as here on earth!!!:
Another great young Patriot, working hard for a better future, while we are still hanging around here (not for long, but not for less either!!!)!!!: https://www.youtube.com/watch?v=FuBHecxGSl8
Updated Aug 26, 2020, 12:10 PM
Trump Challenges and Defeats the godless Globalist Agenda of a "New Normal", of a "Great Reset", which is just another way to call the perverted NWO: SO: Say NO to One W. economy, say NO to One W. government say NO to One W. religion. Gladly, he also rejected the liar that the WHO is, so do WE THE PEOPLE! |
Trump Challenges and Defeats the godless Globalist Agenda of a "New Normal", of a "Great Reset", which is just another way to call the perverted NWO: SO: Say NO to One W. economy, say NO to One W. government say NO to One W. religion. Gladly, he also rejected the liar that the WHO is, so do WE THE PEOPLE!
The Heartfelt Speech Of Patriot Tim Scott of South Carolina: https://youtu.be/v6NWDEE2Uj8
Updated Aug 25, 2020, 1:30 PM
Fernando Castro-Chavez shared a memory.
9 Years Ago
Fernando Castro-Chavez added a new photo.
Aug 25, 2011, 10:10 PM
Esta foto tiene la historia descrita para niños; como adultos sabemos que los primeros frutos de la humanidad perfeccionada por gracia nos vamos al cielo, primero los que murieron en Cristo y luego los vivos, a seguir vivos por siempre!
That Ark as a metaphor of our impending departure...
Updated Aug 25, 2020, 11:18 AM
Fernando Castro-Chavez shared a link to the group: FerKat.
Intrigued by this: https://www.tes.com/lessons/VxoN3JJoSqPE-w/sternberg-s-triarchic-theory, I will respond this with the Kat abiding in all of my seconds: https://psychcentral.com/quizzes/sternberg-triangular-love-test/
Saving elsewhere: https://archive.vn/55J3G, the files that were mercilessly removed from the Archive dot Org, free download of all, such as the first one: https://fdocc2.files.wordpress.com/2020/08/1.the-poisoned-needle-93-429.pdf, where I also put them all today: https://fdocc2.wordpress.com/2020/08/24/the-poisoned-needle-by-eleanor-mcbean-1957-is-a-classic-that-you-need-to-know-to-be-medically-informed, another book that the same author wrote twenty years later is: https://fdocc2.files.wordpress.com/2020/08/16.-vaccines-biggest-medical-fraud-in-history-91-390.pdf (Do your best to open the eyes of your neighbor).
Updated Aug 24, 2020, 2:35 PM
I was able to record from my screen the end of the speech of today, and when he said that the CCP of China was the one that purposefully, in concoction with the US career politician Democrats (i.e., Biden, Pelosi, Clinton, clarified as per the observation by @[100003085740160:2048:Kathleen Hall]), to ruin the USA economy and to defeat him through a mail voting (method with which the CCP from China pre-made-ballouts in favor of the full time dwellers on politics Democrats (not the lay citizens), who have already sold their souls to the best financial bidders, will be entering with not a single problem), released the COVID-19, YouTube cut the transmission for several seconds of his Nomination for President 2021-2024 (as it can be seen at the three seconds lags end of this short clip, then I stopped my first recording, even when the freeze lasted longer..., just to resume when "the signal" went back, as seen in the final clip of his speech below), just look by yourself who are "the ones" pushing the CCP China style of censorship of the "Social" Networks (since 2019, as if "they" already knew what was coming) and who is on the opposite side, trying to keep them fully free and open: https://schiff.house.gov/imo/media/doc/Vaccine%20Letter_Zuckerberg.pdf, https://www.businessinsider.com/adam-schiff-tells-google-and-twitter-to-look-to-facebook-2020-4?r=MX&IR=T, https://fas.org/sgp/crs/misc/R45650.pdf vs. https://www.whitehouse.gov/presidential-actions/executive-order-preventing-online-censorship, https://www.heartland.org/news-opinion/news/physician-group-sues-adam-schiff-for-attempting-to-censure-vaccine-debate, https://static1.squarespace.com/static/514b05c6e4b04d7440eb010a/t/5e43713e383ee71bf828b05d/1581478219297/Letter-to-White-House-Officials-Feb-10-2020.pdf |
I was able to record from my screen the end of the speech of today, and when he said that the CCP of China was the one that purposefully, in concoction with the US career politician Democrats (i.e., Biden, Pelosi, Clinton, clarified as per the observation by Kathleen Hall), to ruin the USA economy and to defeat him through a mail voting (method with which the CCP from China pre-made-ballouts in favor of the full time dwellers on politics Democrats (not the lay citizens), who have already sold their souls to the best financial bidders, will be entering with not a single problem), released the COVID-19, YouTube cut the transmission for several seconds of his Nomination for President 2021-2024 (as it can be seen at the three seconds lags end of this short clip, then I stopped my first recording, even when the freeze lasted longer..., just to resume when "the signal" went back, as seen in the final clip of his speech below), just look by yourself who are "the ones" pushing the CCP China style of censorship of the "Social" Networks (since 2019, as if "they" already knew what was coming) and who is on the opposite side, trying to keep them fully free and open: https://schiff.house.gov/imo/media/doc/Vaccine%20Letter_Zuckerberg.pdf, https://www.businessinsider.com/adam-schiff-tells-google-and-twitter-to-look-to-facebook-2020-4?r=MX&IR=T, https://fas.org/sgp/crs/misc/R45650.pdf vs. https://www.whitehouse.gov/presidential-actions/executive-order-preventing-online-censorship, https://www.heartland.org/news-opinion/news/physician-group-sues-adam-schiff-for-attempting-to-censure-vaccine-debate, https://static1.squarespace.com/static/514b05c6e4b04d7440eb010a/t/5e43713e383ee71bf828b05d/1581478219297/Letter-to-White-House-Officials-Feb-10-2020.pdf
Fernando Castro-Chavez updated his status.
Fernando Castro-Chavez posted in FerKat.
Now our wavelengths, even if they travel afar, are in a Constructive "Interference" (I do not like too much that they used that word, I may have used: "SINERGY": "Constructive Sinergy"), why our waves have unified themselves? Because we have made our independent goals our COMMON goals, otherwise it will be indeed a "Destructive Interference"!!!! Hehee, God, thank you for unifying our forces, energies and our fields!!! Here is the captured slide, we as the speed of light are proportional, so always keeping the same and maximum speed of light!!!:
Fernando Castro-Chavez posted in FerKat.
Kat of All of My Endless Admiration, at Least we Have Each other No Matter What, I am With No Conditions YOURS!!! That, to have us is more valuable than all the gold on the earth!!! And it is more valuable than all the titles and degrees that may be possible in the whole universe!!! So, here is the awesome data of the FIVE water constants (another part of the grand design of GOD)!!!
Plandemic II: The most popular site nowhere to be found on the Internet as Google altered its algorithms to make you NOT to find what is NOT convenient by the devilish globalistst that control them: https://plandemicseries.com/ (Download and share all their videos before they are hijacked again as it was done in the Plandemic I) https://ise.media/ All the videos there are worthy to be watched!!! Mikki Willis: https://www.facebook.com/mikki.willis
Updated Aug 23, 2020, 6:20 PM
More an more people is aware of this: https://www.facebook.com/BenSwannRealityCheck/videos/222593145838782, https://ise.media/video/exclusive-interview-ben-swann-and-plandemic-creator-mikki-willis-24.html, since Mikovits, PhD, by the side of the Lawyer @[100001604190174:2048:Kent Heckenlively] started opening the swamp of the living "Plague" integrated by the Medical very corrupt leaders of America: Fauci, Redfield, Birx, Collins, Varmus, and the list goes on...: https://www.minds.com/newsfeed/1144263933405179904, hopefully Trump does something about draining that swam and that he is not just words and rhetoric, that will be very disappointing for us Americans! In the Plandemic II we found the next, as I responded today to Marie Ovensmith (Updated here to be more explicit): "It seems that the earlier illegal patent (of a Coronavirus) was on the works by Ralph Steven Baric: https://archive.vn/zeSN0 (his cynicism knows no boundaries), as the expert David E. Martin, PhD National Intelligence Analyst, Founder of IQ100 Index (NYSE), says, since 1999, so the dates as seen in the still not removed Patent of him poses dates such as 2001 for the USA and 2002 worldwide (so, as we all know the "fact checkers" are a bunch of idiots paid by the globalists that want to also idiotize the rest of the world), the evidence indicates that even the SARS of 2003 was already an engineered virus from the UNC Lab of Baric (a globalist dupe or supporter, and in either case, very harmful for humanity!, also involved with MERS: https://grantome.com/grant/NIH/R01-AI110700-04): https://archive.vn/7ud3n, the other early patent that appears in the video is: 2003-2004: https://archive.vn/oWrmE, patented by the extremely corrupt CDC, remember William Thompson, and the law that forbids doing so: https://archive.vn/4ileW (and some from the NIH database on a ruling about that: https://archive.vn/FmGSz, https://archive.vn/vnhDC), and the protests of the media raised at that time: https://archive.vn/gS6Ig, but today 17 years later, all the media and social networks have already been bought with the big pharma money!" But also the "Pasteur Institute" patented about Sars (2003): https://archive.vn/j5lTV, which means that this was a globalist race, to see which organization was more in line with the plans of the current criminal globalists that caused the current aliment through all the world (and remember the pitfalls of its founder: https://tinyurl.com/past-lie-eur, https://books.google.com.mx/books?id=KfehqKQWwNIC).
Updated Aug 23, 2020, 4:37 PM
Fernando Castro-Chavez posted in FerKat.
Her channel: https://www.youtube.com/channel/UCOVus4q3qrOyKV_cxyfwfhw
Her own references to her very important: "Human 2.0"? A Wake-Up Call To The World:
https://pubs.rsc.org/--/content/articlelanding/2015/ra/c5ra01508a#!divAbstract
https://www.aier.org/article/why-operation-warp-speed-could-be-deadly/
https://www.facebook.com/1780584826/posts/10213711458378968/?
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1232869/
https://kenfm.de/bill-gates-predicts-700000-victims-from-corona-vaccination/
https://youtu.be/ywuCRVJVDqs
https://www.nationalgeographic.com/science/2020/05/moderna-coronavirus-vaccine-how-it-works-cvd/ (https://archive.vn/G6dve)
https://www.forbes.com/sites/nathanvardi/2020/07/29/modernas-mysterious-coronavirus-vaccine-delivery-system
https://www.washingtonpost.com/science/2018/11/30/gene-drive-research-fight-diseases-can-proceed-cautiously-un-group-decides/
https://www.youtube.com/watch?v=iMl0ty6evhU
https://www.youtube.com/watch?v=KAAZD7QSDiM
https://scialert.net/fulltext/?doi=biotech.2011.136.148
https://www.youtube.com/watch?v=Ofdd4ILdpVY
http://ir.inovio.com/news-releases/news-releases-details/2020/INOVIOs-COVID-19-DNA-Vaccine-INO-4800-Demonstrates-Robust-Neutralizing-Antibody-and-T-Cell-Immune-Responses-in-Preclinical-Models/default.aspx
https://www.researchgate.net/publication/232740966_What_you_always_needed_to_know_about_electroporation_based_DNA_vaccines
https://www.theglobeandmail.com/business/international-business/article-astrazeneca-to-be-exempt-from-coronavirus-vaccine-liability-claims-in/
https://www.discovermagazine.com/the-sciences/20-things-you-didn't-know-about-dna
https://blogs.timesofisrael.com/gene-editing-moderna-and-transhumanism/
https://www.sciencedaily.com/releases/2020/07/200715095500.htm
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC33911/
https://www.genengnews.com/topics/drug-discovery/quantum-dots-deliver-vaccines-and-invisibly-encode-vaccination-history-in-skin/
https://newatlas.com/snake-fang-microneedle-patch/60868/
https://nerdist.com/article/invisible-tattoos-vaccination-records-tracking/
https://www.thermofisher.com/mx/es/home/references/gibco-cell-culture-basics/transfection-basics/introduction-to-transfection.html
https://profusa.com/injectable-body-sensors-take-personal-chemistry-to-a-cell-phone-closer-to-reality/
https://www.forbes.com/sites/sarwantsingh/2017/11/20/transhumanism-and-the-future-of-humanity-seven-ways-the-world-will-change-by-2030/#158444a7d79e
https://www.sciencedaily.com/releases/2020/07/200715095500.htm
https://www.scientificamerican.com/article/invisible-ink-could-reveal-whether-kids-have-been-vaccinated/
https://www.researchgate.net/publication/338044557_Biocompatible_near-infrared_quantum_dots_delivered_to_the_skin_by_microneedle_patches_record_vaccination
https://sciencebusiness.technewslit.com/?p=36802
https://steemit.com/life/@pranavsinha/bill-and-melinda-gates-foundation-kicked-out-of-india
https://www.youtube.com/watch?v=ksEVaO806Oo
http://genedrivefiles.synbiowatch.org/2017/12/01/us-military-gene-drive-development/
https://www.bitchute.com/video/LDfqN0W8Iv8B/ (https://youtu.be/ywuCRVJVDqs)
Her own references to her very important: "Human 2.0"? A Wake-Up Call To The World:
https://pubs.rsc.org/--/content/articlelanding/2015/ra/c5ra01508a#!divAbstract
https://www.aier.org/article/why-operation-warp-speed-could-be-deadly/
https://www.facebook.com/1780584826/posts/10213711458378968/?
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1232869/
https://kenfm.de/bill-gates-predicts-700000-victims-from-corona-vaccination/
https://youtu.be/ywuCRVJVDqs
https://www.nationalgeographic.com/science/2020/05/moderna-coronavirus-vaccine-how-it-works-cvd/ (https://archive.vn/G6dve)
https://www.forbes.com/sites/nathanvardi/2020/07/29/modernas-mysterious-coronavirus-vaccine-delivery-system
https://www.washingtonpost.com/science/2018/11/30/gene-drive-research-fight-diseases-can-proceed-cautiously-un-group-decides/
https://www.youtube.com/watch?v=iMl0ty6evhU
https://www.youtube.com/watch?v=KAAZD7QSDiM
https://scialert.net/fulltext/?doi=biotech.2011.136.148
https://www.youtube.com/watch?v=Ofdd4ILdpVY
http://ir.inovio.com/news-releases/news-releases-details/2020/INOVIOs-COVID-19-DNA-Vaccine-INO-4800-Demonstrates-Robust-Neutralizing-Antibody-and-T-Cell-Immune-Responses-in-Preclinical-Models/default.aspx
https://www.researchgate.net/publication/232740966_What_you_always_needed_to_know_about_electroporation_based_DNA_vaccines
https://www.theglobeandmail.com/business/international-business/article-astrazeneca-to-be-exempt-from-coronavirus-vaccine-liability-claims-in/
https://www.discovermagazine.com/the-sciences/20-things-you-didn't-know-about-dna
https://blogs.timesofisrael.com/gene-editing-moderna-and-transhumanism/
https://www.sciencedaily.com/releases/2020/07/200715095500.htm
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC33911/
https://www.genengnews.com/topics/drug-discovery/quantum-dots-deliver-vaccines-and-invisibly-encode-vaccination-history-in-skin/
https://newatlas.com/snake-fang-microneedle-patch/60868/
https://nerdist.com/article/invisible-tattoos-vaccination-records-tracking/
https://www.thermofisher.com/mx/es/home/references/gibco-cell-culture-basics/transfection-basics/introduction-to-transfection.html
https://profusa.com/injectable-body-sensors-take-personal-chemistry-to-a-cell-phone-closer-to-reality/
https://www.forbes.com/sites/sarwantsingh/2017/11/20/transhumanism-and-the-future-of-humanity-seven-ways-the-world-will-change-by-2030/#158444a7d79e
https://www.sciencedaily.com/releases/2020/07/200715095500.htm
https://www.scientificamerican.com/article/invisible-ink-could-reveal-whether-kids-have-been-vaccinated/
https://www.researchgate.net/publication/338044557_Biocompatible_near-infrared_quantum_dots_delivered_to_the_skin_by_microneedle_patches_record_vaccination
https://sciencebusiness.technewslit.com/?p=36802
https://steemit.com/life/@pranavsinha/bill-and-melinda-gates-foundation-kicked-out-of-india
https://www.youtube.com/watch?v=ksEVaO806Oo
http://genedrivefiles.synbiowatch.org/2017/12/01/us-military-gene-drive-development/
https://www.bitchute.com/video/LDfqN0W8Iv8B/ (https://youtu.be/ywuCRVJVDqs)
My posting of today at the RG: "Baofu Qiao & Monica Olvera de la Cruz made a great experiment entitled: "Enhanced Binding of SARS-CoV‑2 Spike Protein to Receptor by Distal Polybasic Cleavage Sites": Comment: https://archive.vn/Mzyhh and
https://pubs.acs.org/doi/pdf/10.1021/acsnano.0c04798 .
Here, they remove the NSPRRA and discover a reduction of binding affinity between COVID-19 and ACE2 of 36%, then they just replace the Rs with Es, to get a NSPEEA mutant, and this one was able to reduce its affinity bt 20%.
This is, as they put it, an additional evidence that such polibasic, positively charged and distant region from the RBD is unusual biologically, which for us means that has been INSERTED artificially as the other many fragments that keep on being discovered, on a daily basis, as shown above. Their own expressions are as follows:
"We didn't expect to see electrostatic interactions at 10 nanometers," Qiao said. "In physiological conditions, all electrostatic interactions no longer occur at distances longer than 1 nanometer."
Which is further evidence that the COVID-19 virus has been carefully designed in a laboratory to increase its damages in the vulnerable populations.
Furthermore they found a therapeutic alternative by producing a tetrapeptide that attaches to that PRRA polybasic site and inhibits its attachment to the target host cells, it is the GluGluLeuGlu or EELE, which means that by producing this short peptide and nebulizing it to COVID-19 patients, the resulting loads virus will be unable to keep on attacking the cells of the lungs.
Their work as presented in Spanish: https://archive.vn/udojB, translated into Spanish the words of Qiao are:
“No esperábamos ver interacciones electrostáticas a 10 nanómetros. En condiciones fisiológicas, todas las interacciones electrostáticas ya no ocurren a distancias superiores a 1 nanómetro”, refirió el profesor Baofu Qiao.
This study develops experimentally the previous theoretical observations done by the European team of:
Sørensen, B., Dagleish, A. and Susrud, A.The Evidence which Suggests that This Is No Naturally Evolved Virus. A Reconstructed Historical Aetiology of the SARS-CoV-2 Spike. Minervanett 2020:8 pp.: https://www.minervanett.no/files/2020/07/13/TheEvidenceNoNaturalEvol.pdf
Thanks to Alberto Rubio-Casillas for showing me the article of the successful Mexican-Asian team": https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031
https://pubs.acs.org/doi/pdf/10.1021/acsnano.0c04798 .
Here, they remove the NSPRRA and discover a reduction of binding affinity between COVID-19 and ACE2 of 36%, then they just replace the Rs with Es, to get a NSPEEA mutant, and this one was able to reduce its affinity bt 20%.
This is, as they put it, an additional evidence that such polibasic, positively charged and distant region from the RBD is unusual biologically, which for us means that has been INSERTED artificially as the other many fragments that keep on being discovered, on a daily basis, as shown above. Their own expressions are as follows:
"We didn't expect to see electrostatic interactions at 10 nanometers," Qiao said. "In physiological conditions, all electrostatic interactions no longer occur at distances longer than 1 nanometer."
Which is further evidence that the COVID-19 virus has been carefully designed in a laboratory to increase its damages in the vulnerable populations.
Furthermore they found a therapeutic alternative by producing a tetrapeptide that attaches to that PRRA polybasic site and inhibits its attachment to the target host cells, it is the GluGluLeuGlu or EELE, which means that by producing this short peptide and nebulizing it to COVID-19 patients, the resulting loads virus will be unable to keep on attacking the cells of the lungs.
Their work as presented in Spanish: https://archive.vn/udojB, translated into Spanish the words of Qiao are:
“No esperábamos ver interacciones electrostáticas a 10 nanómetros. En condiciones fisiológicas, todas las interacciones electrostáticas ya no ocurren a distancias superiores a 1 nanómetro”, refirió el profesor Baofu Qiao.
This study develops experimentally the previous theoretical observations done by the European team of:
Sørensen, B., Dagleish, A. and Susrud, A.The Evidence which Suggests that This Is No Naturally Evolved Virus. A Reconstructed Historical Aetiology of the SARS-CoV-2 Spike. Minervanett 2020:8 pp.: https://www.minervanett.no/files/2020/07/13/TheEvidenceNoNaturalEvol.pdf
Thanks to Alberto Rubio-Casillas for showing me the article of the successful Mexican-Asian team": https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031
Fernando Castro-Chavez posted in FerKat.
I just received my third recommendation letter for my NYU application, is from the collaborator of Montagnier, who said to them: "If I strongly support the candidacy of Doctor Fernando Castro-Chavez, it is not for his great expertise as a Biochemist, because I am ignorant in this field: pioneer of Artificial Intelligence around 1990, I have been interested, for more than 30 years in the biomathematics of genomes, DNA and proteins.
But it turns out that, from the first days of this year 2020, very few researchers have looked into the possible origins of the genome of the coronavirus COVID_19 ... Among them, Fernando Castro_Chavez and myself ...
It was therefore inevitable that our roads would cross ...
Also, from February 2020, I was able to enrich myself with the detailed and documented analyzes that Dr. Castro-Chavez regularly posted on researchgate in particular.
He quickly achieved pioneering expertise in the genome and biology of COVID_19 ...
I now consider that Doctor Castro-Chavez is really an exceptional researcher, curious, tireless worker, enthusiastic but above all coherent and very educational.
I fully support his candidacy.
Jean Claude Perez
PhD Maths § Computer Science Bordeaux University, RETIRED interdisciplinary researcher (IBM
Emeritus, IBM European Research Center on Artificial Intelligence Montpellier), Martignas on
jalles, Bordeaux Metropole, France."
But it turns out that, from the first days of this year 2020, very few researchers have looked into the possible origins of the genome of the coronavirus COVID_19 ... Among them, Fernando Castro_Chavez and myself ...
It was therefore inevitable that our roads would cross ...
Also, from February 2020, I was able to enrich myself with the detailed and documented analyzes that Dr. Castro-Chavez regularly posted on researchgate in particular.
He quickly achieved pioneering expertise in the genome and biology of COVID_19 ...
I now consider that Doctor Castro-Chavez is really an exceptional researcher, curious, tireless worker, enthusiastic but above all coherent and very educational.
I fully support his candidacy.
Jean Claude Perez
PhD Maths § Computer Science Bordeaux University, RETIRED interdisciplinary researcher (IBM
Emeritus, IBM European Research Center on Artificial Intelligence Montpellier), Martignas on
jalles, Bordeaux Metropole, France."
Fernando Castro-Chavez shared a link to the group: FerKat.
My Application of today at the NYU is this one: https://apply.interfolio.com/78023, here is my letter: 08/21/2020
Dear Carmofon Lab at the NYU,
I am a Molecular Biology Postdoctoral good fit for this position because I am an experienced Molecular Biologist that has been both doing experiments and teaching, since 2000 at the Baylor College of Medicine (BCM) as well as at the Universidad de Guadalajara (U de G). In the BCM I was the leading author of more than five and less than five, respectively, co-authors, both for my PhD Thesis and for my Postdoctoral Main Project, and I did work well in that intercultural, international team.
In both of the previous cases, I liked to use the most innovative methodologies available at that time, which were Microarrays (15K fragments of genes, with three replicates, building a database of variants and using every single software for analysis on and offline, settling with the dChip, and discovering the methodological artifacts of the single strand self-annealing of linkers contaminating millions of genes in the Genbank and in all the platforms depending on it, such as Affymetrix, our chosen provider of microarrays) and 3-D magnetically levitated cell cultures, succeeding in both projects with main publications on their fields, which were obesity (the first Perilipin knock-out mouse) and atherosclerosis (the first 3-D culture Athero model demonstrating attenuation of the disease), respectively. Due to my previous experiments, I have experience in mouse husbandry, metabolomics, and analytical chemistry.
Your lab is of interest to me because I am seeking to grow in my career into lab management as a more senior Laboratory Associate due to my proven expertise, I am also seeking to settle in one specific place, selecting for that New York as endless; theoretically, it is intriguing to determine how metabolic modifications, such as reducing the pH and/or the nutrients make the tumor cells to modify their signaling system, altering the communication cell to cell, delaying or even preventing the tumor growth.
But, I am also very intrigued by continue my methodological and technical development of the advanced approaches that you have in your lab, including in vitro and in vivo tumor modeling, genomics, metabolomics, cell culture, live microscopy, image analysis, and micro-fabrication using 3-D printing which I think will greatly enhance my skills. I am eager to implement my 3-D levitated cultures there.
I am mature, serious, work oriented, responsible, but at the same time fun, very easy-going, and most of all, I like to think out-of-the-box, developing an independent research program on the exploration of the Genetic Code and its properties (The “Rules of Variation”), I am constantly working on an article related to it, aiming to keep on publishing both my experimental and my theoretical biological research.
I am open to any question regarding my qualifications and the personal and human aspect of why I, as an American Citizen, am willing to move to New York to work in your Laboratory (fdocc@yahoo.com; https://www.facebook.com/fernando.castrochavez.90). Hence, I have decided to attach as an extra bundle six of my most significant publications, including the one of this crazy 2020 year, dealing with the Lab Origins of Sars-CoV-2 and the accumulating day by day evidence that corroborates that claim.
With my best hopes to take this job,
Fernando Castro-Chavez, PhD, BCM Postdoc.
Dear Carmofon Lab at the NYU,
I am a Molecular Biology Postdoctoral good fit for this position because I am an experienced Molecular Biologist that has been both doing experiments and teaching, since 2000 at the Baylor College of Medicine (BCM) as well as at the Universidad de Guadalajara (U de G). In the BCM I was the leading author of more than five and less than five, respectively, co-authors, both for my PhD Thesis and for my Postdoctoral Main Project, and I did work well in that intercultural, international team.
In both of the previous cases, I liked to use the most innovative methodologies available at that time, which were Microarrays (15K fragments of genes, with three replicates, building a database of variants and using every single software for analysis on and offline, settling with the dChip, and discovering the methodological artifacts of the single strand self-annealing of linkers contaminating millions of genes in the Genbank and in all the platforms depending on it, such as Affymetrix, our chosen provider of microarrays) and 3-D magnetically levitated cell cultures, succeeding in both projects with main publications on their fields, which were obesity (the first Perilipin knock-out mouse) and atherosclerosis (the first 3-D culture Athero model demonstrating attenuation of the disease), respectively. Due to my previous experiments, I have experience in mouse husbandry, metabolomics, and analytical chemistry.
Your lab is of interest to me because I am seeking to grow in my career into lab management as a more senior Laboratory Associate due to my proven expertise, I am also seeking to settle in one specific place, selecting for that New York as endless; theoretically, it is intriguing to determine how metabolic modifications, such as reducing the pH and/or the nutrients make the tumor cells to modify their signaling system, altering the communication cell to cell, delaying or even preventing the tumor growth.
But, I am also very intrigued by continue my methodological and technical development of the advanced approaches that you have in your lab, including in vitro and in vivo tumor modeling, genomics, metabolomics, cell culture, live microscopy, image analysis, and micro-fabrication using 3-D printing which I think will greatly enhance my skills. I am eager to implement my 3-D levitated cultures there.
I am mature, serious, work oriented, responsible, but at the same time fun, very easy-going, and most of all, I like to think out-of-the-box, developing an independent research program on the exploration of the Genetic Code and its properties (The “Rules of Variation”), I am constantly working on an article related to it, aiming to keep on publishing both my experimental and my theoretical biological research.
I am open to any question regarding my qualifications and the personal and human aspect of why I, as an American Citizen, am willing to move to New York to work in your Laboratory (fdocc@yahoo.com; https://www.facebook.com/fernando.castrochavez.90). Hence, I have decided to attach as an extra bundle six of my most significant publications, including the one of this crazy 2020 year, dealing with the Lab Origins of Sars-CoV-2 and the accumulating day by day evidence that corroborates that claim.
With my best hopes to take this job,
Fernando Castro-Chavez, PhD, BCM Postdoc.
El rescate actual se trata de dos estudios que dada su profundidad agregué a mi "Antología de Textos Científicos" desde el año 2000: La Ciencia de Dios: El Originador de la Ciencia: Cuerpo, Alma y Espíritu", por VPW, y "Las Constelaciones y Su Remoto Origen", por Ethelbert W. Búllinger. La melodía es: "Wade in the Water": https://youtu.be/Nkhfz9DsDyg, esto hasta ahora completa tres de mis rescates: El tremendo de Einstein, en ese mismo sitio, con la gran instrumental "Tangram", y el de Mendel con una pieza desconocida (links de ambos también en un mensaje de más abajo):
Updated Aug 21, 2020, 2:08 PM
Here is the second part of the series that keep on hammering the heads of the deceiving liars that have taken the world is if they were the owners of every single human being: https://www.bitchute.com/video/ZFjRALF5nkHd/, look it all before they keep on removing and censoring it!!! It is a fight to death, either you choose the light!!! Or you choose the "dark mode", the cynicism of the ones that sold their souls to Satan is so disgusting that you need to ask God to open your eyes and to tell you what can you do to help stop this madness of the few malignant beings of this planet. You can start by praying in the spirit, which is the speaking in tongues non-cesant as frequently as you can!!!
Updated Aug 20, 2020, 4:22 PM
Fernando Castro-Chavez shared a memory.
4 Years Ago
Aug 20, 2017, 6:06 PM
Explorando el "Parque Ecológico los Ocotillos", en Zapotlán, Jal.
Disfrutando, según recuerdo, cada pequeño detalle de la naturaleza que nos rodea, de la divina Creación de Dios: cada planta, cada flor, cada árbol, cada insecto, todos ellos declaran lo gloria de Dios a su manera y como mejor pueden, así también nosotros!
Updated Aug 20, 2020, 9:29 AM
Fernando Castro-Chavez posted in FerKat.
D E Shaw responded and said NO, so 10% of all my applications gets responded with NO, 90% of them they do not even respond at all. But whatever is needed to be done I will and want to do it with the help of God, for you to have the MD done at the NYU better than at UST. But as I said, I am willing to adapt to anyplace and anything with you.
Fernando Castro-Chavez shared a link to the group: FerKat.
This is my to-Vogel letter to work at the NYU: Dear New York University, NYU, Vogel Lab,
I am applying for Research Scientist in your Lab, I am interested in eukaryotic response to protein misfolding & your integromics approach… I will succeed, given my experience with the physiological aspect of obesity and its possible molecular prevention, to grow in my specialized service to humans. I think I am very qualified for the job because I am a Postdoctoral in Molecular Biology both from the Baylor College of Medicine (BCM) and from the NYMC, work that I left incomplete before the Pandemic, on going to take care of my elderly parents in Mexico, but I was working consistently in both places in the anti-obesity field. I took the Postdoctoral during three years of NIH Training in Atherosclerosis, Thrombosis and Vascular Biology at the distinguished Laboratory of the Dr. Christie M. Ballatyne, BCM, producing one article as first author and a couple of articles as coauthor, realizing the effect of LPC coming out of LDL. I have published 16 research articles in molecular biology, using genomic and proteomic methodologies, including the comparison of data such as microarrays and scanning of proteins. I have also used mice models of anti-obesity (which is a special case of inflammation) and human cell cultures in 3-D through magnetic levitation as models of atherosclerosis to delay this process with substances such as SHN3, humanly produced. My last research is precisely, critical of COVID-19, being artificial. I really like to teach, to give to the next generation my best. I wish to provide expertise in my specialized area of Molecular Biology and the research that I have done on the Genetic Code. Past didactic classes of which I have been professor include Biochemistry Genetics, Pharmacology and Molecular Biology, plus endless tutoring personal hours. This is my LinkedIn profile: https://www.linkedin.com/in/fernando-castro-chavez-6744a322
I expect to make scientific and scholarly contributions to the research at hand. My PhD is in molecular biology and my dual Postdoc is in Anti-Obesity and Anti-Athero, I have a solid knowledge of cell and mitochondrial metabolism, as the anti-obesity mice that we studied (Perilipin KO) had up-regulated all mitochondrial genes: Respiratory Chain, Beta Oxidation, Krebs (TCA) Cycle; as per my cell culturing experience, I optimized the 3-D cell culture of atherosclerosis models, also working with 2-D cultures; that experience goes from my plasmid research in 1989-90, to my microarray research in the 2000-03 and my 3-D magnetically levitated VSMCs in the 2008-11, plus a recent brief stay in 2019 at the NYMC working with pomegranate oil to reduce diabetes in mice; my proven publication record includes those 15 articles at the PubMed, plus the one on the Pandemic, which also evidences my strong written and oral communication skills, ability to prioritize and to manage my time, ability to work independently and capable of interacting successfully within a group, leading an international and interdisciplinary team twice for my PhD Thesis and my Postdoc research, with fluorescence microscopy, experience in diabetes research, in metabolic modeling and on RNAi methods.
Yours for your consideration, Fernando Castro-Chavez, PhD.
I am applying for Research Scientist in your Lab, I am interested in eukaryotic response to protein misfolding & your integromics approach… I will succeed, given my experience with the physiological aspect of obesity and its possible molecular prevention, to grow in my specialized service to humans. I think I am very qualified for the job because I am a Postdoctoral in Molecular Biology both from the Baylor College of Medicine (BCM) and from the NYMC, work that I left incomplete before the Pandemic, on going to take care of my elderly parents in Mexico, but I was working consistently in both places in the anti-obesity field. I took the Postdoctoral during three years of NIH Training in Atherosclerosis, Thrombosis and Vascular Biology at the distinguished Laboratory of the Dr. Christie M. Ballatyne, BCM, producing one article as first author and a couple of articles as coauthor, realizing the effect of LPC coming out of LDL. I have published 16 research articles in molecular biology, using genomic and proteomic methodologies, including the comparison of data such as microarrays and scanning of proteins. I have also used mice models of anti-obesity (which is a special case of inflammation) and human cell cultures in 3-D through magnetic levitation as models of atherosclerosis to delay this process with substances such as SHN3, humanly produced. My last research is precisely, critical of COVID-19, being artificial. I really like to teach, to give to the next generation my best. I wish to provide expertise in my specialized area of Molecular Biology and the research that I have done on the Genetic Code. Past didactic classes of which I have been professor include Biochemistry Genetics, Pharmacology and Molecular Biology, plus endless tutoring personal hours. This is my LinkedIn profile: https://www.linkedin.com/in/fernando-castro-chavez-6744a322
I expect to make scientific and scholarly contributions to the research at hand. My PhD is in molecular biology and my dual Postdoc is in Anti-Obesity and Anti-Athero, I have a solid knowledge of cell and mitochondrial metabolism, as the anti-obesity mice that we studied (Perilipin KO) had up-regulated all mitochondrial genes: Respiratory Chain, Beta Oxidation, Krebs (TCA) Cycle; as per my cell culturing experience, I optimized the 3-D cell culture of atherosclerosis models, also working with 2-D cultures; that experience goes from my plasmid research in 1989-90, to my microarray research in the 2000-03 and my 3-D magnetically levitated VSMCs in the 2008-11, plus a recent brief stay in 2019 at the NYMC working with pomegranate oil to reduce diabetes in mice; my proven publication record includes those 15 articles at the PubMed, plus the one on the Pandemic, which also evidences my strong written and oral communication skills, ability to prioritize and to manage my time, ability to work independently and capable of interacting successfully within a group, leading an international and interdisciplinary team twice for my PhD Thesis and my Postdoc research, with fluorescence microscopy, experience in diabetes research, in metabolic modeling and on RNAi methods.
Yours for your consideration, Fernando Castro-Chavez, PhD.
My posting of today at that LinkedIn: https://www.linkedin.com/feed/update/urn:li:activity:6702017889446215680, while teaming up during some 8 hs daily of NMAT, while the last daily is for exercise, I am open to every good option According to Our Great Good Wonderful God!!! Doing our best we can, While Granting the Defining Piece to God!!! (As in this only one word!, but having a lot of fun while doing it!!! (Hehee): https://www.youtube.com/watch?v=uihYHuvtfKA), Bye for now:
Fernando Castro-Chavez posted in FerKat.
Fernando Castro-Chavez posted in FerKat.
Most Admired And Endlessly Exciting Woman For Me In Every Single Angle Of YOUR Existence, this was my application of Today: https://apply.interfolio.com/67266, but as I say, if I do not get anything, with YOU I am willing to go to New York and apply myself in anything in order to bring the bread to our place, it is very exciting to have an extreme prospect in life in which the only rope is the one that God is extending to US!!! Do you want to take the most extraordinary ride in life? To defeat the unknown? To tackle the impossible by ourselves? To Believe God 100% in every single aspect of our lives? I am ready whenever you are because it is a labor of determination of TWO and not only of one, it does not taste the same the food without YOU!!! I am craving to take you again to all those extraordinary and unknown yet places to eat in NY!!! Do you want to come with me??? Let's Do it! Let's Go!
Contento estoy de haber recordado al trabajo que realicé, en parte con la ayuda de mis alumnos de Bioquímica del C.U.C.S.: Estudiantes de Medicina, de Ciencias del Deporte, de Nutrición, de Enfermería, etc... Aquí les dejo un gran "Blast From the Past", con la parte que me gusta más de la ciencia: El descubrimiento de la genética realizado por un creyente en la Creación de Dios: Gregor Mendel!!! En ese entonces era grato meterle a las páginas un MIDI a la hora de que se abrieran, para escuchar una melodía, aquí está esa melodía desconocida, espero les guste como a mí cuando lo hice!!! Por allá por el año 2000. Me acordé de esto al estar buscando algo acerca del origen de las Constelaciones para mi colega de la carrera de Ingeniería Agricola de la UAG, MX, @[100001081960293:2048:Luis De Jesús] (a quien aquí recuerdo y saludo con canciones de la época que entonces él llegó a cantar: https://www.youtube.com/watch?v=A_Icst5Bfx8)!!! También he recordado a la guapa estudiante bachiller en aquel entonces, Verónica Fabiola Pulido Ponce, a quien de plano le perdí la pista, por si alguien la conoce, que me la salude...
Updated Aug 19, 2020, 4:15 PM
Fernando Castro-Chavez shared a memory.
7 Years Ago
Aug 19, 2014, 8:31 AM
Mazzaloth: The Planets and their Biblical meaning; the farther two on the Ecliptic: Uranus (false prophet) and Neptune (Abaddon, the Beast) represent the other two leading demons of Revelation that end up in the lake of fire with Satan, who goes there the last (Rev. 20:10); unknown to man until the Telescope was invented, further evidence that the Bible is The Revelation by God to the humanity.
Venus, Mercury and Mars, A.K.A. Jesus, Gabriel and Michael, versus Saturn, Uranus and Neptune, A.K.A. Satan, AntiProphet and AntiChrist, a spiritual battle that you can watch right now by turning on your spiritual discernment!!!
Updated Aug 19, 2020, 9:37 AM
An inspiring song to revolutionize our current thinking, dedicated to the One that melts my heart, propelling it into the skies!!! Do the best you can, the best God tells you to overcame this preplanned COVID-19 Pandemic takeover by the forces of darkness of this world!!!: https://www.youtube.com/watch?v=6a6lAwbE1J4
Updated Aug 19, 2020, 8:34 AM
Fernando Castro-Chavez posted in FerKat.
So, the Nobel Prize responded, and as mentioned, he fears that because of our standing for the truth, that his recommendation could be counterproductive, but I just told him to go ahead, that I do not care what they think, that we stand strong in our upholding the truth of what we are getting as results!
Fernando Castro-Chavez updated his status.
Our dear and bold Robert F. Kennedy Jr. is making a difference with this on purpose COVID-19 "darkness": https://www.instagram.com/p/CECUQ2LH1pI/?igshid=wampc0egd5p1
Fernando Castro-Chavez posted in FerKat.
So, the man who wants to make you infinitely happy and to keep you with no end daily smiling as in the cover photo of here, where we genuinely smile due to the joy of being together at Broadway!, has applied to the NYU at their branch of Brooklyn, NY: https://apply.interfolio.com/77041
Fernando Castro-Chavez posted in FerKat.
So, the Nobel Prize of 2008 for discovering the HIV, Luc Montagnier is now aware of my need of the best job in the USA, with one of his good contacts, I expect to receive an opportunity (But that Leap of Faith I am willing to do it for you and for you only, for you to see, as you requested since day one, how a real man loves a woman, because you are very worthy, to see how in real time with the real motivator of my heart beat, which is you since day one also, I am willing to die for you while demonstrating in real time the walking of belief by the hand of God! I know that the ideal is to have everything set ahead of time, but my real experience is that things do not work like that for me, but as an inspired take that arrives just in time, one step at a time, so please Kat, think about it and take that jump of faith with me, going back to the USA even if we only have the intense enthusiasm within us, and that, with God, is all that we need to succeed!)
El Heraldo de México acaba de publicar los resultados de Latham y Wilson indicando que el COVID-19 es Artificial, mejorado en humanos usados como conejillos de indias por el partido comunista chino (CCP): https://archive.vn/12m2a, que es una de las referencias que pongo en mi artículo, la cual en inglés apareció el mes pasado: https://www.independentsciencenews.org/commentaries/a-proposed-origin-for-sars-cov-2-and-the-covid-19-pandemic/, mi artículo es: https://globaljournals.org/GJSFR_Volume20/2-Anticovidian-v-2-COVID-19.pdf, mientras más gente sepa que toda la situación de la Pandemia del COVID-19 es algo deliberado y planeado por las fuerzas oscuras de este planeta, menos posibilidad tendrán de actuar. La luz disipa las tinieblas.
Updated Aug 17, 2020, 1:29 PM
During the week, I was studying genetics with the One I want (wishing it to one day soon that to be reciprocal), and we discovered this amazing thing: The "Template" (for the mRNA) strand is the "Lagged" strand, also called the minus (-) strand or the feminine, discontinuous, strand: The "life giving one", as women are, as it is the one that produces all the mRNA!!! As God created the DNA and the RNA, He also has also hidden messages there and within all of His molecular designs!!! The sky through His constellations narrates His plan of Salvation, also the molecules and atoms within our bodies!!! The fingerprints of the Creation and of the Salvation from God to men!!!
This is the third interview of Judy Mikovits with Mike Moore of the Thomas Paine show: https://lbry.tv/@fdocc:b/Judy-Mikovits-in-her-Third-interview-with-Mike-Moore-of-the-Thomas-Paine-Show:d, she has two new books with @[100001604190174:2048:Kent Heckenlively]: The one on the masking of humanity to condition the human brain to submission in preparation to the injection of the "Digitization" of humans, and another with her mentor Ruscetti, due for the next year: "Ending Plague", in my case, my research article just published this week is: https://globaljournals.org/GJSFR_Volume20/2-Anticovidian-v-2-COVID-19.pdf, so, each of us doing, like you, individually (do your own work and make it public, I have seen that such works), the best that we can do while we still have time! I am putting chronologically her research and I still have 31 more articles to go!!! Thus far, with the previous and this, only 19 of her early works have I been able to load on the screen!!!
Updated Aug 16, 2020, 10:59 AM
Fernando Castro-Chavez updated his status.
El Cantar de los Cantares nos habla de lo intenso que ha de ser el amor entre un hombre y una mujer... en contexto, Salomón intentó quedarse con una doncella de pueblo que ya había puesto sus ojos en otro hombre humilde que con reciprocidad la amaba. ¡Qué bello podría ser el amor de hombre y mujer cuándo este es plenamente recíproco! Ella despreció al hombre más poderoso y sabio de ese entonces y escapó a los brazos de su pastorcito. Amor como este, en la hora actual aún no me ha venido a mí. Si tú lo tienes, ¡no lo pierdas!, es preferible a todos los tesoros del universo. Jamás te unas por conveniencia a alguien que no quieras, el martirio y la tortura mutua serían como un infierno... y el pago de tanta "riqueza" en vano, serían solamente cánceres y tumores... Pero, ¡qué triste y destructivo para mi salud mental y física y la emocional de mis más cercanos, es un amor no correspondido! Si acaso te es posible, huye también de eso cuanto antes... a no ser que recibas alguna señal de ella o aún mejor, del Cielo, que podría desmentir a un fingimiento y sanar a un corazón, en el sentido que vale la pena la temporal agonía del instante actual... "Porque fuerte como la muerte es el amor", dice ese libro.
Guided by the meticulous work of Dr. David E. Martin, Plandemic II: Indoctornation, tracks a three decade-long money trail that leads directly to the key players behind the COVID 19 pandemic. Plandemic II connects the dots between all forms of media, the medical industry, politics and the financial industry to unmask the major conflicts of interests with the decision makers that are currently managing this crisis: https://plandemicseries.com/, please, download all the movies and share them profusely before it is too late, the criminals that brought to us this Plandemic of the COVID-19 engineered in a laboratory are invested into lying to us and rewriting the history, removing everything that is not convenient to them, even if all the evidences are clear!!! You can make the difference by NOT believing at the criminal "fact checkers" or at the prostitute "Mass Media", and now, the big whores of the "Social Media" too!!!
Updated Aug 24, 2020, 10:30 AM
Fernando Castro-Chavez shared a memory.
3 Years Ago
Aug 15, 2018, 11:25 PM
Santos Amados: Aquí les presento mi lectura de hoy de Hechos del 1 al 4 del griego: https://youtu.be/kzd4w8f1f6I, en donde se aprecia que es la continuación de las labores de Cristo Jesús, pero ahora él desde el cielo, instruyendo a los suyos, quienes al ser su Cuerpo continúan con su obra. Se observa la gran ventaja espiritual y el poder edificador que nos es el hablar en lenguas, así como el poder que tenemos para salvar y para sanar con el poder de Dios como si nosotros mismos fuéramos Cristo, ¡y eso precisamente significa hacer las cosas en el nombre de Jesucristo: cómo si él mismo las estuviera haciendo, nosotros actuando con su autoridad y poder! También se observa que la vida comunitaria fue algo temporal específico de los judíos cristianos que aprovecharon la reunión internacional de Pentecostés, para continuar aprendiendo al pie de los Apóstoles por unos días más, y eso fue todo (una probadita de la armonía del Milenio con Cristo como el Rey de reyes y Señor de señores). En Cristo, Fernando.
Mi mayor deleite es estudiar y compartir las maravillas de Dios, de Su Revelación y de Su Creación maravillosa. Como científico Postdoctoral, doblo mis rodillas solamente ante Dios, y mantengo mi plena y firme confianza, certeza y creencia en Dios aunque me cueste una y mil carreras, trabajos y relaciones. De que sirve todo eso si ya tenemos a Dios?
Updated Aug 15, 2020, 9:58 AM
The truth keeps on advancing, kicking the rear of the Adversary hard, no matter how the forces of darkness attempt to suppress it: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031
Updated Aug 15, 2020, 4:02 AM
Updated Aug 15, 2020, 4:01 AM
Fernando Castro-Chavez posted in FerKat.
My letter to Dr. Latham: "Dear Jonathan, I reported an artificial artifact in 2003 and was silently fired by my then PI from Hong Kong at the BCM of Houston, TX; then, 5 years later, back to the BCM I developed during 2-3 years a 3-D model of atherosclerosis and its attenuation and my methodology was stolen and reported first by a crooked team of Chinese, Korean and American men, from "The Methodist Hospital" and again from the BCM. To denounce 9/11 I needed to hide my results unseemly within my articles. Now, in reparation, we want to start for free, with a scholarship or with a grant, anywhere in this world, the career of MD or a related MSc in the company of my female study companion, but I found no support by anybody. So, we are in the mean time studying the NMAT to pay some $400.00 each just to have the right to do the test, and then (one of the cheap options that we have found, but we really, rather do it in the currently very beaten, but still the best place on earth, USA!!!), some more than $3,000.00 each per semester during eight semesters... So as Vivek and Lorna before me, we are talking about real life issues here that are going thus far into deaf ears. P.S. Here is my current effort done, as I am fighting for life against the current situation, to counter the deliberate release of COVID-19: 1) My peer-reviewed article that took four months of back and forths until accepted: https://globaljournals.org/GJSFR_Volume20/2-Anticovidian-v-2-COVID-19.pdf, 2) My ongoing discussion aimed at expert researchers: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031 (reaching the 16,000 reads), and brief excerpts of my several interviews where I report the current plots of the heartless globalists (in Spanish): https://www.youtube.com/watch?v=yvUjvukmJ-o, https://www.youtube.com/watch?v=V0g0Z9AGO98, and one of the full episodes: https://www.facebook.com/KardagarCoaching/videos/713879892781432, already reaching the 59,000 viewers. Any advice, help or suggestion will be very well accepted (@@ my paper). For further personal contacting or to answer questions, I can gladly be reached. In Christ, Fernando Castro-Chavez, PhD, Postdoctoral at the BCM and at the NYMC."
My current posting at the RG: "Engineered COVID-19... by Latham: https://archive.vn/NArOS
Depicts a grim reality, because if not stopped on time, the globalists behind this Pandemic are gladly realizing that the current hands-on criminals like Baric and Zheng-Li are getting away with designing and releasing COVID-19, they all now feel "empowered" to keep on breaking the laws and to keep on harming humanity, hence the medular importance to make it widely known that the current Sars-CoV-2 was originated in a lab and deliberately released to pursue an agenda of global control of human beings, of economies, of governments and even of religions, aiming at all of them being controlled by only one world government, that has been the sinister aim of the UN and of the WHO since the start... and now they are supported by the CCP, by Fauci and by Gates and company on that pursuit.
Ralph Baric is a very dishonest person, which makes him repugnant to all that is human, as in the recent past, he reported of having "found" in 2015 a killer virus to a TV station, when in reality he did not "found" it but "designed" it in the company of the main suspect of the release of the current Pandemic, CCP criminal: Shi Zheng-Li, who even brought from the WIV at Wuhan the killer Spike sequences previously tampered with by her, we read in that article "the lack of transparency represented by the sparse minutes and especially the redactions represent a violation of science’s social contract... The redaction of the researchers’ identities from IBC meeting minutes, in order to hide the activities of researchers and avoid accountability for accidents, fundamentally contradicts the core principles of the US oversight system and violates the commitments that science made"!!! So, yeah Baric is again at it, and their plan to keep on infecting humanity seems to be now based in more "accidental" releases with further cover-ups and layers of deception, just as this COVID-19 is, the good guys of the story are mostly Latham and Ebright, but also the others that are demanding the UNC to be transparent, Hammond, Racaniello and others. Ebright goes further: “There is no justification for UNC’s redaction of the names of the laboratory heads and the identities of pathogens. UNC’s redactions violate conditions UNC agreed to in exchange for NIH funding of UNC’s research and, if not corrected, should result in the termination of current NIH funding, and the loss of eligibility for future NIH funding, of UNC’s research.”
Excerpts:
"SARS-CoV-2 could infect researchers, especially inexperienced researchers, with unpredictable and potentially quite dangerous results. The biggest risk is the creation and accidental release of a novel form of SARS-CoV-2 — a variant whose altered characteristics... continues Hammond: “Each additional lab that experiments with CoV-2 amplifies the risk”... They do not provide any details of the fate of the bitten researcher. Nor do they state, for example, whether the researcher developed an active infection, nor whether they developed symptoms, nor if they transmitted the recombinant virus to anyone else. Neither do they reveal what kind of recombinant virus was being used or the purpose of the experiment... "...involved a mouse-adapted SARS-CoV-2 strain used in the development of a mouse model system.” Ralph Baric... UNC media relations also told Independent Science News that: “The researcher did not develop any symptoms and no infection occurred as a result of the incident.” ...the UNC redacted the names of Principal Investigators (PIs) whose research required biosafety scrutiny, along with many of the experimental specifics... (“a full-length infectious clone” refers to a viable DNA copy of the coronavirus, which is ordinarily an RNA virus)... any one of eight sets of different experiments approved by the UNC Chapel Hill IBC in 2020 proposed infecting mice with live infectious and mutant SARS-CoV-2-like coronaviruses under BSL-3 conditions and therefore could have led to the accident ...Hammond. Using FOIA again he has further discovered that researchers at the University of Pittsburgh (whose identity is redacted) plan to make what Hammond calls Corona-thrax... Pittsburgh researchers intend put the spike protein of SARS-CoV-2 (which allows the virus to gain entry into human cells) into Bacillus anthracis which is the causative agent of anthrax (U Pittsburgh Inst Biosafety Committee minutes June 2020)... the Institutional Biosafety Committee of the University of Pittsburgh... (did a) redacting the name of the laboratory from the minutes and also every name of the members of the committee which approved it... (so) who will take responsibility for risky coronavirus research?"
Make your comments there, I did mine, the previous of mine are:
"FOE had hoped to pursue litigation but could not find scientists willing to be expert witnesses. There were too many conflicts of interest. Scientists who strongly favored following the law were almost nonexistent. One of these was the late Marc Lappe, who was physically pushed against a wall by another scientists for questioning the refusal of scientists to accept regulation and follow the law regarding an EIS. / FOE”s president, Dave Brower, was himself besieged by “friends” to drop the lawsuit but refused. In our NY office Francine Simring established the Committee for Responsible Genetics, with globally notable credible scientists such as Erwin Chargaff and many others, urging a slow down in research and a commitment to preparing a comprehensive EIS, etc.
But it was an uphill battle and FOE was not able to raise enough money to continue the lawsuit." Lorna Salzman.
"The social contract that science is supposed to have had with society was dissolved long back." Vivek Cariappa.
Mine, awaiting "moderation" says:
"Dear Jonathan, I reported an artificial artifact in 2003 and was silently fired by my then PI from Hong Kong at the BCM of Houston, TX; then, 5 years later, back to the BCM I developed during 2-3 years a 3-D model of atherosclerosis and its attenuation and my methodology was stolen and reported first by a crooked team of Chinese, Korean and American men, from "The Methodist Hospital" and again from the BCM. To denounce 9/11 I needed to hide my results unseemly within my articles. Now, in reparation, we want to start for free, with a scholarship or with a grant, anywhere in this world, the career of MD or a related MSc in the company of my female study companion, but I found no support by anybody. So, we are in the mean time studying the NMAT to pay some $400.00 each just to have the right to do the test, and then (one of the cheap options that we have found, but we really, rather do it in the currently very beaten, but still the best place on earth, USA!!!), some more than $3,000.00 each per semester during eight semesters... So as Vivek and Lorna before me, we are talking about real life issues here that are going thus far into deaf ears. P.S. Here is my current effort done, as I am fighting for life against the current situation, to counter the deliberate release of COVID-19: 1) My peer-reviewed article that took four months of back and forths until accepted: https://globaljournals.org/GJSFR_Volume20/2-Anticovidian-v-2-COVID-19.pdf, 2) My ongoing discussion aimed at expert researchers: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031 (reaching the 16,000 reads), and brief excerpts of my several interviews where I report the current plots of the heartless globalists (in Spanish): https://www.youtube.com/watch?v=yvUjvukmJ-o, https://www.youtube.com/watch?v=V0g0Z9AGO98, and one of the full episodes: https://www.facebook.com/KardagarCoaching/videos/713879892781432, already reaching the 59,000 viewers. Any advice, help or suggestion will be very well accepted (@@ my paper). For further personal contacting or to answer questions, I can gladly be reached. In Christ, Fernando Castro-Chavez, PhD, Postdoctoral at the BCM and at the NYMC."
Thanks to Lisa K Townsend for the link." Posted at the: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031
Depicts a grim reality, because if not stopped on time, the globalists behind this Pandemic are gladly realizing that the current hands-on criminals like Baric and Zheng-Li are getting away with designing and releasing COVID-19, they all now feel "empowered" to keep on breaking the laws and to keep on harming humanity, hence the medular importance to make it widely known that the current Sars-CoV-2 was originated in a lab and deliberately released to pursue an agenda of global control of human beings, of economies, of governments and even of religions, aiming at all of them being controlled by only one world government, that has been the sinister aim of the UN and of the WHO since the start... and now they are supported by the CCP, by Fauci and by Gates and company on that pursuit.
Ralph Baric is a very dishonest person, which makes him repugnant to all that is human, as in the recent past, he reported of having "found" in 2015 a killer virus to a TV station, when in reality he did not "found" it but "designed" it in the company of the main suspect of the release of the current Pandemic, CCP criminal: Shi Zheng-Li, who even brought from the WIV at Wuhan the killer Spike sequences previously tampered with by her, we read in that article "the lack of transparency represented by the sparse minutes and especially the redactions represent a violation of science’s social contract... The redaction of the researchers’ identities from IBC meeting minutes, in order to hide the activities of researchers and avoid accountability for accidents, fundamentally contradicts the core principles of the US oversight system and violates the commitments that science made"!!! So, yeah Baric is again at it, and their plan to keep on infecting humanity seems to be now based in more "accidental" releases with further cover-ups and layers of deception, just as this COVID-19 is, the good guys of the story are mostly Latham and Ebright, but also the others that are demanding the UNC to be transparent, Hammond, Racaniello and others. Ebright goes further: “There is no justification for UNC’s redaction of the names of the laboratory heads and the identities of pathogens. UNC’s redactions violate conditions UNC agreed to in exchange for NIH funding of UNC’s research and, if not corrected, should result in the termination of current NIH funding, and the loss of eligibility for future NIH funding, of UNC’s research.”
Excerpts:
"SARS-CoV-2 could infect researchers, especially inexperienced researchers, with unpredictable and potentially quite dangerous results. The biggest risk is the creation and accidental release of a novel form of SARS-CoV-2 — a variant whose altered characteristics... continues Hammond: “Each additional lab that experiments with CoV-2 amplifies the risk”... They do not provide any details of the fate of the bitten researcher. Nor do they state, for example, whether the researcher developed an active infection, nor whether they developed symptoms, nor if they transmitted the recombinant virus to anyone else. Neither do they reveal what kind of recombinant virus was being used or the purpose of the experiment... "...involved a mouse-adapted SARS-CoV-2 strain used in the development of a mouse model system.” Ralph Baric... UNC media relations also told Independent Science News that: “The researcher did not develop any symptoms and no infection occurred as a result of the incident.” ...the UNC redacted the names of Principal Investigators (PIs) whose research required biosafety scrutiny, along with many of the experimental specifics... (“a full-length infectious clone” refers to a viable DNA copy of the coronavirus, which is ordinarily an RNA virus)... any one of eight sets of different experiments approved by the UNC Chapel Hill IBC in 2020 proposed infecting mice with live infectious and mutant SARS-CoV-2-like coronaviruses under BSL-3 conditions and therefore could have led to the accident ...Hammond. Using FOIA again he has further discovered that researchers at the University of Pittsburgh (whose identity is redacted) plan to make what Hammond calls Corona-thrax... Pittsburgh researchers intend put the spike protein of SARS-CoV-2 (which allows the virus to gain entry into human cells) into Bacillus anthracis which is the causative agent of anthrax (U Pittsburgh Inst Biosafety Committee minutes June 2020)... the Institutional Biosafety Committee of the University of Pittsburgh... (did a) redacting the name of the laboratory from the minutes and also every name of the members of the committee which approved it... (so) who will take responsibility for risky coronavirus research?"
Make your comments there, I did mine, the previous of mine are:
"FOE had hoped to pursue litigation but could not find scientists willing to be expert witnesses. There were too many conflicts of interest. Scientists who strongly favored following the law were almost nonexistent. One of these was the late Marc Lappe, who was physically pushed against a wall by another scientists for questioning the refusal of scientists to accept regulation and follow the law regarding an EIS. / FOE”s president, Dave Brower, was himself besieged by “friends” to drop the lawsuit but refused. In our NY office Francine Simring established the Committee for Responsible Genetics, with globally notable credible scientists such as Erwin Chargaff and many others, urging a slow down in research and a commitment to preparing a comprehensive EIS, etc.
But it was an uphill battle and FOE was not able to raise enough money to continue the lawsuit." Lorna Salzman.
"The social contract that science is supposed to have had with society was dissolved long back." Vivek Cariappa.
Mine, awaiting "moderation" says:
"Dear Jonathan, I reported an artificial artifact in 2003 and was silently fired by my then PI from Hong Kong at the BCM of Houston, TX; then, 5 years later, back to the BCM I developed during 2-3 years a 3-D model of atherosclerosis and its attenuation and my methodology was stolen and reported first by a crooked team of Chinese, Korean and American men, from "The Methodist Hospital" and again from the BCM. To denounce 9/11 I needed to hide my results unseemly within my articles. Now, in reparation, we want to start for free, with a scholarship or with a grant, anywhere in this world, the career of MD or a related MSc in the company of my female study companion, but I found no support by anybody. So, we are in the mean time studying the NMAT to pay some $400.00 each just to have the right to do the test, and then (one of the cheap options that we have found, but we really, rather do it in the currently very beaten, but still the best place on earth, USA!!!), some more than $3,000.00 each per semester during eight semesters... So as Vivek and Lorna before me, we are talking about real life issues here that are going thus far into deaf ears. P.S. Here is my current effort done, as I am fighting for life against the current situation, to counter the deliberate release of COVID-19: 1) My peer-reviewed article that took four months of back and forths until accepted: https://globaljournals.org/GJSFR_Volume20/2-Anticovidian-v-2-COVID-19.pdf, 2) My ongoing discussion aimed at expert researchers: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031 (reaching the 16,000 reads), and brief excerpts of my several interviews where I report the current plots of the heartless globalists (in Spanish): https://www.youtube.com/watch?v=yvUjvukmJ-o, https://www.youtube.com/watch?v=V0g0Z9AGO98, and one of the full episodes: https://www.facebook.com/KardagarCoaching/videos/713879892781432, already reaching the 59,000 viewers. Any advice, help or suggestion will be very well accepted (@@ my paper). For further personal contacting or to answer questions, I can gladly be reached. In Christ, Fernando Castro-Chavez, PhD, Postdoctoral at the BCM and at the NYMC."
Thanks to Lisa K Townsend for the link." Posted at the: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031
Fernando Castro-Chavez posted in FerKat.
My message to Perez (left), the assistant of Luc Montagnier (right), the Nobel Prize of Medicine of 2008: "Dear JCP,
Their response is attached here, but I have not seen them updating it in their two original sources (but I think you can upload the attached one corrected here anywhere you want). Their online sources:
https://globaljournals.org/GJSFR_Volume20/2-Anticovidian-v-2-COVID-19.pdf
And within their current issue:
https://globaljournals.org/GJSFR_Volume20/E-Journal_GJSFR_(I)_Vol_20_Issue_3.pdf
With the best to combat this calamity imposed on us by heartless inhuman monsters,
FCC, PhD.
P.S.
Praying to find an open door anywhere in the planet to study the career of medicine (MD) for free, or an MSc, or even to have a job as a researcher while the girl I like studies medicine or MSc (any advice, recommendation, human link or suggestion helps)."
Their response is attached here, but I have not seen them updating it in their two original sources (but I think you can upload the attached one corrected here anywhere you want). Their online sources:
https://globaljournals.org/GJSFR_Volume20/2-Anticovidian-v-2-COVID-19.pdf
And within their current issue:
https://globaljournals.org/GJSFR_Volume20/E-Journal_GJSFR_(I)_Vol_20_Issue_3.pdf
With the best to combat this calamity imposed on us by heartless inhuman monsters,
FCC, PhD.
P.S.
Praying to find an open door anywhere in the planet to study the career of medicine (MD) for free, or an MSc, or even to have a job as a researcher while the girl I like studies medicine or MSc (any advice, recommendation, human link or suggestion helps)."
Fernando Castro-Chavez posted in FerKat.
My Treasure, I have completed my first set of hormones: "A Catalogue of Human Hormones: Their Sources and Their Functions:
By Fernando Castro-Chavez, PhD
Based on the graphic for the NMAT, Philippines, I allocate the hormones in the next fashion (all the new information added in blue color), here the order is from top to bottom and from left to right:
1) Hypothalamus:
TRH – thyrotrophin-releasing hormone: A small tripeptide (G-H-P-NH2) hormone that stimulates the release of thyroid-stimulating hormone (TSH) and prolactin from the anterior pituitary.
CRH – corticotrophin-releasing hormone: A 41 amino acid hormone stimulating both the synthesis and secretion of adrenocorticotropic hormone (ACTH) by the anterior pituitary gland.
GHRH – growth hormone-releasing hormone (somatocrinin, “somatorelin”, etc.): It is a releasing hormone of growth hormone 44-amino acid peptide hormone produced in the hypothalamus.
Dopamine: It is the "happy hormone" and a neurotransmitter that plays several important roles in the brain and body. It is an organic chemical released when your brain expects a reward.
Somatostatin (GHIH – growth hormone-inhibiting hormone, SST): It is a 15 amino acid peptide hormone regulating the endocrine system, neurotransmission and cell proliferation via interacting with its G protein-coupled receptors, and inhibits insulin and glucagon secretion…
Vasopressin (antidiuretic hormone, arginine vasopressin or argipressin): It is a hormone synthesized as a nonapeptide with an S-S bridge, antidiuretic, vasopressor and glycogenolytic."
By Fernando Castro-Chavez, PhD
Based on the graphic for the NMAT, Philippines, I allocate the hormones in the next fashion (all the new information added in blue color), here the order is from top to bottom and from left to right:
1) Hypothalamus:
TRH – thyrotrophin-releasing hormone: A small tripeptide (G-H-P-NH2) hormone that stimulates the release of thyroid-stimulating hormone (TSH) and prolactin from the anterior pituitary.
CRH – corticotrophin-releasing hormone: A 41 amino acid hormone stimulating both the synthesis and secretion of adrenocorticotropic hormone (ACTH) by the anterior pituitary gland.
GHRH – growth hormone-releasing hormone (somatocrinin, “somatorelin”, etc.): It is a releasing hormone of growth hormone 44-amino acid peptide hormone produced in the hypothalamus.
Dopamine: It is the "happy hormone" and a neurotransmitter that plays several important roles in the brain and body. It is an organic chemical released when your brain expects a reward.
Somatostatin (GHIH – growth hormone-inhibiting hormone, SST): It is a 15 amino acid peptide hormone regulating the endocrine system, neurotransmission and cell proliferation via interacting with its G protein-coupled receptors, and inhibits insulin and glucagon secretion…
Vasopressin (antidiuretic hormone, arginine vasopressin or argipressin): It is a hormone synthesized as a nonapeptide with an S-S bridge, antidiuretic, vasopressor and glycogenolytic."
Fernando Castro-Chavez posted in FerKat.
Thanks to you, heaven, and for your honest questions, today it was the first time in my life that I retained in my head why is it of calling the direction of the replication as going only from 5' to 3', from the point of view of the newly made strands: it is because of the Carbon numbers of the backbone sugars!!! That only can be added starting with their carbon called the "5 prime": 5', and the next sugar can only attach its 5' in the 3' of the previous one as illustrated!!!: |
Thanks to you, heaven, and for your honest questions, today it was the first time in my life that I retained in my head why is it of calling the direction of the replication as going only from 5' to 3', from the point of view of the newly made strands: it is because of the Carbon numbers of the backbone sugars!!! That only can be added starting with their carbon called the "5 prime": 5', and the next sugar can only attach its 5' in the 3' of the previous one as illustrated!!!:
Fernando Castro-Chavez posted in FerKat.
Fernando Castro-Chavez updated his status.
The Heavens Speak, not Spoke, They Speak of the Sovereign Power of God!!! Evil men may attempt as now, it all, but the Body of Christ on earth puts on them a leash (He and It Restrains them of their mad men plans!!!!), as it IS happening today!!!!
Fernando Castro-Chavez posted in FerKat.
Sharing also our common success, to inspire us to always do a better effort: The Article in which I was working during four months that finally appeared published successfully, also thanks to your prayers, is: https://web.archive.org/web/20200811115437/https://globaljournals.org/GJSFR_Volume20/2-Anticovidian-v-2-COVID-19.pdf, praying that it may be able to open the eyes of many. To check its daily impact, the open search link is: https://www.google.com/search?q=%22Anticovidian+v.2%22+%22Fernando+Castro-Chavez%22
Fernando Castro-Chavez posted in FerKat.
Finally, the local director of the School of Medicine responded, it says: "Good morning, right now the access to the University is completely restricted, as soon as the health authorities authorize others to enter, gladly we can program a personal meeting to clarify any doubt and provide information"
Libro de Job ilustrado, y leído por mí: https://youtu.be/uJGa1dGzejw (debe de ser de 2:41:28 y me le corta el principio, no sé por qué):
Updated Aug 10, 2020, 4:45 PM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Aug 9, 2016, 9:40 AM
Amadas Santas y Santos, Ésta es mi lectura del libro de Rut del Hebreo, libro que se leía el día de Pentecostés, dedicada a aquella que será mi mujer, sea quien esta fuere: https://youtu.be/zee-VkOV8_s [Y el que se leía en la Pascua: https://youtu.be/zee-VkOV8_s] En Cristo, Su Fer.
Tal Fidelidad, Añorada y Casi Un Imposible Actual...:
Updated Aug 9, 2020, 10:13 AM
Dedicated to HER:
Updated Aug 9, 2020, 7:54 AM
Again, dedicated to the One that I want to keep on loving by my free will and desire: https://www.youtube.com/watch?v=wcVlavgjGlY
Updated Aug 7, 2020, 8:04 PM
Fernando Castro-Chavez
Current highlights from one of the bold whistleblower nurses from New York, friend @[100051043734270:2048:Nicole Sirotek], who found with many others that in the NY epicenter hospitals they were inflating the numbers of the victims deliberately, killing patients that arrived with no COVID-19, using ventilators and other criminal strategies. For those new to her, I remind you of her landmark video: https://www.youtube.com/watch?v=PuO4d7ZEsO8:
Updated Aug 7, 2020, 7:34 PM
I love this photo of our hard-working friends of the truth, as also is our friend Kent Heckenlively (who injects the humorous notes on it all!!!), here we can see the joyful professional relation of a mentor, Francis W. Ruscetti, PhD, and his outstanding disciple and research associate, Dr. Judy A. Mikovits, PhD. They are bent to publish on the next year the seminal book entitled: "Ending Plague", again with the prestigious, hard fact-checking "Simon & Schuster" brand, so, all that they may had to say about the corruption of Tony Fauci, of Francis S. Collins, of Harold Varmus and of many other Vermins (pun intended), such as Redfield and Birx, but also Gates and the WHO, in a blend of concoctions with the CCP... are absolutely real, solid and fully documented, and such precisely are the felons in charge of our response to the current pre-planned "Plandemic" that has all the planet at stake under the perverted interested of those few pests of humanity!!!: https://www.simonandschuster.com/books/Ending-Plague/Francis-W-Ruscetti/Children-s-Health-Defense/9781510764682 This is what we read of the solid science of Ruscetti, a top-notch scientist, more praised by his human quality than any other self-serving glory-seeking scientist as is/was the very corrupt colleague of, and identical to, Fauci, Robert Gallo, disgraced on his own, by his corrupted being, just a reflection of all the other ones already mentioned, but here we read of an honorable one: "Francis W. Ruscetti, PhD has had a lifelong love affair with scientific discovery and participated in several seminal discoveries. In 1975, while a fellow at University of Pittsburgh, he discovered Interleukin-5. In 1978 at National Cancer Institute (NCI), Dr. Ruscetti's team discovered interleukin 2 (T-Cell Growth factor), for which they won a team award from the Society for Immunotherapy of Cancer. In 1980, the team he directed at the NCI isolated the first known disease-causing human retrovirus, HTLV-1, opening the field of human retrovirology, which would rise to critical importance during the HIV-AIDS epidemic. During the 1980s, his team identified IL-15, an additional immune response regulator. In hematology, his team demonstrated that human cord blood cells proliferate continuously in vitro and TGF Beta functions as a bidirectional regulator of the hematopoietic stem cell. These discoveries have all been the basis for the development of useful therapeutics. / In 2013, the IL-2 manuscript was recognized by the American Association of Immunologists as the second most important paper published in their Journal in the past hundred years. Similarly, the HTLV-1 manuscript was cited as one of the thirty most important papers in the hundred years of the publication in Proceedings of the National Academy of Science. Dr. Ruscetti received the "Distinguished Service Award" from the National Institutes of Health. In order to develop new antiviral drugs, Ruscetti and Dr. Mikovits work on understanding the contribution of inflammatory pathways in disease, specifically how retroviruses dysregulate DNA methylation. In 2009, they identified a new family of retroviruses, the XMRVs from patients with chronic fatigue syndrome (ME/CFS). After thirty-nine years at the National Cancer Institute, Dr. Ruscetti retired in 2014, with more than 325 publications. Since his retirement, he has been consulting with patients and their families, continuing his lifelong effort to understand the process of chronic disease development and develop therapeutic treatment strategies." So, his is solid science impossible to refute by the alluded said corrupted beings, and not even one of them has been really able, in a legal setting, to counter-claim the written statements of these three good luminaries of science!!! No matter how much the planners of the current pest try to silence them, that just increases the desire of the planet to know about the truth!!!
Dedicated to The One I Love, with whom I had sweet and beautiful times in that USA past..., and still... by the magic still of the Internet, by our current times online... one of my dear favorite songs of all times, its video: https://www.youtube.com/watch?v=0P2a6aLDkkM, and live!!!: https://www.youtube.com/watch?v=anDXNlYLW78: "
"Being With You"
Smokey Robinson
I don't care what they think about me and
I don't care what they say
I don't care what they think, if you're leaving
I'm gonna beg you to stay
I don't care if they start to avoid me
I don't care what they do
I don't care about anything else
But being with you, being with you
Honey don't go, don't leave this scene
Be out of the picture and off of the screen
Don't let them say "we told you so"
They tell me you'll love me and then let me go
I've heard the warning voice
From friends and my relations
They tell me all about your heart-break reputation
I don't care what they think about me and
I don't care what they say, no
I don't care what they think, if you're leaving
I'm gonna beg you to stay
I don't care if they start to avoid me
I don't care what they do
I don't care about anything else
But being with you, being with you
People can change, they always do
Haven't they noticed the changes in you?
Or can it be, that like love I am blind?
Do I want it so much 'til it's all in my mind?
One thing I know for sure
Is really really real
I never felt before the way you make me feel
I don't care what they think about me and
I don't care what they say
I don't care what they think, if you're leaving
I'm gonna beg you to stay
I don't care if they start to avoid me
I don't care what they do
I don't care about anything else
But being with you, being with you
Being with you
Being with you
I don't care about anything else
But being with you, being with you
I wanna be with you
I don't care if they start to avoid me..."
"Being With You"
Smokey Robinson
I don't care what they think about me and
I don't care what they say
I don't care what they think, if you're leaving
I'm gonna beg you to stay
I don't care if they start to avoid me
I don't care what they do
I don't care about anything else
But being with you, being with you
Honey don't go, don't leave this scene
Be out of the picture and off of the screen
Don't let them say "we told you so"
They tell me you'll love me and then let me go
I've heard the warning voice
From friends and my relations
They tell me all about your heart-break reputation
I don't care what they think about me and
I don't care what they say, no
I don't care what they think, if you're leaving
I'm gonna beg you to stay
I don't care if they start to avoid me
I don't care what they do
I don't care about anything else
But being with you, being with you
People can change, they always do
Haven't they noticed the changes in you?
Or can it be, that like love I am blind?
Do I want it so much 'til it's all in my mind?
One thing I know for sure
Is really really real
I never felt before the way you make me feel
I don't care what they think about me and
I don't care what they say
I don't care what they think, if you're leaving
I'm gonna beg you to stay
I don't care if they start to avoid me
I don't care what they do
I don't care about anything else
But being with you, being with you
Being with you
Being with you
I don't care about anything else
But being with you, being with you
I wanna be with you
I don't care if they start to avoid me..."
Updated Aug 6, 2020, 4:31 PM
Un libro revolucionario de la medicina y nutrición: "La Dieta del ADN", por mi ex-alumno Stefano Macedo Reyes: https://www.youtube.com/watch?v=JIcTUB7Dxtw, https://www.amazon.es/Dieta-del-ADN-Aprende-Hackear-ebook/dp/B07ZPTF3PW (abreviado: https://bit.ly/LaDietadelADN), https://www.centrogenica.com/
What I responded to the intelligent Dr. Pascal, one of the 15,577 researchers and MDs that have seen my ongoing research on the artificiality of the current and wretched calamity (his question as an image, in order to prevent the stupid "AI" robots by the obtuse maker of Windows and collaborators, to also maliciously remove this posting, use yourself every single strategy that occurs to you, that is inspired by God, to tackle and defeat the current "Plandemic" and to their "engineers"): "Dr. Pascal, Yes, it is very clear that there are inserts in the genome of Sars-CoV-2, cause of COVID-19, at least six independent groups have confirmed these HIV inserts, and the number keeps on growing daily, this is my current documentation of some 22 of them, but there are more. For you to be fully confident on this, you can see, both the advance that I have integrated about this: https://osf.io/ugpkj/?view_only=65022277577644869f605d0ee12e8ae5, also in here: https://tinyurl.com/Anticovidian2, as well as the work of Perez and Nobel Prize Montagnier, with whom we interacted to verify the results: https://www.granthaalayahpublication.org/journals/index.php/granthaalayah/article/view/IJRG20_B07_3568/691?fbclid=IwAR0evsIgntbVPA7okBeSz7BCRAk0kZrOWybJYowGDeuFlb2O1Y5Iz-sDHlk, you can do a verification of the longest of these inserts: ACTGTTGGTCAACAAGACGGCAGTGAGGACAATCAGACAACTACTATTCAAACAATTGTT, (in Nsp3, found by Arumugham) using: https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Nucleotides, with my best regards to those doctors in the middle of this diabolical and preplanned Pandemic by the likes of WHO, CCP, Fauci, Gates, etc..., with my best, Fernando Castro-Chavez."
Fernando Castro-Chavez updated his status.
Fernando's most loved photo on Facebook of 2017
Bending my knees only to God and to His Original (not adulterated by any, so-called "Christian" sect or religion), and to His Current Direct Revelation to those that are His own, to us, as to bless them and to protect them every single day!!! Thank You God for Your Personal Guidance!!!
Her Mentor Frank Ruscetti (the real force behind the "discoveries" of Robert Gallo, a real corrupt plague akin and protégé of the other most depraved of a current infamous memory, Tony Fauci) finally joins his collaborator Mikovits and the most fun writer, our good and admired friend, @[100001604190174:2048:Kent Heckenlively]!!! As per its info: https://archive.vn/t4bSQ, "From the authors of the New York Times bestselling Plague of Corruption comes the prescription on how to end the plague infecting our medical community.
Ending Plague continues the New York Times bestselling team of Dr. Judy A. Mikovits and Kent Heckenlively with legendary scientist, Dr. Francis W. Ruscetti joining the conversation. Dr. Ruscetti is credited as one of the founding fathers of human retrovirology. In 1980, Dr. Ruscetti’s team isolated the first pathogenic human retrovirus, HTLV-1. Ruscetti would eventually go on to work for thirty-eight years at the National Cancer Institute.
Dr. Ruscetti was deeply involved in performing some of the most critical HIV-AIDS research in the 1980s, pioneered discoveries in understanding the workings of the human immune system in the 1990s, isolating a new family of mouse leukemia viruses linked to chronic diseases in 2009, and offers his insights into the recent COVID-19 pandemic. In 1991, Ruscetti received the Distinguished Service Award from the National Institutes of Health.
Dr. Ruscetti offers a true insider’s portrait of nearly four decades at the center of public health. His insights into the successes and failures of government science will be eye-opening to the general public. You will read never-before-revealed information about the personalities and arguments which have been kept from view behind the iron curtain of public health. Can we say our scientists are protecting us, or is another agenda at work? For most of his decades at the National Cancer Institute, Dr. Ruscetti has been in almost daily contact with his long-time collaborator, Dr. Mikovits, and their rich intellectual discussions will greatly add to our national discussion. Science involves a rigorous search for truth, and you will come to understand how science scholars are relentless in their quest for answers."
Ending Plague continues the New York Times bestselling team of Dr. Judy A. Mikovits and Kent Heckenlively with legendary scientist, Dr. Francis W. Ruscetti joining the conversation. Dr. Ruscetti is credited as one of the founding fathers of human retrovirology. In 1980, Dr. Ruscetti’s team isolated the first pathogenic human retrovirus, HTLV-1. Ruscetti would eventually go on to work for thirty-eight years at the National Cancer Institute.
Dr. Ruscetti was deeply involved in performing some of the most critical HIV-AIDS research in the 1980s, pioneered discoveries in understanding the workings of the human immune system in the 1990s, isolating a new family of mouse leukemia viruses linked to chronic diseases in 2009, and offers his insights into the recent COVID-19 pandemic. In 1991, Ruscetti received the Distinguished Service Award from the National Institutes of Health.
Dr. Ruscetti offers a true insider’s portrait of nearly four decades at the center of public health. His insights into the successes and failures of government science will be eye-opening to the general public. You will read never-before-revealed information about the personalities and arguments which have been kept from view behind the iron curtain of public health. Can we say our scientists are protecting us, or is another agenda at work? For most of his decades at the National Cancer Institute, Dr. Ruscetti has been in almost daily contact with his long-time collaborator, Dr. Mikovits, and their rich intellectual discussions will greatly add to our national discussion. Science involves a rigorous search for truth, and you will come to understand how science scholars are relentless in their quest for answers."
Updated Aug 4, 2020, 11:10 PM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Aug 2, 2015, 8:49 AM
I talked with my lovely wife and we decided that today Sunday, at 4:00 PM I'll be re-transmitting live the same presentation from yesterday related to the Angels Below and the Neanderthal. Yesterday the audio did not work for the recorded version of it so, if you are around and can be here, please come: https://www.youtube.com/channel/UCGgi7H6CT_ALYhT4jHRu_8w In the image, the first research that showed that the Neanderthal were not human, and the six early places in Israel where their bones have been found, just as the Bible said!
Neanderthal, half human half chimpanzee, RNA vaccines today, attempting Gates, Fauci, WHO, CCP, CDC..., to scramble the human genomes to produce monsters again (in the next generation), and for them, to "learn" as they go about how to keep on tampering with the human software which are the genes:
Updated Aug 2, 2020, 12:31 PM
I am thankful with @[1265686482:2048:Jean-claude Perez] and with Nobel Prize winner Luc Montagnier for the honor to be mentioned, both as reference and in the acknowledgements, in their current ground breaking work on the artificial origin of COVID-19 and most of its lab insertions from the HIV (you do not hear about this in the corrupted with blood money Mainstream Media), thank you!!!:
Updated Aug 2, 2020, 6:25 AM
Updated Aug 2, 2020, 12:24 AM
“Some 20000 protesters” have rallied in Berlin to protest against measures imposed by German officials as part of their coronavirus response, saying they violated people’s rights and freedoms: ttps://thehighwire.com/thousands-protest-in-berlin-against-coronavirus-restrictions/
Updated Aug 1, 2020, 2:28 PM
Two great professional news, the article of my French friends has been accepted, to be put here below once it is out. They blessed me by making reference to my own ongoing work, but because it has reached already 60 pages, I think that is good to stop it here, where at least the basic science of it is there, even if a lot of information was not included, especially regarding the planning, the motives and the opportunity to release COVID-19 by the sinister powers of this world, already known by everybody (CCP, WHO, Gates, Fauci, NIAID, EcoHealth Alliance, CDC, HHS, FDA...): https://osf.io/ugpkj/?view_only=65022277577644869f605d0ee12e8ae5
Updated Jul 31, 2020, 7:38 PM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Jul 31, 2015, 8:08 PM
The Angels Below,part 2 will be dealing with the Neanderthal according to the Bible, Saturday at 6:00 PM (pending to re-recording the presentation due to high static): https://www.youtube.com/channel/UCGgi7H6CT_ALYhT4jHRu_8w/videos The cover shows in the left side a Neanderthal skull and thicker bones compared with a Human skull and bones in the right side. The set of slides of the presentation, for you to do a detailed study of the corresponding Scriptures can be seen at: http://fdocc.ucoz.com/2/2SpiritsPrison_2_2015.pdf God bless you in Christ!
Genetic aberrations from the past due to perverted brains... similar perverted brains are currently in action preparing their RNA-vaccines to scramble the human genetics, in order to bring back those monsters... plus their tech "upgrade" of branding all digitally, so say NO to the globalist plans of Gates. Fauci, WHO, CCP, etc...
Updated Jul 31, 2020, 2:39 PM
The only amazing program of the many by Del Bigtree at the suppressed (by YT, FB, TW) The Highwire that I was able to save: https://lbry.tv/@fdocc:b/UNDERCOVER-NURSE-EXPOSES-COVID-CATASTROPHE:c
Updated Jul 30, 2020, 8:51 PM
Michele Malkin interviews Del Bigtree about the criminal repression of truth of the current times, how YT and FB and Twitter at the same time removed his great interviews:
Updated Jul 30, 2020, 8:12 PM
Fernando Castro-Chavez shared a memory.
3 Years Ago
Jul 30, 2018, 1:46 PM
Comenzando mi próxima lectura de la maravillosa y majestuosa Biblia, me encuentro con la palabra "automate", que llegó a nosotros como "automatos", "autómata", "automáticamente" y todo lo que tiene movimiento autónomo, dice el verso en cuestión: "...llegaron a la puerta la de hierro, la que lleva a la ciudad, la cual automáticamente se les abrió..." Hch. 12:10b; nosotros que nos consideramos tan tecnológicamente avanzados, vemos que hay un poder espiritual sobrenatural capaz de controlar por completo a la materia, aquí hablando de cuando el ángel libertó a Pedro de la cárcel, ¡justo cuando estaba a punto de ser decapitado! Y esto debido a las fervientes oraciones de los creyentes que moraban en Jerusalén, reunidos en casa del futuro Evangelista Marcos.
"Automate": Automáticamente, por un milagro de Dios. Así también ahora!!!
Updated Jul 30, 2020, 9:08 AM
One more time giving my recognition to the bold PhD who spoke, and who now is the most banned person on the face of the earth!!!: Judy Mikovits, co-author with our friend @[100001604190174:2048:Kent Heckenlively] of two amazing books regarding the pernicious "Plague" of Fauci and Gates plus friends (Birx, Redfield, Collins, etc.), that currently has at stake the whole humanity!!! (This is the second Podcast interview that Mike Moore, from Thomas Paine did to her, and very soon, if not already, her "Plandemic TWO" is going to be released as well as her book against the criminal "Protocols" aimed at shepplize humanity and for the destruction of the economies of the world, plus the elimination of the religious gatherings!!!, imposed in the whole planted by the WHO subservient to the CCP!!!): https://lbry.tv/@fdocc:b/Mikovits3:d, my previous two were, also there: https://lbry.tv/@fdocc:b/MikovitsAlmost-10_09_55-BIG:5, https://lbry.tv/@fdocc:b/MikovitsPaineMooreP2:1; and for researchers, the slow motion of the HOLOGRAMS that duped humanity on 9/11, as today the Preplanned COVID-19 is doing against the human freedom, as those PNAC / WHO organizers, respectively, are rather "inhuman" than human: https://lbry.tv/@fdocc:b/53HologramsOrCGIEnhancedFlight175HIttingWTCThereWereNoRealPlanes!:9, here Robert F. Kennedy Jr. denounces the hidden plan of Gates behind his "calculated" release of Sars-CoV-2: https://lbry.tv/@fdocc:b/COVID-19-Is-Gates-To-Implant-Humans:d, and then, the depravity of Joe Biden (the worst possible Democrat candidate), also member of the criminal PNAC: https://lbry.tv/@fdocc:b/DepravateJoeBiden:c, and further evidence of the strategies used to demolish those Twin Towers on 9/11, like nano-atomics and Directed Energy (Laser) Weapons, amongst others: https://lbry.tv/@fdocc:b/AceBakerFinalVersionPart2:4, and the CGI strategy used to cover the imperfect holograms that missed wings and are registered as such on film, plus their disappearance of the holographic planes like ghosts into the WTC towers: https://lbry.tv/@fdocc:b/AceBakerFinalVersionPart1:4; my videos have been removed by the heartless communist dupes at YouTube... hopefully here this post will last, as Trump requested leniency with our critical research, something VITAL in a Still, just or a hair of a distance, FREE society!!!!...
Updated Jul 29, 2020, 9:19 PM
Fernando Castro-Chavez shared a memory.
2 Years Ago
Fernando Castro-Chavez added a new photo.
Aug 18, 2019, 11:17 PM
The sunrise, and on the road again!!! https://www.youtube.com/watch?v=MWMnU2UWjLs
Place: Ajijic, Jalisco, Mexico (20.3, -103.283)
Address: Ajijic, Jalisco, Mexico
Creations of God, the sun emerges always after darkness!!! Light always wins!!! Especially when we, the children of God are still here stomping on the Devil's head!!!
Updated Jul 29, 2020, 11:58 AM
Singing her favorite song, angelical!!: https://www.youtube.com/watch?v=cG7HAq_ExFI
Updated Jul 27, 2020, 10:33 PM
7 Minutes of Reasons why the Vaccines for COVID-19 Being Currently Made by Oxford and by Fauci are Completely Useless: They are rigged, unethical, unhealthy, fully conflicted and very dangerous!!!, says Robert F. Kennedy Jr. to Dershowitz, the now 82 year old one who took O. J. Simpson to trial, and to bold interviewer Patrick Bet-David, who is doing what the wharlok whores of the Mainstream Media keep avoiding!!! (The whole debate is worth watching, to be informed: https://www.youtube.com/watch?v=IfnJi7yLKgE): |
7 Minutes of Reasons why the Vaccines for COVID-19 Being Currently Made by Oxford and by Fauci are Completely Useless: They are rigged, unethical, unhealthy, fully conflicted and very dangerous!!!, says Robert F. Kennedy Jr. to Dershowitz, the now 82 year old one who took O. J. Simpson to trial, and to bold interviewer Patrick Bet-David, who is doing what the wharlok whores of the Mainstream Media keep avoiding!!! (The whole debate is worth watching, to be informed: https://www.youtube.com/watch?v=IfnJi7yLKgE):
I never send unrequested "funny" videos or photos of any sort with anybody, I never recommend either any pharmaceutical or "vaccine"; so, hackers do!!!, beware and discern in these perilous times those horrible impersonators that are taking even the "identities" of the "beloved" ones:
Fernando Castro-Chavez shared a memory.
3 Years Ago
Jul 27, 2018, 9:46 PM
Tengo gran gozo de presentarles mi estudio del griego de Filemón: https://youtu.be/YK5Z8gXqXSw, que consiste en tan sólo 25 versículos que tratan de manera práctica del amor (Agape) cristiano: Pablo ruega el buen trato para un esclavo: Onésimo (Provechoso), que huyó de Filemón (Lleno de Fileo), su dueño, y que se hizo cristiano en Roma, el cual ahora desea regresar a servir de corazón. El trato como hermanos entre el más alto y el más bajo estrato de la sociedad romana era y es algo totalmente revolucionario, sobrenatural y contrario a la condición natural humana tendiente al egoísmo!
...And those that trust in the Lord will renew their strength like the eagles, and I do not know how, but God does, and that is good, they also will have more vigor than the unbelieving youngsters, those that will faint and that even will fall...!!!
Updated Jul 27, 2020, 8:57 AM
Updated Jul 26, 2020, 10:42 AM
Hurricane Hanna in Southern Texas, USA
Pray for the saints all over the globe and their tribulations, that are diverse!!!
Updated Jul 26, 2020, 9:04 AM
Fernando Castro-Chavez shared a memory.
3 Years Ago
Jul 26, 2018, 7:24 PM
Here, we have an additional and miscellaneous blend of these three intense dream-days of vacations through Zapotlan el Grande, Jal., MX, with an audio of David Garrett, other of the "virtuoso" favorites of my sister: I hope you like it!: https://www.youtube.com/watch?v=SZ-lhLOpnpo
Past amazing!!! Past meets the Present , and basically it says that somehow it needs to be established that COVID-19 is an artificial crisis, if not, they just will continue doing perverted and mad, Gates style, "Pandemics" at their will!!!
Updated Jul 26, 2020, 9:02 AM
COVID-19 has been inflated to Category 2 of 5 in order to ruin the economy of the nations, shame on the corrupt world medical agencies and on its agents, starting from WHO, NIH, NIAID, CDC, FDA...!!!, they are responsible, by cow-towing to Gates, of the current crisis in every single aspect: Morally, Financially, Socially, Medically...: https://www.youtube.com/watch?v=t6OhiNJYQ7k
Updated Jul 25, 2020, 2:26 PM
Fernando Castro-Chavez shared a memory.
Times of a Lonely (almost), complete freedom!!! Fighting to have it back with no "vaccinations" and other evils at the airport!
Updated Jul 25, 2020, 8:45 AM
Fernando Castro-Chavez updated his status.
One More Bold Doctor From Germany Exposes The Situation!!!: https://www.facebook.com/LuzHbg/videos/10157739631672880, thanks to biol. Alberto Rubio Casillas
Fernando Castro-Chavez shared a memory.
Fernando Castro-Chavez updated his status.
The Debate of the Times: https://www.youtube.com/watch?v=IfnJi7yLKgE, https://www.instagram.com/p/CC9YfmKHXys/?igshid=r1whq6esxr46
Every single day there are more and more voices of scientists that denounce the artificiality of COVID-19, but they have no coverage in the mainstream media, whose purpose is to scare humanity, and valuable information needs to be found in the alternative media, claiming that the Sars-CoV-2 is completely an artifact designed to strongly hit human beings by design (the WHO had plans for the current "Plandemic", to be even more disgustingly invasive in the airports, with a mandate to vaccinate in order to travel, and every sort of "human groping" with a "medical" pretext, since 2005!!!): Stuart Newman, from the NYMC at Valhalla, NY, and Andre Leu, Director of "Regeneration International" join their voices to Jonathan Latham, leader of the "Bioscience Resource Project" to denounce the current crimes against humanity with the pretext of a pre-planned Pandemia to steal the rights of humans, starting again at the Airports and everywhere!!!: "It's been a coverup from day one, and we're unraveling it..."!!! Andre Leu.
https://www.organicconsumers.org/blog/more-pandemics-our-future-unless-we-shut-down-gain-function-research-an-interview-andre-leu
1
"How do we know? We knew right from the beginning, China's working with the World Health Organization on this cover-up. They [the Chinese government] first admitted that there were a few cases of this new pneumonia. But they said it came from the seafood market, and that there was no evidence that it could be transmitted between humans, because it went directly from animals to humans. So, no need to worry about it. At the same time [the Chinese government] was saying that, and the World Health Organization was parroting China's claims, China was jailing the doctors who were reporting on this new pneumonia. We know one of those doctors died, in the end, a month later. He's a hero in China, and should be hero for the rest of us because he went out of his way, he was jailed for telling the truth. So, that's the first coverup."
2
"We know that they covered up the first laboratory, this is on January the 11, that released the genome of this virus. Because before that they would not release the information on this virus to any other scientists in the world. Then a laboratory in Shanghai published the genetics of it so other scientists could study it. They closed that laboratory down the next day, on January 12, and silenced the scientists."
3
"We know in early February, a paper came out from two eminent scientists in China showing there were zero bats in the Huanan seafood market, and that the likely cause of this epidemic was a release from one of the two laboratories that were doing this research in Wuhan. Not just one, it's two doing this research. Then that paper got pulled, and the Chinese put pressure on all the academic sites that posted it. It's no longer online, but fortunately we have copies of it and we've kept it, as have other people. But those scientists have disappeared. Any scientist that's come out to try and tell the truth has disappeared or been silenced."
4
"We can see the cover-up is still happening. They've closed down the Wuhan Institute of Virology. They will not allow any independent scientists in. The lab has been taken over by the military now. And also in China, any publication, anything said about this virus, has to go through their propaganda unit in Beijing."
5
"So, everything coming out of China now is pure propaganda, including any so-called "scientific study." It's officially edited and approved by the propaganda unit from Beijing. So, this is a grand-scale cover-up."
6
"And then the other evidence is, that when my country [Australia] proposed an independent investigation into the [origins of] the pandemic, [China] stopped all our imports of barley and meat, and starting putting trade pressure on us."
"...the majority of countries in the world have agreed to an independent investigation into the source and cause of this [pandemic], and the cover-up... What we're seeing is a lack of transparency and scientific transparency. We need openness. We need the real facts published. We don't need the media suppressing things. It's what's happening. The whole issue of Gain-of-Function, you will not see it in any mainstream media. And yet Gain-of-Function research is one of the biggest threats we face. Gain-of-Function research is the cause of this pandemic, and will be the cause of future and even worse pandemics unless we put a stop to it. And I think we need a global campaign to end this type of genetic engineering. This is a disaster. It has been predicted for a long time. Now it's happening and we're in the middle of it, and we need to make sure it never ever happens again."
"Why this matters is because this is probably the greatest disaster that the world has ever seen... here are millions of people now who are hungry because of all the economic shutdowns and people who will be dying of starvation. How many people do we know that their careers and jobs have stopped, they've lost their businesses?"
"This is an A-Grade disaster, and we need to know why it happened so that we can prevent this ever happening again. This is critical, so to do that we actually need to get the evidence and find out the science and the real data, not what the mainstream media is peddling. Let's look at actual evidence. So, that's what myself and others have been doing, we've been combing through documents and documents and documents. This is like putting a giant jigsaw puzzle together."
"There's a very good paper that the Chinese government suppressed that showed that there were zero bats sold in this market. By the way, this is a seafood market. They are really sort of, how can I say, inventing, fabricating that this is a wild animal market. It was not. Now, maybe there were some wild animals sold there. But there is zero evidence that any of those wild animals had the virus that causes COVID-19. On the other hand, where we do have evidence of the closest virus to the one that causes COVID-19, this is found in a bat in Yunnan, which is about 1000 miles away from Wuhan. It was found by researchers at the Wuhan Institute of Virology in 2013. In February [2020], they released the paper showing that this virus [found by the researchers in 2013] is about 96 - 96.2 percent the same as the virus that causes COVID-19. And they're trying to say that this is the one that has mutated. Other papers will show that that mutation will take about between 80 - 90 years to happen. That's nonsense to say that the closest virus has mutated naturally. There is zero evidence of that."
"The other [virus] that they started talking about was from pangolins, because they found some similar viruses in pangolins, and most of those were between 80 - 90 percent similar to COVID-19. Once again, we're talking about 100 years or more of mutations, natural mutations, for them to be the same as the virus that causes COVID-19. However, one of these pangolin viruses had a section of it that was identical to the spike protein on the virus that causes COVID-19. This is missing from the bat virus [found to be similar] to COVID-19. This spike protein is very important. People can imagine in their mind the coronavirus, and you see it's got little spikes on it, you know that's why they call it corona, those spikes are what attach to our cells in our bodies and then allow the virus to invade [human cells]. The spike protein is sort of like a lock and key system. You've got to have the right spike protein to get into a cell. And they found this unique spike protein in a pangolin. So then they said, oh look the pangolin is the cause. But the rest of it is completely different from the COVID-19 virus... But this recombination could not have happened naturally. Because the closest bat virus is very rare, it's only found in a couple of bats in a mineshaft a thousand miles away from Wuhan. And then the pangolin virus are from Malayan pangolins, which were confiscated by the border police, the customs, and were probably collected thousands of miles away from China. And there is no way that this virus, these two viruses, could have recombined, given that the two host animals were probably more than 1000 miles apart from each other. It's just scientific nonsense. There is zero evidence, zero scientific evidence to show that these two viruses recombined naturally."
"I want to explain what Gain-of-Function research is. This is where researchers will artificially modify diseases, all sorts of diseases, and make them more dangerous. So, for instance, most of these coronaviruses in bats and pangolins and mice will not infect people because their spike proteins are the wrong style or shape to infect people. So what a lot of researchers, and this includes researchers at the Wuhan Institute of Virology, have been doing is inserting spike proteins into these harmless viruses. This makes them more dangerous now because these new spike proteins are the type of spike protein to allow the virus to infect people. And we have the papers. They've been doing this research since 2007. Two particular scientific papers, one in 2015, and an even more important paper 2017, show how they did it. In 2017, they got eight harmless bat viruses and inserted new spike proteins into them, so they now had the ability to infect people. It's in black and white. They published it. This is what they do, they take harmless bat viruses, and they put new spike proteins on them. So now people can get infected by these viruses. The viruses go from harmless to being deadly."
"...in 2014, Gain-of-Function research was banned in the United States after several hundred scientists wrote to the Obama government saying this research is too dangerous. We just need one of these organisms, manmade organisms, to escape and we'll have a global pandemic. So, it was banned, but it was reinstated in 2017. And while it was banned there's various organizations in the United States, in Europe and also in my country, Australia, that were funding the Wuhan Institute of Virology to do this banned research. So, it's been going on. And it's not just the Chinese government. Most of our governments are complicit in this."
"And while they're saying we need to do it to understand these viruses, so we can get cures..., there's been 30 years of this type of research, and about all that's come out of it is bioweapons. There is zero evidence of any value that's come from this research. And look at the pandemic we have now. Where are all the benefits of 30 years of Gain-of-Function research to give us the cures and "vaccines" (my quote marks as in ridicule)? They are not there. Everybody is scrambling and panicking to try and develop something. But we've got a pandemic, and we're completely unprepared for it because we've got zero ways to treat it or prevent it. So Gain-of-Function research has had no upsides and has every sort of downside we can imagine."
"...we have good evidence now that that lab had poor biosecurity. There's a very good article in the Washington Post that reported on the cable from intelligence sources that went to the lab. They reported that this lab was essentially a pandemic waiting to happen. They said exactly that, that one of these organisms gets out and we will have a global coronavirus pandemic. They reported that. They explained how the staff was under-skilled, undertrained and they didn't have enough adequately trained skilled staff to run a BSL-4 laboratory, which is the highest security. And there are heaps of evidence all around the world of these organisms escaping out of laboratories, in virtually every country. There’s a very good paper published in Science, which is a high-level scientific journal, documenting numerous examples of these deadly organisms that have escaped, and essentially saying it's just been luck that we haven't had a deadly pandemic from one of these escapes."
"...if you look at who are the people who are saying this is natural, we're looking at the military, were looking at various government-funded research organizations—people or organizations who are actually involved in this Gain-of-Function research. They know if the truth came out, there'd be such public anger that this research would be stopped. And so it should be. I think one of the really important things that needs to come out of this, is that we need Gain-of-Function research stopped. This genetic modification of these viruses is wrong. It's creating new deadly organisms that have zero benefit. The only thing they're designed to do is kill people. And it not only is a waste of billions of dollars over the years, which could be used on much better things, it's now created the worst pandemic in our history. We need to prevent it ever happening again. Because believe me, we know there are far worse organisms sitting in these laboratories. If one of those escapes, it's going to make this COVID-19 look like a picnic."
"What we're uncovering at the moment will clearly provide even more evidence about the day the accident happened... I'll be very happy to come back and go into more detail about what happened, when it happened, and who did it."
/////////////////////////////////////////////////////
"It was Anthony Fauci’s institute that issued these grants and rescinded the ban, so he kind of has an interest in minimizing the possibility that this is a gain-of-function experiment." Stewart Newman.
https://www.organicconsumers.org/blog/why-gain-function-research-should-be-banned-author-biotech-juggernaut-speaks-out-covid-19
"...the most suspicious looking thing is the fact that the virus was first identified in Wuhan, China, and that is the site of the only what's called a BSL-4, that’s a biological safety lab, in China. There’s also a BSL-3 lab, and research on bat viruses goes on in these laboratories... viruses of this sort were researched in the lab, and not only by Chinese scientists but also in collaboration with scientists around the world including in the United States.
...after it was sequenced was found to have some features that resembled earlier coronaviruses, things that were being worked on in the lab. But they also had some hallmarks of other kinds of mixtures. A chimera is something that's a mixture of several different types of viruses... This virus is chimeric, it has bits and pieces that look like it originated from viruses in not only bats, but possibly pangolins and other organisms that it might have passed through... It has hallmarks of possibly having originated by manipulation, by being in different kinds of animals. The proximity to the lab is suspicious. So people have started to ask; “Could it have been partly a product of lab manipulation?”
These things can be partly genetically engineered, and they could have genetic engineering in their lineage, in their history...
The spike protein of this virus has a number of hallmarks that are very unusual. So it's very well suited to binding to something on human cells called the ACE2 receptor. That's called a receptor binding domain and the receptor binding domain is unusually avid for the human ACE2 receptor. And then it has something else which is called a furin cleavage site. It's a weak point in the spike protein that makes it very flexible, so the way that you assay for that weak point is you use an enzyme called furin and that will cut it. Almost no viruses in this category have that binding site, because that enzyme cleavage site, it's something that the enzyme cuts and it's the weak point. There are papers that show that genetic engineers working on viruses have introduced that by genetic engineering into other coronaviruses, just as an experiment. So people do these things...
There are papers in which scientists have introduced this cleavage site, it's a sequence of amino acids. They've introduced it through genetic engineering in viruses that don't normally have it, and it becomes much more dangerous when they do that. And this virus, very unusually, this coronavirus has that site in it, and nobody knows how it got in there. So that is kind of another suspicious aspect. So it could have been that some experiment introduced it to a virus, the virus left the lab...
...when I read that paper (the Anderson et al., 2020 "hit-opinion-piece") it raised some red flags for me, because the people who wrote that paper made a very strong assertion about it being very unlikely to have originated in a lab. And what were the arguments they used? First they said it has a very avid receptor-binding domain, but it's not an ideal one. If scientists had designed it they would have designed it differently. / Well, that was kind of ridiculous to me because there are papers going back 20 years that say that this domain is something that is very important to look at... So the fact that this is not what other scientists have found to be ideal, by computer programs, doesn't mean that this wasn't manipulated. And they didn't refer to those papers that talked about modifying those domains. I was surprised by that.
Then they [the authors] point out that the furin cleavage site is part of the spike protein, and they said this is not part of any other viruses like this. Well, that wasn't a good argument either, because they do refer to a paper where it [the cleavage site] was inserted by genetic engineers... the fact that it didn't use the standard backbone is not at all a good argument... the conclusions that they draw from it are very speculative and really raise red flags.
...I think that the honest conclusion is that there's a lot of uncertainty and a number of red flags. The red flags are that it was identified in Wuhan—which was a place where they were working on this kind of virus—and that things like this have been genetically engineered in the literature... there was a lot of controversy going back around 2010, 2012 about what are called gain-of-function experiments. Where you take a virus and you try to add factors to its sequence to possibly make it more dangerous.
In December of 2017, they rescinded the ban, and said that as of 2018 they would begin to issue grants for gain-of-function experiments. Now here we are a year-and-a-half after that and we have something that looks like a gain-of-function. So I think that it was certainly research going on in the U.S. and in collaboration with China that was doing gain-of-function experiments...
...I think that one thing that we found (the ongoing cover-up of COVID-19 by Fauci, WHO, Collins, Gates, Daszak, etc.) —and this is actually a theme of the book, “Biotech Juggernaut,” that I wrote with historian Tina Stevens... we found that very unconvincing... scientists that are backed by corporations, by patents, by business interests—have a strong stake in doing these things, trying them out even though they might have adverse effects... these are very complex systems, and if you put something simple into a complex system that wasn't there before... you can get all sorts of poisons being unleashed that weren't there before but are induced by the new engineered form... this virus killed every mouse that it encountered, it became absolutely lethal for all mice... They had no idea that was going to happen, they put a known gene into a known virus and they got something completely unexpected... it was just too dangerous to try. And this is where we may have messed up ...it's as plausible to me as any other thing I've seen... I would be an advocate for banning gain-of-function experiments. And it's a little bit ambiguous because as I said, we don't know what a gene is going to do when it's in a new context... we have to maybe increase containment when we're working with things like coronaviruses and other kinds of viruses that have caused problems in the past.
...I think it's more likely to have originated in a lab... somebody touched something, and walked out with it on part of their skin... Or it might have been an animal that somehow got discarded incorrectly or something like that. A leak could take many different forms. But I think that the fact that there was this high containment research going on in the same city is very suspicious to me.
...there's a case where you're not using a standard isolate, you're not using a standard backbone, you're using things from the wild, from patients. There’s a fair amount of virus research that goes on that way also, just isolates from animals and isolates from patients. So this idea (the absurd idea of Andersen et al., 2020, that because it was not from a kit, it was not engineered!!! C-mon!) about starting with one backbone and modifying it just doesn't happen typically.
...if it seems to have something new, then it kind of spreads virally itself. You know on Twitter and on social media. As a scientist I look at Twitter to find out what other scientists are talking about, even before they publish papers on it... something came out in Science magazine just this week saying that this particular coronavirus has a lot of sites on it’s spike protein that have numerous glycans, sugar groups attached to them. And these sugar groups both help it to bind to the human cells, but also protect the virus from being seen by the immune system. So it's kind of like a perfect storm... much worse, it’s more protected and more avid."
/////////////////////////////////////////////////////
"Eco Health Alliance (of Peter Daszak), who have been in the news plenty recently, was apparently using U.S. taxpayer funds to fund the Wuhan lab as an end-run around the ban." Jonathan Latham.
https://www.organicconsumers.org/blog/are-we-creating-pandemic-viruses-simply-generate-research-funds-interview-dr-jonathan-latham
"The ban has now been reversed by the Trump administration. That's what looks like happened, because the grant clearly lays open the possibility of doing gain-of-function type research, and mixing and matching potential pandemic pathogenic viruses."
"He has quite a record, Tony Fauci (with 35 years in power!). I wish the media was slightly more skeptical of his credentials. He's been involved in a whole series of questionable events, and what it comes down to for me is, you've got these people running the research situation in the U.S., they have been in power for a long time. Francis Collins is the head of the National Institutes of Health, he's been there for 20 years. These are basically like dictators. It used to be the case that these research heads would come and go in a three, or four, or five year period... What was once a democracy, what was once controlled democratically, and what was a research-led project is becoming more of a corrupt kind of corporate led, in-group cabal of interests, that are running a U.S. research agenda. They have nothing to do with the public interest, and nothing to do with health."
"The NIH has given about $15 million to an organization called the Eco Health Alliance, and the head of that is Peter Daszak. They have used that money for funding biology research in other countries, developing countries for the most part. They've been dispensing that money to do the kind of research that many people find problematic—collecting viruses and doing experiments on them in the lab, as a way of claiming to be estimating pandemic risks... they were the funders of the grant for gain-of-function type research at the Wuhan lab, that started in 2014. If this really was an end run around the ban on gain-of-function research, they were the conduit. They've been basically using U.S. taxpayer money to fund this research abroad... There's a complicated situation here. If you look at their supporters, if you look at their funders—the funds mostly are public money—but if you look at their supporters, if you look at their policy advisers, you come up with a very interesting list of people."
"Firstly, the policy advisors are people like the Gates Foundation, the World Health Organization, the CDC, the NIH, and there's even British public health institutions. On the one hand you’ve got those kind of research interests who want to get NIH public money—they've [Eco Health Alliance] got $15 million, that's quite a decent pot."
"On the other hand, you have Eco Health Alliance listing corporations as part of their support network. Of the corporations listed, a few of them are chemical companies, and other ones are things like Johnson & Johnson, there is also Colgate Palmolive, there is also Reckitt Benckiser, which is another detergent, hygienic preparedness-type company. You start to see a pattern, which is that these are companies that use large amounts of palm oil. These companies are, in my opinion, attempting to divert the narrative around the destruction of the rainforests, away from the idea of palm oil, and agribusiness and big companies, and directing that towards blaming the little guys—the little guys who do the wildlife trading, the little guys who cut down the forests with their hand axes, and the people involved in the medical trade, and the wet markets of China."
"But if you want to make connections between public health, and rainforest destruction and ecological destruction, the people you should be looking at are the palm oil plantations, the cattle plantations, the soybeans and the loggers. These are the big interests that are destroying the rainforest. But what you see in the interviews with members of the Eco Health Alliance is they go from “rainforests are being destroyed” directly into a narrative about wildlife trade, of people coming into contact with wild animals, wild bats, wild pangolins and so forth. This is a total mis-description of what is really going on. So while they profess all this concern for the rainforest, they're not addressing the number one drivers of its destruction."
"You see where the interest of the palm oil people comes in; you get the public trust of scientists who will talk about their important research to do with viruses, of virus research, and how they're collecting viruses from the wild, but they are the spokespeople for this movement. The New York Times, Science magazine, Nature magazine, The Guardian, New Scientist; all these media go to Peter Daszack, to members of the Eco Health Alliance, and they ask them about how to prevent pandemics, and how to stop the destruction of the rainforests, and these One Health people—One Health is kind of an umbrella term—is overlapping with the Eco Health Alliance. These people will point you towards wildlife trading. The Chinese government even bought into this narrative, and shut down the Wuhan market, and shut down all these places that, quite likely, were not the original location of the outbreak in the first place. So we come back to the question of ‘Did it come from a lab...?"
"...it's astounding how little digging the media has done. You have China's only BSL-4 lab at the epicenter of this epidemic, in a part of China where you wouldn't expect the bat virus to emerge. China has a population of a billion to 1.3 billion people. Wuhan is a city of 11 million people. If you do the math, there's a pretty remote concatenation of chances. Why doesn't the media dig into that question? It's so obvious, and yet they haven't done it."
"If you research this you're going to offend the vaccine makers, you're going to offend the Chinese government, you're going to offend agribusiness, we're going to upset the research community, and the scientific community in general... These are enemies of free thought at this point. You can't come down firmly on one side (the "natural" origin of COVID-19), based on not having a clue what happened in that lab, and call it a fact."
/////////////////////////////////////////////////////
Some references:
https://www.organicconsumers.org/blog/covid-19-reckless-gain-of-function-experiments-lie-at-the-root-of-the-pandemic
https://youtu.be/WLYBBYwqlE4
https://www.organicconsumers.org/campaigns/covid-19
https://www.organicconsumers.org/news/who-is-getting-rich-off-covid-pandemic
https://www.organicconsumers.org/blog/covid-19-leaked-franken-virus-jointly-engineered-and-financed-us-and-china
https://www.organicconsumers.org/blog/covid-19-spike-and-furin-cleavage
https://www.organicconsumers.org/blog/pandemic-reporting-media-getting-it-wrong
https://www.organicconsumers.org/blog/pandemic-shock-digital-dictatorship-or-green-recovery
https://www.organicconsumers.org/blog/murder-most-foul-perps-behind-covid-19
https://www.organicconsumers.org/blog/covid-19-where-do-we-go-here-video-message-ronnie-cummins
https://www.youtube.com/watch?v=AFH8XOLjdJc: "Genetically engineered human-animal chimeras – what could go wrong?"
https://advocacy.organicconsumers.org/page/18957/petition/1
https://www.dailywire.com/news/nashville-man-told-by-state-hes-positive-for-coronavirus-he-was-never-tested (Just one of the numerous notes of the thousands upon thousands of "False Positives" for COVID-19).
////////////////////////
Also denouncing the perverted, planet and individuals controlling freak of the WHO (one more time!):
And then, I want to end with you looking at another perverted document by the WHO, this goes back to 2005 (updated in 2008), where we read the adulteration of definitions with a perverted motive of gain advantage over the individual body in even more perverted ways that what is already happening today at the airports due to Bush and his wretched government, which itself with foreign help caused 9/11 in order to limit the freedoms of humanity.
So, in this document:
https://www.who.int/ihr/9789241596664/en/ (https://archive.vn/iqnCG)
We read a aberracy on travesting and twisting the definitions as for the perverted globalists to be able to grope cute and young ladies with not even the smallest impediment at all, but that is not all, they will also be able to inject you with any microchip that thew want (unless you say "NO" and refuse then to take the trip that you wanted to take...), so, in the page 15 of that perverted document, we read two twisted, as all that they do, definitions:
"“intrusive” means possibly provoking discomfort through close or intimate contact or questioning;
“invasive” means the puncture or incision of the skin or insertion of an instrument or foreign material into the body or the examination of a body cavity. For the purposes of these Regulations, medical examination of the ear, nose and mouth, temperature assessment using an ear, oral or cutaneous thermometer, or thermal imaging; medical inspection; auscultation; external palpation; retinoscopy; external collection of urine, faeces or saliva samples; external measurement of blood pressure; and electrocardiography shall be considered to be non-invasive"
So, these wretched and perverted peoples of the WHO said that according to them: "cutaneous thermometer, or thermal imaging; medical inspection; auscultation; external palpation", and they say that all of this, and plus: "and electrocardiography shall be considered to be non-invasive"!!!
So, and let me be sarcastic of their regulations and definitions for you to get their full preversity: @rub her... "external palpation", to detect the heart-beat, expecting everyone to be scared as hell; put your hand inside her... "medical" inspection", because, who knows, there may be a "weapon" hidden there, or erstwhile a dangerous "disease" awaiting if not stopped the traveler's destination; massage her... "auscultation" to get her "temperature", and all of that shall be according to their criminal brains something: "non-invasive"!!!"
Plus: They can also "legally" according to their twisted brains, be "invasive" injecting you with whatever they want in order for you to travel, and their so perverted brain had already planned it all since 2005 (and they wished it happened with the pretext of this Pandemic that they themselves released with such purposes)!!!
Also it can be "invasive", "the examination of a body cavity", so not only the touch, but now if they want they can insert a microlens to verify at their full pleasure in their big screens the gonadal details of their unaware "victims"!!!
So, say NO to their depravate plans and long-salivated projects to gain a full control of your individuality in every single aspect that they wish!!! (Only God can get us out of this mayhem of evil!!!)
https://www.organicconsumers.org/blog/more-pandemics-our-future-unless-we-shut-down-gain-function-research-an-interview-andre-leu
1
"How do we know? We knew right from the beginning, China's working with the World Health Organization on this cover-up. They [the Chinese government] first admitted that there were a few cases of this new pneumonia. But they said it came from the seafood market, and that there was no evidence that it could be transmitted between humans, because it went directly from animals to humans. So, no need to worry about it. At the same time [the Chinese government] was saying that, and the World Health Organization was parroting China's claims, China was jailing the doctors who were reporting on this new pneumonia. We know one of those doctors died, in the end, a month later. He's a hero in China, and should be hero for the rest of us because he went out of his way, he was jailed for telling the truth. So, that's the first coverup."
2
"We know that they covered up the first laboratory, this is on January the 11, that released the genome of this virus. Because before that they would not release the information on this virus to any other scientists in the world. Then a laboratory in Shanghai published the genetics of it so other scientists could study it. They closed that laboratory down the next day, on January 12, and silenced the scientists."
3
"We know in early February, a paper came out from two eminent scientists in China showing there were zero bats in the Huanan seafood market, and that the likely cause of this epidemic was a release from one of the two laboratories that were doing this research in Wuhan. Not just one, it's two doing this research. Then that paper got pulled, and the Chinese put pressure on all the academic sites that posted it. It's no longer online, but fortunately we have copies of it and we've kept it, as have other people. But those scientists have disappeared. Any scientist that's come out to try and tell the truth has disappeared or been silenced."
4
"We can see the cover-up is still happening. They've closed down the Wuhan Institute of Virology. They will not allow any independent scientists in. The lab has been taken over by the military now. And also in China, any publication, anything said about this virus, has to go through their propaganda unit in Beijing."
5
"So, everything coming out of China now is pure propaganda, including any so-called "scientific study." It's officially edited and approved by the propaganda unit from Beijing. So, this is a grand-scale cover-up."
6
"And then the other evidence is, that when my country [Australia] proposed an independent investigation into the [origins of] the pandemic, [China] stopped all our imports of barley and meat, and starting putting trade pressure on us."
"...the majority of countries in the world have agreed to an independent investigation into the source and cause of this [pandemic], and the cover-up... What we're seeing is a lack of transparency and scientific transparency. We need openness. We need the real facts published. We don't need the media suppressing things. It's what's happening. The whole issue of Gain-of-Function, you will not see it in any mainstream media. And yet Gain-of-Function research is one of the biggest threats we face. Gain-of-Function research is the cause of this pandemic, and will be the cause of future and even worse pandemics unless we put a stop to it. And I think we need a global campaign to end this type of genetic engineering. This is a disaster. It has been predicted for a long time. Now it's happening and we're in the middle of it, and we need to make sure it never ever happens again."
"Why this matters is because this is probably the greatest disaster that the world has ever seen... here are millions of people now who are hungry because of all the economic shutdowns and people who will be dying of starvation. How many people do we know that their careers and jobs have stopped, they've lost their businesses?"
"This is an A-Grade disaster, and we need to know why it happened so that we can prevent this ever happening again. This is critical, so to do that we actually need to get the evidence and find out the science and the real data, not what the mainstream media is peddling. Let's look at actual evidence. So, that's what myself and others have been doing, we've been combing through documents and documents and documents. This is like putting a giant jigsaw puzzle together."
"There's a very good paper that the Chinese government suppressed that showed that there were zero bats sold in this market. By the way, this is a seafood market. They are really sort of, how can I say, inventing, fabricating that this is a wild animal market. It was not. Now, maybe there were some wild animals sold there. But there is zero evidence that any of those wild animals had the virus that causes COVID-19. On the other hand, where we do have evidence of the closest virus to the one that causes COVID-19, this is found in a bat in Yunnan, which is about 1000 miles away from Wuhan. It was found by researchers at the Wuhan Institute of Virology in 2013. In February [2020], they released the paper showing that this virus [found by the researchers in 2013] is about 96 - 96.2 percent the same as the virus that causes COVID-19. And they're trying to say that this is the one that has mutated. Other papers will show that that mutation will take about between 80 - 90 years to happen. That's nonsense to say that the closest virus has mutated naturally. There is zero evidence of that."
"The other [virus] that they started talking about was from pangolins, because they found some similar viruses in pangolins, and most of those were between 80 - 90 percent similar to COVID-19. Once again, we're talking about 100 years or more of mutations, natural mutations, for them to be the same as the virus that causes COVID-19. However, one of these pangolin viruses had a section of it that was identical to the spike protein on the virus that causes COVID-19. This is missing from the bat virus [found to be similar] to COVID-19. This spike protein is very important. People can imagine in their mind the coronavirus, and you see it's got little spikes on it, you know that's why they call it corona, those spikes are what attach to our cells in our bodies and then allow the virus to invade [human cells]. The spike protein is sort of like a lock and key system. You've got to have the right spike protein to get into a cell. And they found this unique spike protein in a pangolin. So then they said, oh look the pangolin is the cause. But the rest of it is completely different from the COVID-19 virus... But this recombination could not have happened naturally. Because the closest bat virus is very rare, it's only found in a couple of bats in a mineshaft a thousand miles away from Wuhan. And then the pangolin virus are from Malayan pangolins, which were confiscated by the border police, the customs, and were probably collected thousands of miles away from China. And there is no way that this virus, these two viruses, could have recombined, given that the two host animals were probably more than 1000 miles apart from each other. It's just scientific nonsense. There is zero evidence, zero scientific evidence to show that these two viruses recombined naturally."
"I want to explain what Gain-of-Function research is. This is where researchers will artificially modify diseases, all sorts of diseases, and make them more dangerous. So, for instance, most of these coronaviruses in bats and pangolins and mice will not infect people because their spike proteins are the wrong style or shape to infect people. So what a lot of researchers, and this includes researchers at the Wuhan Institute of Virology, have been doing is inserting spike proteins into these harmless viruses. This makes them more dangerous now because these new spike proteins are the type of spike protein to allow the virus to infect people. And we have the papers. They've been doing this research since 2007. Two particular scientific papers, one in 2015, and an even more important paper 2017, show how they did it. In 2017, they got eight harmless bat viruses and inserted new spike proteins into them, so they now had the ability to infect people. It's in black and white. They published it. This is what they do, they take harmless bat viruses, and they put new spike proteins on them. So now people can get infected by these viruses. The viruses go from harmless to being deadly."
"...in 2014, Gain-of-Function research was banned in the United States after several hundred scientists wrote to the Obama government saying this research is too dangerous. We just need one of these organisms, manmade organisms, to escape and we'll have a global pandemic. So, it was banned, but it was reinstated in 2017. And while it was banned there's various organizations in the United States, in Europe and also in my country, Australia, that were funding the Wuhan Institute of Virology to do this banned research. So, it's been going on. And it's not just the Chinese government. Most of our governments are complicit in this."
"And while they're saying we need to do it to understand these viruses, so we can get cures..., there's been 30 years of this type of research, and about all that's come out of it is bioweapons. There is zero evidence of any value that's come from this research. And look at the pandemic we have now. Where are all the benefits of 30 years of Gain-of-Function research to give us the cures and "vaccines" (my quote marks as in ridicule)? They are not there. Everybody is scrambling and panicking to try and develop something. But we've got a pandemic, and we're completely unprepared for it because we've got zero ways to treat it or prevent it. So Gain-of-Function research has had no upsides and has every sort of downside we can imagine."
"...we have good evidence now that that lab had poor biosecurity. There's a very good article in the Washington Post that reported on the cable from intelligence sources that went to the lab. They reported that this lab was essentially a pandemic waiting to happen. They said exactly that, that one of these organisms gets out and we will have a global coronavirus pandemic. They reported that. They explained how the staff was under-skilled, undertrained and they didn't have enough adequately trained skilled staff to run a BSL-4 laboratory, which is the highest security. And there are heaps of evidence all around the world of these organisms escaping out of laboratories, in virtually every country. There’s a very good paper published in Science, which is a high-level scientific journal, documenting numerous examples of these deadly organisms that have escaped, and essentially saying it's just been luck that we haven't had a deadly pandemic from one of these escapes."
"...if you look at who are the people who are saying this is natural, we're looking at the military, were looking at various government-funded research organizations—people or organizations who are actually involved in this Gain-of-Function research. They know if the truth came out, there'd be such public anger that this research would be stopped. And so it should be. I think one of the really important things that needs to come out of this, is that we need Gain-of-Function research stopped. This genetic modification of these viruses is wrong. It's creating new deadly organisms that have zero benefit. The only thing they're designed to do is kill people. And it not only is a waste of billions of dollars over the years, which could be used on much better things, it's now created the worst pandemic in our history. We need to prevent it ever happening again. Because believe me, we know there are far worse organisms sitting in these laboratories. If one of those escapes, it's going to make this COVID-19 look like a picnic."
"What we're uncovering at the moment will clearly provide even more evidence about the day the accident happened... I'll be very happy to come back and go into more detail about what happened, when it happened, and who did it."
/////////////////////////////////////////////////////
"It was Anthony Fauci’s institute that issued these grants and rescinded the ban, so he kind of has an interest in minimizing the possibility that this is a gain-of-function experiment." Stewart Newman.
https://www.organicconsumers.org/blog/why-gain-function-research-should-be-banned-author-biotech-juggernaut-speaks-out-covid-19
"...the most suspicious looking thing is the fact that the virus was first identified in Wuhan, China, and that is the site of the only what's called a BSL-4, that’s a biological safety lab, in China. There’s also a BSL-3 lab, and research on bat viruses goes on in these laboratories... viruses of this sort were researched in the lab, and not only by Chinese scientists but also in collaboration with scientists around the world including in the United States.
...after it was sequenced was found to have some features that resembled earlier coronaviruses, things that were being worked on in the lab. But they also had some hallmarks of other kinds of mixtures. A chimera is something that's a mixture of several different types of viruses... This virus is chimeric, it has bits and pieces that look like it originated from viruses in not only bats, but possibly pangolins and other organisms that it might have passed through... It has hallmarks of possibly having originated by manipulation, by being in different kinds of animals. The proximity to the lab is suspicious. So people have started to ask; “Could it have been partly a product of lab manipulation?”
These things can be partly genetically engineered, and they could have genetic engineering in their lineage, in their history...
The spike protein of this virus has a number of hallmarks that are very unusual. So it's very well suited to binding to something on human cells called the ACE2 receptor. That's called a receptor binding domain and the receptor binding domain is unusually avid for the human ACE2 receptor. And then it has something else which is called a furin cleavage site. It's a weak point in the spike protein that makes it very flexible, so the way that you assay for that weak point is you use an enzyme called furin and that will cut it. Almost no viruses in this category have that binding site, because that enzyme cleavage site, it's something that the enzyme cuts and it's the weak point. There are papers that show that genetic engineers working on viruses have introduced that by genetic engineering into other coronaviruses, just as an experiment. So people do these things...
There are papers in which scientists have introduced this cleavage site, it's a sequence of amino acids. They've introduced it through genetic engineering in viruses that don't normally have it, and it becomes much more dangerous when they do that. And this virus, very unusually, this coronavirus has that site in it, and nobody knows how it got in there. So that is kind of another suspicious aspect. So it could have been that some experiment introduced it to a virus, the virus left the lab...
...when I read that paper (the Anderson et al., 2020 "hit-opinion-piece") it raised some red flags for me, because the people who wrote that paper made a very strong assertion about it being very unlikely to have originated in a lab. And what were the arguments they used? First they said it has a very avid receptor-binding domain, but it's not an ideal one. If scientists had designed it they would have designed it differently. / Well, that was kind of ridiculous to me because there are papers going back 20 years that say that this domain is something that is very important to look at... So the fact that this is not what other scientists have found to be ideal, by computer programs, doesn't mean that this wasn't manipulated. And they didn't refer to those papers that talked about modifying those domains. I was surprised by that.
Then they [the authors] point out that the furin cleavage site is part of the spike protein, and they said this is not part of any other viruses like this. Well, that wasn't a good argument either, because they do refer to a paper where it [the cleavage site] was inserted by genetic engineers... the fact that it didn't use the standard backbone is not at all a good argument... the conclusions that they draw from it are very speculative and really raise red flags.
...I think that the honest conclusion is that there's a lot of uncertainty and a number of red flags. The red flags are that it was identified in Wuhan—which was a place where they were working on this kind of virus—and that things like this have been genetically engineered in the literature... there was a lot of controversy going back around 2010, 2012 about what are called gain-of-function experiments. Where you take a virus and you try to add factors to its sequence to possibly make it more dangerous.
In December of 2017, they rescinded the ban, and said that as of 2018 they would begin to issue grants for gain-of-function experiments. Now here we are a year-and-a-half after that and we have something that looks like a gain-of-function. So I think that it was certainly research going on in the U.S. and in collaboration with China that was doing gain-of-function experiments...
...I think that one thing that we found (the ongoing cover-up of COVID-19 by Fauci, WHO, Collins, Gates, Daszak, etc.) —and this is actually a theme of the book, “Biotech Juggernaut,” that I wrote with historian Tina Stevens... we found that very unconvincing... scientists that are backed by corporations, by patents, by business interests—have a strong stake in doing these things, trying them out even though they might have adverse effects... these are very complex systems, and if you put something simple into a complex system that wasn't there before... you can get all sorts of poisons being unleashed that weren't there before but are induced by the new engineered form... this virus killed every mouse that it encountered, it became absolutely lethal for all mice... They had no idea that was going to happen, they put a known gene into a known virus and they got something completely unexpected... it was just too dangerous to try. And this is where we may have messed up ...it's as plausible to me as any other thing I've seen... I would be an advocate for banning gain-of-function experiments. And it's a little bit ambiguous because as I said, we don't know what a gene is going to do when it's in a new context... we have to maybe increase containment when we're working with things like coronaviruses and other kinds of viruses that have caused problems in the past.
...I think it's more likely to have originated in a lab... somebody touched something, and walked out with it on part of their skin... Or it might have been an animal that somehow got discarded incorrectly or something like that. A leak could take many different forms. But I think that the fact that there was this high containment research going on in the same city is very suspicious to me.
...there's a case where you're not using a standard isolate, you're not using a standard backbone, you're using things from the wild, from patients. There’s a fair amount of virus research that goes on that way also, just isolates from animals and isolates from patients. So this idea (the absurd idea of Andersen et al., 2020, that because it was not from a kit, it was not engineered!!! C-mon!) about starting with one backbone and modifying it just doesn't happen typically.
...if it seems to have something new, then it kind of spreads virally itself. You know on Twitter and on social media. As a scientist I look at Twitter to find out what other scientists are talking about, even before they publish papers on it... something came out in Science magazine just this week saying that this particular coronavirus has a lot of sites on it’s spike protein that have numerous glycans, sugar groups attached to them. And these sugar groups both help it to bind to the human cells, but also protect the virus from being seen by the immune system. So it's kind of like a perfect storm... much worse, it’s more protected and more avid."
/////////////////////////////////////////////////////
"Eco Health Alliance (of Peter Daszak), who have been in the news plenty recently, was apparently using U.S. taxpayer funds to fund the Wuhan lab as an end-run around the ban." Jonathan Latham.
https://www.organicconsumers.org/blog/are-we-creating-pandemic-viruses-simply-generate-research-funds-interview-dr-jonathan-latham
"The ban has now been reversed by the Trump administration. That's what looks like happened, because the grant clearly lays open the possibility of doing gain-of-function type research, and mixing and matching potential pandemic pathogenic viruses."
"He has quite a record, Tony Fauci (with 35 years in power!). I wish the media was slightly more skeptical of his credentials. He's been involved in a whole series of questionable events, and what it comes down to for me is, you've got these people running the research situation in the U.S., they have been in power for a long time. Francis Collins is the head of the National Institutes of Health, he's been there for 20 years. These are basically like dictators. It used to be the case that these research heads would come and go in a three, or four, or five year period... What was once a democracy, what was once controlled democratically, and what was a research-led project is becoming more of a corrupt kind of corporate led, in-group cabal of interests, that are running a U.S. research agenda. They have nothing to do with the public interest, and nothing to do with health."
"The NIH has given about $15 million to an organization called the Eco Health Alliance, and the head of that is Peter Daszak. They have used that money for funding biology research in other countries, developing countries for the most part. They've been dispensing that money to do the kind of research that many people find problematic—collecting viruses and doing experiments on them in the lab, as a way of claiming to be estimating pandemic risks... they were the funders of the grant for gain-of-function type research at the Wuhan lab, that started in 2014. If this really was an end run around the ban on gain-of-function research, they were the conduit. They've been basically using U.S. taxpayer money to fund this research abroad... There's a complicated situation here. If you look at their supporters, if you look at their funders—the funds mostly are public money—but if you look at their supporters, if you look at their policy advisers, you come up with a very interesting list of people."
"Firstly, the policy advisors are people like the Gates Foundation, the World Health Organization, the CDC, the NIH, and there's even British public health institutions. On the one hand you’ve got those kind of research interests who want to get NIH public money—they've [Eco Health Alliance] got $15 million, that's quite a decent pot."
"On the other hand, you have Eco Health Alliance listing corporations as part of their support network. Of the corporations listed, a few of them are chemical companies, and other ones are things like Johnson & Johnson, there is also Colgate Palmolive, there is also Reckitt Benckiser, which is another detergent, hygienic preparedness-type company. You start to see a pattern, which is that these are companies that use large amounts of palm oil. These companies are, in my opinion, attempting to divert the narrative around the destruction of the rainforests, away from the idea of palm oil, and agribusiness and big companies, and directing that towards blaming the little guys—the little guys who do the wildlife trading, the little guys who cut down the forests with their hand axes, and the people involved in the medical trade, and the wet markets of China."
"But if you want to make connections between public health, and rainforest destruction and ecological destruction, the people you should be looking at are the palm oil plantations, the cattle plantations, the soybeans and the loggers. These are the big interests that are destroying the rainforest. But what you see in the interviews with members of the Eco Health Alliance is they go from “rainforests are being destroyed” directly into a narrative about wildlife trade, of people coming into contact with wild animals, wild bats, wild pangolins and so forth. This is a total mis-description of what is really going on. So while they profess all this concern for the rainforest, they're not addressing the number one drivers of its destruction."
"You see where the interest of the palm oil people comes in; you get the public trust of scientists who will talk about their important research to do with viruses, of virus research, and how they're collecting viruses from the wild, but they are the spokespeople for this movement. The New York Times, Science magazine, Nature magazine, The Guardian, New Scientist; all these media go to Peter Daszack, to members of the Eco Health Alliance, and they ask them about how to prevent pandemics, and how to stop the destruction of the rainforests, and these One Health people—One Health is kind of an umbrella term—is overlapping with the Eco Health Alliance. These people will point you towards wildlife trading. The Chinese government even bought into this narrative, and shut down the Wuhan market, and shut down all these places that, quite likely, were not the original location of the outbreak in the first place. So we come back to the question of ‘Did it come from a lab...?"
"...it's astounding how little digging the media has done. You have China's only BSL-4 lab at the epicenter of this epidemic, in a part of China where you wouldn't expect the bat virus to emerge. China has a population of a billion to 1.3 billion people. Wuhan is a city of 11 million people. If you do the math, there's a pretty remote concatenation of chances. Why doesn't the media dig into that question? It's so obvious, and yet they haven't done it."
"If you research this you're going to offend the vaccine makers, you're going to offend the Chinese government, you're going to offend agribusiness, we're going to upset the research community, and the scientific community in general... These are enemies of free thought at this point. You can't come down firmly on one side (the "natural" origin of COVID-19), based on not having a clue what happened in that lab, and call it a fact."
/////////////////////////////////////////////////////
Some references:
https://www.organicconsumers.org/blog/covid-19-reckless-gain-of-function-experiments-lie-at-the-root-of-the-pandemic
https://youtu.be/WLYBBYwqlE4
https://www.organicconsumers.org/campaigns/covid-19
https://www.organicconsumers.org/news/who-is-getting-rich-off-covid-pandemic
https://www.organicconsumers.org/blog/covid-19-leaked-franken-virus-jointly-engineered-and-financed-us-and-china
https://www.organicconsumers.org/blog/covid-19-spike-and-furin-cleavage
https://www.organicconsumers.org/blog/pandemic-reporting-media-getting-it-wrong
https://www.organicconsumers.org/blog/pandemic-shock-digital-dictatorship-or-green-recovery
https://www.organicconsumers.org/blog/murder-most-foul-perps-behind-covid-19
https://www.organicconsumers.org/blog/covid-19-where-do-we-go-here-video-message-ronnie-cummins
https://www.youtube.com/watch?v=AFH8XOLjdJc: "Genetically engineered human-animal chimeras – what could go wrong?"
https://advocacy.organicconsumers.org/page/18957/petition/1
https://www.dailywire.com/news/nashville-man-told-by-state-hes-positive-for-coronavirus-he-was-never-tested (Just one of the numerous notes of the thousands upon thousands of "False Positives" for COVID-19).
////////////////////////
Also denouncing the perverted, planet and individuals controlling freak of the WHO (one more time!):
And then, I want to end with you looking at another perverted document by the WHO, this goes back to 2005 (updated in 2008), where we read the adulteration of definitions with a perverted motive of gain advantage over the individual body in even more perverted ways that what is already happening today at the airports due to Bush and his wretched government, which itself with foreign help caused 9/11 in order to limit the freedoms of humanity.
So, in this document:
https://www.who.int/ihr/9789241596664/en/ (https://archive.vn/iqnCG)
We read a aberracy on travesting and twisting the definitions as for the perverted globalists to be able to grope cute and young ladies with not even the smallest impediment at all, but that is not all, they will also be able to inject you with any microchip that thew want (unless you say "NO" and refuse then to take the trip that you wanted to take...), so, in the page 15 of that perverted document, we read two twisted, as all that they do, definitions:
"“intrusive” means possibly provoking discomfort through close or intimate contact or questioning;
“invasive” means the puncture or incision of the skin or insertion of an instrument or foreign material into the body or the examination of a body cavity. For the purposes of these Regulations, medical examination of the ear, nose and mouth, temperature assessment using an ear, oral or cutaneous thermometer, or thermal imaging; medical inspection; auscultation; external palpation; retinoscopy; external collection of urine, faeces or saliva samples; external measurement of blood pressure; and electrocardiography shall be considered to be non-invasive"
So, these wretched and perverted peoples of the WHO said that according to them: "cutaneous thermometer, or thermal imaging; medical inspection; auscultation; external palpation", and they say that all of this, and plus: "and electrocardiography shall be considered to be non-invasive"!!!
So, and let me be sarcastic of their regulations and definitions for you to get their full preversity: @rub her... "external palpation", to detect the heart-beat, expecting everyone to be scared as hell; put your hand inside her... "medical" inspection", because, who knows, there may be a "weapon" hidden there, or erstwhile a dangerous "disease" awaiting if not stopped the traveler's destination; massage her... "auscultation" to get her "temperature", and all of that shall be according to their criminal brains something: "non-invasive"!!!"
Plus: They can also "legally" according to their twisted brains, be "invasive" injecting you with whatever they want in order for you to travel, and their so perverted brain had already planned it all since 2005 (and they wished it happened with the pretext of this Pandemic that they themselves released with such purposes)!!!
Also it can be "invasive", "the examination of a body cavity", so not only the touch, but now if they want they can insert a microlens to verify at their full pleasure in their big screens the gonadal details of their unaware "victims"!!!
So, say NO to their depravate plans and long-salivated projects to gain a full control of your individuality in every single aspect that they wish!!! (Only God can get us out of this mayhem of evil!!!)
Updated Jul 23, 2020, 5:02 PM
You tagged Lambert Dolphin
My posting of today at the Research Gate: "By Sørensen, Dalgleish & Susrud: The Evidence which Suggests that This Is No Naturally Evolved Virus: A Reconstructed Historical Aetiology of the SARS-CoV-2 Spike https://www.minervanett.no/files/2020/07/13/TheEvidenceNoNaturalEvol.pdf, this is their second amazing article on the subject. Hopefully somebody really important and not only us insignificant researchers could do something about the restraint of the current deliberate madness of the satanic globalists that want a full control of the individual using COVID-19 as their pre-planned "pretext".
"The SARS-CoV-2 general mode of action is as a co-receptor dependent phagocyte"
"SARS-CoV-2 is possessed of dual action capability"
"simultaneously it is capable of binding to ACE2 receptors"
"the likelihood of this being the result of natural processes is very small"
"The spike has six inserts which are unique fingerprints with five salient features indicative of purposive manipulation."
"a diachronic dimension by analysing a sequence of four linked published research projects which, we suggest, show by deduction how, where, when and by whom the SARS-CoV-2 Spike acquired its special characteristics... the criteria of means, timing, agent and place..."
"Why does this matter?"
"...a salutary review of failed vaccine programmes... (while our proposal is) not included in the Nature review..."
"the eight methodologies reviewed in Nature are unlikely to prove immunogenic... especially RNA vectored models, may carry significant risk of Antibody Dependent Enhancement (ADE)... we have seen such a story before over thirty years in the failure of all three mainstream vaccine approaches to HIV, which we predicted but were disbelieved"
"the SARS-CoV-2 Spike ...is highly singular, possessed of features that we have not seen before and which are not present in other SARS viruses of that clade."
"inserts placed on the surface of the Spike receptor binding domain... That SARS-CoV-2 has charged inserts is not in dispute (Zhou (with the man suspect Zheng-Li Shi) et al., 2020)"
"the SARS-CoV-2 Spike carries significant additional charge (isoelectric point (pI) pI=8.2)"!!!, compared to human SARS-CoV-1 Spike "(pI = 5.67)"
"Basic domains - partly inserted, partly substituted amino acids and partly redistributed from outside the receptor binding domain - explain the salt bridges formed between the SARS-CoV-2 Spike and its co-receptors on the cell membrane"
"they suggested, therefore sustain an hypothesis of natural evolution (Andersen et al., 2020). We do not agree... in a forthcoming companion article to this one, about three other viruses of interest, we will discuss further"
"Andersen et al cite two authorities which actually say the reverse of what they say that they say... Wan et al say that the SARS-CoV-2 binding to the ACE2 receptor confirms the accuracy of the structural predictions... Wan et al contradicts Andersen et al's opinion that it is improbable that the virus could have emerged through laboratory manipulation"
"Sheahan et al go on to explain that by in vitro evolution of the chimeric virus icSZ16-S on human airway epithelial (HAE) cells in the lab, they have been able to produce two new viruses binding to such HAE cells. Therefore this reference supports the very opposite of the Andersen et al hypothesis. We are immediately wary of any paper containing such egregious errors"
"make natural evolution a less likely explanation than purposive manipulation, specifically for Gain of Function"
"a designed mutated strain (initially) lacking the furin cleavage site residues was used"
"there are 6 inserts which make the SARS-CoV-2 Spike structurally special"
"and there are five salient features that strengthen the case for purposive manipulation in the laboratory":
1. A major part of the spike protein has human-like domains with matured transmission adaption... 78.4% of 6 amino acid windows are human like...a built-in stealth property... remarkably well-adapted virus for human co-existence"!!!
"Such high human similarity also implies a high risk for the ("vaccine") development of severe adverse events/toxicity and even Antibody Dependent Enhancement (ADE)"
"surprisingly, this characteristic is present from the very first isolate (Zhan et al, 2020). This is something that does not sit well with an hypothesis of natural evolution"
"2. The Spike displays new amino acid inserts with condensed cumulative charge, all of which are surface exposed"
"Being physically located on the surface of the Spike protein greatly increases the infectivity and pathogenicity of the virus, enabling these inserts to participate in binding to co-receptors/negatively charged... even...to the negatively charged phospholipid heads on the cell membrane" With not even a need for a receptor!!!
"typically the objective of gain of function experiments... a strong indicator of manipulation"
"3. The concentration of positive charge is on the receptor binding domain near the receptor binding motif at the top of the Spike protein... explained by an hypothesis of purposive manipulation"
"of the Spike trimer, the majority of the positive charged amino acids are located near or on the top of the spike protein giving the receptor binding domain a pI=8.906, while the Cov-2 specific Cys538-Cys590 bridge brings in additional charge from 526-560 (with even higher pI=10.03) via the Cys391-Cys525 to positions right next to the receptor binding motif (where the ACE2 receptor is located)... this ...facilitates the dual mode capability, allowing binding to ACE2 and/or to co-receptors/attachments receptors... such ACE2 independent attachment and infectivity is happening and is evidenced clinically by the Covid-19 disease pattern... also reported by Zhou et al" (since "2018")!!!
Other "receptors ...most likely to be involved are CLEC4M/DC-SIGN (CD209)"
"charged amino acids belong to the hydrophilic group of amino acids and are most likely surface exposed"
"4. The Spike is so configured that it can bind to cell tissue without use of the ACE2 receptor... Covid-19 ...compromises the functions of olfaction and bitter/sweet (taste) receptors, erythrocytes, t-cells, neurons and various tissues such as intestine epithelia", etc.
"5. Location and concentration of charge on the attachment receptor CLEC4M/DC-SIGN (C-type Lectin domain family 4 member M (CLEC4M)/ Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin(DC-SIGNR) also known as CD209) (Marzi et al., 2004)... the CLEC4M attachment receptor shows an overall pI=5.23 where the C-type lectin tail 274-390 has a pI=4.4. However, due to the two disulfide bonds Cys296-Cys389 and Cys368-Cys381 the C-terminal part of the tail is pulled back to a domain around position 296. This condensed negatively charged domain is ready for formation of salt-bridges with similar condensed opposite charged amino acids structures on the S1 RBD of SARS-CoV-2... these capabilities were developed between 2008 - 2015... a trial to demonstrate a newly discovered attachment/co-receptor by field testing and verification"!!!!!, this gets harder to reason for normal, not CCP pawns of China, as it may indicate that the six miners of the MMP study were humans used deliberately as guinea-pigs for the "greater good" of spreading communism world-wide, the ultimate "goal" of the WHO, Gates, Fauci, NIAID, Eco"Hell", etc...
"the Wuhan Institute of Virology (WIV) team had discovered the functionalities of CLEC4M/DC-SIGN/CD209 receptors in the new SADS-CoV isolate and the fact that it could bind to positive charge (Ref: https://www.uniprot.org/uniprot/Q9NNX6 (CD209) and https://www.uniprot.org/uniprot/Q9H2X3)... they wanted to do a field test of the described functionalities, the best conditions for doing so would be in connection with an ongoing viral infection"!!!
"...there are 2 charged domains on SADS that are likely to contribute to attachment receptor binding located in domains 330-360 and 540-560 respectively. Recollect that we have identified a similar highly charged structure on SARS-CoV-2 within the edge of the RBD domain (526-560) with pI=10.03 which is brought right into the core of the RBD (to approximately position 400) by Cys-Cys bridging of the domain (538-590)... similar to that which can be observed for SADS. This new Cys-Cys property inserted into the SARS-CoV-2 Spike does not exist in SARS-CoV... not... by ""natural" evolution""!!!!!!!
"we now add here a forensic analysis"!!!!
Then, about the Piece O.S that the CCP indeed is, as it is acknowledged by everybody, except by its partners in crime (such as the criminal Gates that even supports and protects them!!!, or the cover-upers of the CCP, the prostituted WHO, NIH, CDC, FDA, FAO, etc...) they say: "...international access has not been allowed to the relevant laboratories or materials, since Chinese scientists who wished to share their knowledge have not been able to do so and indeed since it appears that preserved virus material and related information have been destroyed, we are compelled to apply deduction... the evidence below attains a high level of confidence":
"1. In 2008, Dr Shi ...linked gain-of-function projects which lead to SARS-CoV-2's exact functionalities... discovered via SADS ...field-tested..."
"Ren et al (2008, including Shi) ...successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses (they state): “... a minimal insert region (amino acids 310 to 518) was found to be sufficient to convert the SL-CoV S from non-ACE2 binding to human ACE2 binding"
"2. In 2010 scientists from the 'Special Viruses' section of the Wuhan Institute of Virology (WIV) were engaged in 'gain of function' experiments, jointly with international collaborators, to increase SARS-CoV infectiousness for humans."
Note: So, their research is in the good company of the Nobel Price of 2008, Luc Montagnier, for discovering the HIV (defeating in the process to one of the most corrupt individuals, as his repugnant pal, director of NIAID for some 30 years is today), whose key clip is also added here, for the history of this awful, pre-planed situation, to look in retrospect, once this one is completely defeated at its roots!!! But the fight continues as follows:
"They used an HIV pseudo virus to express seven bat ACE2 receptors and compared their binding properties to human ACE2 receptors in order to pick the best for further optimizing a SARS-like coronavirus’s ability to bind to human cells. They also found that some bat ACE2 receptors are very close to human ACE2 receptors. This study provided a model system for testing the most infectious of SARS-CoV-like viruses which already had been selected in a vast survey of Chinese bat populations between 2005 – 2013 (Xu L et al., 2016)... Further new viruses were identified between 2012-2015 (Lin et al., 2017)."
And the next one is a "classic" of infamy:
"3. In 2015 scientists from the 'Special Viruses' section of the Wuhan Institute of Virology (WIV) were engaged in 'gain of function' experiments jointly with a majority team from the University of North Carolina Chapel Hill... a mouse adapted chimeric virus SHC014-MA15 which binds to and can proliferate on human upper airway cells (2B4 Calu-3 - a cell line contributed by Chapel Hill):"
"...and achieve in vitro titers equivalent to epidemic strains of SARS-CoV", say there the cynical Baric and Zheng-Li.
"...it is a high priority in further investigations to ascertain precisely from Chapel Hill lab records the exact donor provenance of 2B4 Calu-3. The lead Wuhan scientist, who provided the CoV material, was Dr Zheng-Li Shi ("provided SHC014 spike sequences and plasmids"). We note that what is described here are, in fact, precisely SARS-CoV-2 properties."
"Menachery et al reported that it may be hard to develop a vaccine against SHC014-MA15"
"the 2015 experiment advanced the 2010 work by perfecting in animal trials a virus optimised to infect the human upper respiratory tract"
"a surprising observation is that the paper states that this research consortium has permission to continue this research. It appears that optimisation gain of function work on this chimeric virus did continue... (both with Baric and) ...in the Wuhan Institute of Virology (WIV)".
"4. In 2018, as discussed earlier, Dr Shi's close colleague Peng Zhou, with others, investigated a coronavirus outbreak associated with a fatal Swine Acute Diarrhoea Syndrome (SADS) in Guangdong... 25,000 piglets died... SADS is a CoV infection utilising new tissue-specific binding domains... Pigs ...have immune systems very similar to humans."
"in the Covid-19 pandemic, a well-reported symptom in the early phase of the infection is loss of taste, headache and a sore throat": "Over the past several years, taste receptors have emerged as key players in the regulation of innate immune defenses in the mammalian respiratory tract. Several cell types in the airway, including ciliated epithelial cells, solitary chemosensory cells, and bronchial smooth muscle cells, all display chemoresponsive properties that utilize taste receptors." (Workman et al., 2015)".
So, "the reconstructed historical aetiology of the Spike (is) as follows:"
"1) In 2008, Dr Zheng-Li Si and WIV colleagues successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses. Building upon this, 2) the 2010 work (Hou et al., 2010) perfected the ability to express receptors on human cells. On these foundations, 3) (In 2015) the central Gain of Function work that underpins the functionalities of SARS-CoV-2 took place, carrying the WIV spike and plasmid materials to bond successfully to a UNC Chapel Hill human epithelial cell-line. This work (Menachery et al., 2015) produced a highly infectious chimeric virus optimised to the human upper respiratory tract. In convergent support of this hypothesis, both Lu (Lu et al., 2020) and Jia (Jia et al., 2020) have now, in January and April 2020, shown that SARS-CoV-2 has a bat SARS-like backbone but is carrying an RBD from a human SARS and Zhan et al. (2020), have, like us, noted unusual adaption to humans from the first isolate. In the 2015 Chapel Hill work it was only ACE2 receptors that were discussed. However, 4) in 2018 Zhou P. et al., demonstrated capabilities to clone other receptors like APN and DPP4 and to test and compare these against the (intestine) tissue specific SADS-CoV identified. Then, in the 2019-20 Covid-19 pandemic, profuse symptoms indicating compromise of the bitter/sweet receptors are reported. Taken all together, this implies that by employing insights gained after 2015, as just deduced, a further optimization of the 2015 chimeric virus for additional binding to receptors/co-receptors such as bitter/sweet specific upper airway epithelia receptors occurred (in 2018). That would help to explain the otherwise puzzling high infectivity and pathology associated with SARS-CoV-2 and hence also help to explain the social epidemiology of its spread."
"Conclusion
We have deduced the internal logic of published research which resulted in the exact functionalities of SARS-CoV-2..."
Additionally, in this wretched document: https://apps.who.int/gpmb/assets/annual_report/GPMB_annualreport_2019.pdf (saved at: https://web.archive.org/web/*/https://apps.who.int/gpmb/assets/annual_report/GPMB_annualreport_2019.pdf ), we have in plain sight the plan to take over humanity with the pretext of a "Pandemic", the globalists are already in their non-conventional "Third World War" against humanity and most of humans are still unawares. In the photos of that perverted double-talk document, we have the four main suspects of having organized this "Plandemic" aligned, in the photos of page 42: 1) The "Gates Foundation", 2) Fauci, king of NIAID for 30 years and five presidencies, 3) Gao, from the Chinese Communist Party (CCP), 4) The corrupt and perverted WHO; the first and the third were deeply involved in the "Event 201" in complicity with the WEF and the Johns Hopkins. I think that all that we can do to revert the current trend of annihilation of the individual will be deeply helpful before it is to late."
"The SARS-CoV-2 general mode of action is as a co-receptor dependent phagocyte"
"SARS-CoV-2 is possessed of dual action capability"
"simultaneously it is capable of binding to ACE2 receptors"
"the likelihood of this being the result of natural processes is very small"
"The spike has six inserts which are unique fingerprints with five salient features indicative of purposive manipulation."
"a diachronic dimension by analysing a sequence of four linked published research projects which, we suggest, show by deduction how, where, when and by whom the SARS-CoV-2 Spike acquired its special characteristics... the criteria of means, timing, agent and place..."
"Why does this matter?"
"...a salutary review of failed vaccine programmes... (while our proposal is) not included in the Nature review..."
"the eight methodologies reviewed in Nature are unlikely to prove immunogenic... especially RNA vectored models, may carry significant risk of Antibody Dependent Enhancement (ADE)... we have seen such a story before over thirty years in the failure of all three mainstream vaccine approaches to HIV, which we predicted but were disbelieved"
"the SARS-CoV-2 Spike ...is highly singular, possessed of features that we have not seen before and which are not present in other SARS viruses of that clade."
"inserts placed on the surface of the Spike receptor binding domain... That SARS-CoV-2 has charged inserts is not in dispute (Zhou (with the man suspect Zheng-Li Shi) et al., 2020)"
"the SARS-CoV-2 Spike carries significant additional charge (isoelectric point (pI) pI=8.2)"!!!, compared to human SARS-CoV-1 Spike "(pI = 5.67)"
"Basic domains - partly inserted, partly substituted amino acids and partly redistributed from outside the receptor binding domain - explain the salt bridges formed between the SARS-CoV-2 Spike and its co-receptors on the cell membrane"
"they suggested, therefore sustain an hypothesis of natural evolution (Andersen et al., 2020). We do not agree... in a forthcoming companion article to this one, about three other viruses of interest, we will discuss further"
"Andersen et al cite two authorities which actually say the reverse of what they say that they say... Wan et al say that the SARS-CoV-2 binding to the ACE2 receptor confirms the accuracy of the structural predictions... Wan et al contradicts Andersen et al's opinion that it is improbable that the virus could have emerged through laboratory manipulation"
"Sheahan et al go on to explain that by in vitro evolution of the chimeric virus icSZ16-S on human airway epithelial (HAE) cells in the lab, they have been able to produce two new viruses binding to such HAE cells. Therefore this reference supports the very opposite of the Andersen et al hypothesis. We are immediately wary of any paper containing such egregious errors"
"make natural evolution a less likely explanation than purposive manipulation, specifically for Gain of Function"
"a designed mutated strain (initially) lacking the furin cleavage site residues was used"
"there are 6 inserts which make the SARS-CoV-2 Spike structurally special"
"and there are five salient features that strengthen the case for purposive manipulation in the laboratory":
1. A major part of the spike protein has human-like domains with matured transmission adaption... 78.4% of 6 amino acid windows are human like...a built-in stealth property... remarkably well-adapted virus for human co-existence"!!!
"Such high human similarity also implies a high risk for the ("vaccine") development of severe adverse events/toxicity and even Antibody Dependent Enhancement (ADE)"
"surprisingly, this characteristic is present from the very first isolate (Zhan et al, 2020). This is something that does not sit well with an hypothesis of natural evolution"
"2. The Spike displays new amino acid inserts with condensed cumulative charge, all of which are surface exposed"
"Being physically located on the surface of the Spike protein greatly increases the infectivity and pathogenicity of the virus, enabling these inserts to participate in binding to co-receptors/negatively charged... even...to the negatively charged phospholipid heads on the cell membrane" With not even a need for a receptor!!!
"typically the objective of gain of function experiments... a strong indicator of manipulation"
"3. The concentration of positive charge is on the receptor binding domain near the receptor binding motif at the top of the Spike protein... explained by an hypothesis of purposive manipulation"
"of the Spike trimer, the majority of the positive charged amino acids are located near or on the top of the spike protein giving the receptor binding domain a pI=8.906, while the Cov-2 specific Cys538-Cys590 bridge brings in additional charge from 526-560 (with even higher pI=10.03) via the Cys391-Cys525 to positions right next to the receptor binding motif (where the ACE2 receptor is located)... this ...facilitates the dual mode capability, allowing binding to ACE2 and/or to co-receptors/attachments receptors... such ACE2 independent attachment and infectivity is happening and is evidenced clinically by the Covid-19 disease pattern... also reported by Zhou et al" (since "2018")!!!
Other "receptors ...most likely to be involved are CLEC4M/DC-SIGN (CD209)"
"charged amino acids belong to the hydrophilic group of amino acids and are most likely surface exposed"
"4. The Spike is so configured that it can bind to cell tissue without use of the ACE2 receptor... Covid-19 ...compromises the functions of olfaction and bitter/sweet (taste) receptors, erythrocytes, t-cells, neurons and various tissues such as intestine epithelia", etc.
"5. Location and concentration of charge on the attachment receptor CLEC4M/DC-SIGN (C-type Lectin domain family 4 member M (CLEC4M)/ Dendritic Cell-Specific Intercellular adhesion molecule-3-Grabbing Non-integrin(DC-SIGNR) also known as CD209) (Marzi et al., 2004)... the CLEC4M attachment receptor shows an overall pI=5.23 where the C-type lectin tail 274-390 has a pI=4.4. However, due to the two disulfide bonds Cys296-Cys389 and Cys368-Cys381 the C-terminal part of the tail is pulled back to a domain around position 296. This condensed negatively charged domain is ready for formation of salt-bridges with similar condensed opposite charged amino acids structures on the S1 RBD of SARS-CoV-2... these capabilities were developed between 2008 - 2015... a trial to demonstrate a newly discovered attachment/co-receptor by field testing and verification"!!!!!, this gets harder to reason for normal, not CCP pawns of China, as it may indicate that the six miners of the MMP study were humans used deliberately as guinea-pigs for the "greater good" of spreading communism world-wide, the ultimate "goal" of the WHO, Gates, Fauci, NIAID, Eco"Hell", etc...
"the Wuhan Institute of Virology (WIV) team had discovered the functionalities of CLEC4M/DC-SIGN/CD209 receptors in the new SADS-CoV isolate and the fact that it could bind to positive charge (Ref: https://www.uniprot.org/uniprot/Q9NNX6 (CD209) and https://www.uniprot.org/uniprot/Q9H2X3)... they wanted to do a field test of the described functionalities, the best conditions for doing so would be in connection with an ongoing viral infection"!!!
"...there are 2 charged domains on SADS that are likely to contribute to attachment receptor binding located in domains 330-360 and 540-560 respectively. Recollect that we have identified a similar highly charged structure on SARS-CoV-2 within the edge of the RBD domain (526-560) with pI=10.03 which is brought right into the core of the RBD (to approximately position 400) by Cys-Cys bridging of the domain (538-590)... similar to that which can be observed for SADS. This new Cys-Cys property inserted into the SARS-CoV-2 Spike does not exist in SARS-CoV... not... by ""natural" evolution""!!!!!!!
"we now add here a forensic analysis"!!!!
Then, about the Piece O.S that the CCP indeed is, as it is acknowledged by everybody, except by its partners in crime (such as the criminal Gates that even supports and protects them!!!, or the cover-upers of the CCP, the prostituted WHO, NIH, CDC, FDA, FAO, etc...) they say: "...international access has not been allowed to the relevant laboratories or materials, since Chinese scientists who wished to share their knowledge have not been able to do so and indeed since it appears that preserved virus material and related information have been destroyed, we are compelled to apply deduction... the evidence below attains a high level of confidence":
"1. In 2008, Dr Shi ...linked gain-of-function projects which lead to SARS-CoV-2's exact functionalities... discovered via SADS ...field-tested..."
"Ren et al (2008, including Shi) ...successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses (they state): “... a minimal insert region (amino acids 310 to 518) was found to be sufficient to convert the SL-CoV S from non-ACE2 binding to human ACE2 binding"
"2. In 2010 scientists from the 'Special Viruses' section of the Wuhan Institute of Virology (WIV) were engaged in 'gain of function' experiments, jointly with international collaborators, to increase SARS-CoV infectiousness for humans."
Note: So, their research is in the good company of the Nobel Price of 2008, Luc Montagnier, for discovering the HIV (defeating in the process to one of the most corrupt individuals, as his repugnant pal, director of NIAID for some 30 years is today), whose key clip is also added here, for the history of this awful, pre-planed situation, to look in retrospect, once this one is completely defeated at its roots!!! But the fight continues as follows:
"They used an HIV pseudo virus to express seven bat ACE2 receptors and compared their binding properties to human ACE2 receptors in order to pick the best for further optimizing a SARS-like coronavirus’s ability to bind to human cells. They also found that some bat ACE2 receptors are very close to human ACE2 receptors. This study provided a model system for testing the most infectious of SARS-CoV-like viruses which already had been selected in a vast survey of Chinese bat populations between 2005 – 2013 (Xu L et al., 2016)... Further new viruses were identified between 2012-2015 (Lin et al., 2017)."
And the next one is a "classic" of infamy:
"3. In 2015 scientists from the 'Special Viruses' section of the Wuhan Institute of Virology (WIV) were engaged in 'gain of function' experiments jointly with a majority team from the University of North Carolina Chapel Hill... a mouse adapted chimeric virus SHC014-MA15 which binds to and can proliferate on human upper airway cells (2B4 Calu-3 - a cell line contributed by Chapel Hill):"
"...and achieve in vitro titers equivalent to epidemic strains of SARS-CoV", say there the cynical Baric and Zheng-Li.
"...it is a high priority in further investigations to ascertain precisely from Chapel Hill lab records the exact donor provenance of 2B4 Calu-3. The lead Wuhan scientist, who provided the CoV material, was Dr Zheng-Li Shi ("provided SHC014 spike sequences and plasmids"). We note that what is described here are, in fact, precisely SARS-CoV-2 properties."
"Menachery et al reported that it may be hard to develop a vaccine against SHC014-MA15"
"the 2015 experiment advanced the 2010 work by perfecting in animal trials a virus optimised to infect the human upper respiratory tract"
"a surprising observation is that the paper states that this research consortium has permission to continue this research. It appears that optimisation gain of function work on this chimeric virus did continue... (both with Baric and) ...in the Wuhan Institute of Virology (WIV)".
"4. In 2018, as discussed earlier, Dr Shi's close colleague Peng Zhou, with others, investigated a coronavirus outbreak associated with a fatal Swine Acute Diarrhoea Syndrome (SADS) in Guangdong... 25,000 piglets died... SADS is a CoV infection utilising new tissue-specific binding domains... Pigs ...have immune systems very similar to humans."
"in the Covid-19 pandemic, a well-reported symptom in the early phase of the infection is loss of taste, headache and a sore throat": "Over the past several years, taste receptors have emerged as key players in the regulation of innate immune defenses in the mammalian respiratory tract. Several cell types in the airway, including ciliated epithelial cells, solitary chemosensory cells, and bronchial smooth muscle cells, all display chemoresponsive properties that utilize taste receptors." (Workman et al., 2015)".
So, "the reconstructed historical aetiology of the Spike (is) as follows:"
"1) In 2008, Dr Zheng-Li Si and WIV colleagues successfully demonstrated technical capabilities to interchange RBD’s between bat SARS-like and human SARS viruses. Building upon this, 2) the 2010 work (Hou et al., 2010) perfected the ability to express receptors on human cells. On these foundations, 3) (In 2015) the central Gain of Function work that underpins the functionalities of SARS-CoV-2 took place, carrying the WIV spike and plasmid materials to bond successfully to a UNC Chapel Hill human epithelial cell-line. This work (Menachery et al., 2015) produced a highly infectious chimeric virus optimised to the human upper respiratory tract. In convergent support of this hypothesis, both Lu (Lu et al., 2020) and Jia (Jia et al., 2020) have now, in January and April 2020, shown that SARS-CoV-2 has a bat SARS-like backbone but is carrying an RBD from a human SARS and Zhan et al. (2020), have, like us, noted unusual adaption to humans from the first isolate. In the 2015 Chapel Hill work it was only ACE2 receptors that were discussed. However, 4) in 2018 Zhou P. et al., demonstrated capabilities to clone other receptors like APN and DPP4 and to test and compare these against the (intestine) tissue specific SADS-CoV identified. Then, in the 2019-20 Covid-19 pandemic, profuse symptoms indicating compromise of the bitter/sweet receptors are reported. Taken all together, this implies that by employing insights gained after 2015, as just deduced, a further optimization of the 2015 chimeric virus for additional binding to receptors/co-receptors such as bitter/sweet specific upper airway epithelia receptors occurred (in 2018). That would help to explain the otherwise puzzling high infectivity and pathology associated with SARS-CoV-2 and hence also help to explain the social epidemiology of its spread."
"Conclusion
We have deduced the internal logic of published research which resulted in the exact functionalities of SARS-CoV-2..."
Additionally, in this wretched document: https://apps.who.int/gpmb/assets/annual_report/GPMB_annualreport_2019.pdf (saved at: https://web.archive.org/web/*/https://apps.who.int/gpmb/assets/annual_report/GPMB_annualreport_2019.pdf ), we have in plain sight the plan to take over humanity with the pretext of a "Pandemic", the globalists are already in their non-conventional "Third World War" against humanity and most of humans are still unawares. In the photos of that perverted double-talk document, we have the four main suspects of having organized this "Plandemic" aligned, in the photos of page 42: 1) The "Gates Foundation", 2) Fauci, king of NIAID for 30 years and five presidencies, 3) Gao, from the Chinese Communist Party (CCP), 4) The corrupt and perverted WHO; the first and the third were deeply involved in the "Event 201" in complicity with the WEF and the Johns Hopkins. I think that all that we can do to revert the current trend of annihilation of the individual will be deeply helpful before it is to late."
The Phthalates, like DEHP & DBP, the plan to feminize boys to reduce "the resistance" against the "globalists", inserted into: Baby foods, infant care products, toys, school supplies...: https://branchbasics.com/blog/common-household-chemicals-phthalates-19-surprising-sources, https://archive.vn/dpP4y, https://branchbasics.com/blog/common-household-chemicals-phthalates-19-surprising-sources
Updated Jul 19, 2020, 1:17 PM
Fernando Castro-Chavez shared a memory.
2 Years Ago
Jul 19, 2019, 8:07 AM
Arte de la China Milenaria!: La cultura Cantonesa de Guangzhou: Esto complementa al mensaje que puse desde la misma China represiva usando un VPN (el CyberGhost, desde su Aeropuerto de 5 estrellas): https://www.facebook.com/fernando.castrochavez.90/posts/2583585851694075, así como al promocional de esta exposición que puse con posterioridad: https://www.facebook.com/fernando.castrochavez.90/posts/2588184794567514; aquí se observa a uno de sus artesanos en plena labor, y la belleza de su jade labrado y de su afamada porcelana, entre muchas otras cosas bellas (pinturas, ropas, labrados, maderas, etc., etc.):
More memories from Guangzhou, 2019:
Updated Jul 19, 2020, 12:09 PM
You tagged Tommy C Dearman
The Science Against The Face Masks (Especially in CHILDREN!!!): Further Damaging The Development Of The Brain Of Your Children By Their Use Of The Face Mask (They Want A Generation Of Idiots To Do As They Please With Them!!!): https://www.bitchute.com/video/OOtNAaD5rayr (The CO2 detector was even unable to capture its real presence as it went BEYOND its limit of numbers, which is 9999)
I say the same!
Updated Jul 18, 2020, 2:58 PM
The last song I dedicate to her: https://www.youtube.com/watch?v=uFtfrd8_K9k, and the last that she dedicates to me: https://www.youtube.com/watch?v=JhaCNIpAnPs
Fernando Castro-Chavez shared a memory.
5 Years Ago
Jul 18, 2016, 5:17 PM
Y aquí estamos, Estéfano y yo, a la entrada de la Biblioteca del Centro Universitario (C. U.) de la Universidad Autónoma de Guadalajara (U.A.G.), donde se encuentra una pareja de Mamuts excavados en Jalisco. Platicábamos el fin de semana, de cómo la segunda glaciación, que fue parcial, en tiempos del diluvio de Noé, arrasó con los grandes mamíferos de todo el mundo; para ver mi estudio Bíblico acerca de esto, favor de dirigirse a, "Las Aguas Arriba ' 2": https://youtu.be/VMzndWIMLD8
Los ciclos de la historia se repiten, ayer se trató de un mamut en la biblioteca de la C. U. de mi primera Alma Mater...:
Updated Jul 18, 2020, 7:25 AM
Las Lucas Locuras De La Gente Maldita (abajo con ella! Y a la derecha, vemos al enfermo mental de Gates, obseso con el control del planeta, sin haber sido elegido por nadie) Que Nos Quiete "vacunar" como pretexto para "Digitalizarnos"... como controla a los medios de comunicación corruptos, que prefieren darle de su caro tiempo televisivo a un loco que nada sabe de medicina pero que tiene suficiente dinero y astucia diabólica como para "comprar" a todos, y a una niña que tampoco sabe nada de nada ni de medicina ni de la vida misma y que tan solo está siendo usada como carnada por las prostitutas de CNN, como lo son la Cooper y el inepto Gupta, pero como ya también lo son, ante mi sorpresa Fernando del Rincón y la Aristegui... (O siempre lo han sido pero no me daba cuenta?). Mientras que la corrupta OMS que le pertenece a Gates, censura a talentos como los Cinco seres de calidad humana y de alto calibre que se ven en la parte de arriba. Estos ni siquiera han sido "noticia" (de notarse) en la porqueriza en la que se ha convertido la "aterradora" (con falsas e infladas cifras durante todo el día) TV vendida de hoy!!!
Updated Jul 17, 2020, 8:51 AM
Fernando Castro-Chavez shared a memory.
2 Years Ago
Jul 17, 2019, 8:09 AM
More shots from my goings into China from the Philippines, I was the only foreigner within a plane filled with Chinese people, some of them laughed at it, as well as at my flight schedule that I have drown by hand as I had just got it; then, the scheduled departures from the Manila Ninoy Airport can be seen, as well as a set of Muslims sitting at the floor awaiting for their trip to Abu Dhabi:
Here, I reminisce my way back form the Philippines a year ago, coming back to the USA through China, the only one like me amongst a 100% of Chinese, mostly men...
Updated Jul 17, 2020, 7:06 AM
These are the great comments of our dear Nobel Prize of 2008 for discovering the AIDS virus HIV: "Our dear Luc Montagnier made the next comments to my last posting at the ResearchGate, and sent them to our common and talented acquaintance Jean-claude Perez: "Sequence alignment show differences between RaTG13 (Sequence of 2020) and Covid 19. Analysis of the samples taken from the dead miners (my note: The six that got infected by a ferocious virus on 2013, very similar to COVID-19) should reveal whether or not they died from a RaTG13 manipulated into Covid-19." LM" " Regarding my last posting at the ResearchGate: "The most recent publications by two PhDs a virologist and a geneticist: Jonathan Latham, & Allison Wilson: "A Proposed Origin for SARS-CoV-2 and the COVID-19 Pandemic": https://www.independentsciencenews.org/commentaries/a-proposed-origin-for-sars-cov-2-and-the-covid-19-pandemic/?fbclid=IwAR22IfkFMlcTUbjefm3GENnmpVeHg29c9oMiCdwh8Ds18zcmdEqhvoJj894 and https://www.independentsciencenews.org/health/the-case-is-building-that-covid-19-had-a-lab-origin/, thanks to biol A.R.C.
Furthermore the full original MSc Thesis of the first 2013 COVID-19-likes is available there for download: https://assets.documentcloud.org/documents/6981198/Analysis-of-Six-Patients-With-Unknown-Viruses.pdf
As they describe the 2013 symptoms of that COVID-19-like scenario (that Shi Zheng-Li has tried to keep on hidden with every single trick in her book: changing names of the strain, omitting that it was a virus then the cause, etc.): "a) dry cough, b) sputum, c) high fevers, especially shortly before death d) difficulty breathing, e) myalgia (sore limbs). Some patients had hiccoughs and headaches... Clinical work established that patients 1-4 had low blood oxygen “for sure it was ARDS” (Acute Respiratory Distress Syndrome) and immune damage considered indicative of viral infection. Additionally, a tendency for thrombosis was noted in patients 2 and 4. Symptom severity and mortality were age-related... Treatment of the six patients included ventilation (patients 2-4), steroids (all patients), antivirals (all except patient 5), and blood thinners (patients 2 and 4). Antibiotics and antifungal medications were administered to counter what were considered secondary (but significant) co-infections... Judging by their clinical symptoms such as the CT scans, all the miner’s infections were primarily of the lungs... the hospitalised miners had very long-term bouts of disease characterised by a continuous high load of virus. In the cases of patients 3 and 4 their illnesses lasted over 4 months..." and most importantly, as per our HIV INSERTIONS (in the word used by Zheng-Li herself!!!): "Furthermore, according to the Master’s thesis, the immune systems of the miners were compromised and remained so even for those discharged"!!! Whoaaaa!!! And also: "Coronaviruses are well known to recombine at very high rates: 10% of all progeny in a cell can be recombinants" Now my question is: Can a coronavirus even pick up in a host a favorable sequence from bacteria????
Regarding multiple "passages" within the lungs of these miners, this is what they say: "...movement around the lungs would likely have resulted in what amounted to a passaging effect without the need for a researcher to infect new tissues. Indeed, in the Master’s thesis the observation is several times made that areas of the lungs of a specific patient would appear to heal even while other parts of the lungs would become infected." Just like today!!!
This is their straightforward conclusion: "We suggest, first, that inside the miners RaTG13 (or a very similar virus) evolved into SARS-CoV-2, an unusually pathogenic coronavirus highly adapted to humans. Second, that the Shi lab used medical samples taken from the miners and sent to them by Kunming University Hospital for their research. It was this human-adapted virus, now known as SARS-CoV-2, that escaped from the WIV in 2019. / We refer to this COVID-19 origin hypothesis as the Mojiang Miners Passage (MMP) hypothesis."
Plus the classic statement by, RIP, Mullis, about the uselessness of PCR for estimating viral load: "With regard to the viral-load tests, which attempt to use PCR for counting viruses, Mullis has stated: “Quantitative PCR is an oxymoron.” PCR is intended to identify substances qualitatively, but by its very nature is unsuited for estimating numbers. Although there is a common misimpression that the viral-load tests actually count the number of viruses in the blood, these tests cannot detect free, infectious viruses at all; they can only detect proteins that are believed, in some cases wrongly, to be unique to HIV. The tests can detect genetic sequences of viruses, but not viruses themselves." From: Lauritsen J. Has Provincetown Become Protease Town? [Internet]. Available from: http://www.virusmyth.com/aids/hiv/jlprotease.html
Here is the preprint also mentioned in that article of the Preprint of Segreto and now Deigin!!!!:
Preprint Is considering a genetic-manipulation origin for SARS-CoV-2 ...
Finally this is the link, posted elsewhere, that was removed from ResearchGate, just because it insinuated an ill-hearted trend in those researchers, that like Zheng-Li, were deliberately twisting the evidence to fit their preconceived cover-up ideas!, while Petrovsky was straight as a man since the beginning!!! Kudos to him, and shame on the rest that twist, hide (through the Gis-NO-aid), or even "doctor" the evidence, like Shi and Holmes; so if speaking the truth gets me banned from here, feel free to seek my results of these inquires in the next root page as well, hoping there to find more peace than in FB, YT, RG, etc.: https://fdocc.neocities.org/Petrovsky--Holmes.htm
A clear-cut criticism to "cover-upper" Holmes is even raised in the main article at the top of this message, as follows:
"At first glance RaTG13 is unlikely to have evolved into SARS-CoV-2 since RaTG13 is approximately 1,200 nucleotides (3.8%) different from SARS-CoV-2. Although RaTG13 is the most closely related virus to SARS-CoV-2, this sequence difference still represents a considerable gap. In a media statement evolutionary virologist Edward Holmes has suggested this gap represents 20-50 years of evolution and others have suggested similar figures. / We agree that ordinary rates of evolution would not allow RaTG13 to evolve into SARS-CoV-2 but we also believe that conditions inside the lungs of the miners were far from ordinary."
Will Holmes cry again like a little girl to have that information also removed????"
Furthermore the full original MSc Thesis of the first 2013 COVID-19-likes is available there for download: https://assets.documentcloud.org/documents/6981198/Analysis-of-Six-Patients-With-Unknown-Viruses.pdf
As they describe the 2013 symptoms of that COVID-19-like scenario (that Shi Zheng-Li has tried to keep on hidden with every single trick in her book: changing names of the strain, omitting that it was a virus then the cause, etc.): "a) dry cough, b) sputum, c) high fevers, especially shortly before death d) difficulty breathing, e) myalgia (sore limbs). Some patients had hiccoughs and headaches... Clinical work established that patients 1-4 had low blood oxygen “for sure it was ARDS” (Acute Respiratory Distress Syndrome) and immune damage considered indicative of viral infection. Additionally, a tendency for thrombosis was noted in patients 2 and 4. Symptom severity and mortality were age-related... Treatment of the six patients included ventilation (patients 2-4), steroids (all patients), antivirals (all except patient 5), and blood thinners (patients 2 and 4). Antibiotics and antifungal medications were administered to counter what were considered secondary (but significant) co-infections... Judging by their clinical symptoms such as the CT scans, all the miner’s infections were primarily of the lungs... the hospitalised miners had very long-term bouts of disease characterised by a continuous high load of virus. In the cases of patients 3 and 4 their illnesses lasted over 4 months..." and most importantly, as per our HIV INSERTIONS (in the word used by Zheng-Li herself!!!): "Furthermore, according to the Master’s thesis, the immune systems of the miners were compromised and remained so even for those discharged"!!! Whoaaaa!!! And also: "Coronaviruses are well known to recombine at very high rates: 10% of all progeny in a cell can be recombinants" Now my question is: Can a coronavirus even pick up in a host a favorable sequence from bacteria????
Regarding multiple "passages" within the lungs of these miners, this is what they say: "...movement around the lungs would likely have resulted in what amounted to a passaging effect without the need for a researcher to infect new tissues. Indeed, in the Master’s thesis the observation is several times made that areas of the lungs of a specific patient would appear to heal even while other parts of the lungs would become infected." Just like today!!!
This is their straightforward conclusion: "We suggest, first, that inside the miners RaTG13 (or a very similar virus) evolved into SARS-CoV-2, an unusually pathogenic coronavirus highly adapted to humans. Second, that the Shi lab used medical samples taken from the miners and sent to them by Kunming University Hospital for their research. It was this human-adapted virus, now known as SARS-CoV-2, that escaped from the WIV in 2019. / We refer to this COVID-19 origin hypothesis as the Mojiang Miners Passage (MMP) hypothesis."
Plus the classic statement by, RIP, Mullis, about the uselessness of PCR for estimating viral load: "With regard to the viral-load tests, which attempt to use PCR for counting viruses, Mullis has stated: “Quantitative PCR is an oxymoron.” PCR is intended to identify substances qualitatively, but by its very nature is unsuited for estimating numbers. Although there is a common misimpression that the viral-load tests actually count the number of viruses in the blood, these tests cannot detect free, infectious viruses at all; they can only detect proteins that are believed, in some cases wrongly, to be unique to HIV. The tests can detect genetic sequences of viruses, but not viruses themselves." From: Lauritsen J. Has Provincetown Become Protease Town? [Internet]. Available from: http://www.virusmyth.com/aids/hiv/jlprotease.html
Here is the preprint also mentioned in that article of the Preprint of Segreto and now Deigin!!!!:
Preprint Is considering a genetic-manipulation origin for SARS-CoV-2 ...
Finally this is the link, posted elsewhere, that was removed from ResearchGate, just because it insinuated an ill-hearted trend in those researchers, that like Zheng-Li, were deliberately twisting the evidence to fit their preconceived cover-up ideas!, while Petrovsky was straight as a man since the beginning!!! Kudos to him, and shame on the rest that twist, hide (through the Gis-NO-aid), or even "doctor" the evidence, like Shi and Holmes; so if speaking the truth gets me banned from here, feel free to seek my results of these inquires in the next root page as well, hoping there to find more peace than in FB, YT, RG, etc.: https://fdocc.neocities.org/Petrovsky--Holmes.htm
A clear-cut criticism to "cover-upper" Holmes is even raised in the main article at the top of this message, as follows:
"At first glance RaTG13 is unlikely to have evolved into SARS-CoV-2 since RaTG13 is approximately 1,200 nucleotides (3.8%) different from SARS-CoV-2. Although RaTG13 is the most closely related virus to SARS-CoV-2, this sequence difference still represents a considerable gap. In a media statement evolutionary virologist Edward Holmes has suggested this gap represents 20-50 years of evolution and others have suggested similar figures. / We agree that ordinary rates of evolution would not allow RaTG13 to evolve into SARS-CoV-2 but we also believe that conditions inside the lungs of the miners were far from ordinary."
Will Holmes cry again like a little girl to have that information also removed????"
Fernando Castro-Chavez
La segunda parte del gran programa de @[876355292:2048:Stefano Macedo Reyes] con @[100000268184927:2048:Manuel Murillo] https://www.facebook.com/KardagarCoaching/videos/1194328894267668/, poniendo los puntos sobre las íes:
Updated Jul 16, 2020, 9:59 PM
Fernando Castro-Chavez shared a memory.
2 Years Ago
Jul 16, 2019, 1:03 PM
So, the Airport of Guangzhou is considered a five star one, specially because of its exquisite museum with the arts and crafts of the region: Cantonese and elementary for all of it that the Chinese culture is, as it originated there its works in porcelain, the paintings of the face and body typically Chinese, the clothing and costumes (including those long dragon ones were several people fits inside), the paintings with written and soothing messages in Chinese, the bronze, the fine carving over jade, ivory, etc., etc., the cake industry and its shapes, etc. (so, as I am able, I will be posting the additional pictures I took of such peculiar art):
Memories of my path through Guangzhou, other days, other times:
Updated Jul 16, 2020, 8:36 AM
Most recent research into COVID-19: https://www.independentsciencenews.org/commentaries/a-proposed-origin-for-sars-cov-2-and-the-covid-19-pandemic/, sent to me by @[100001141123869:2048:Alberto Rubio Casillas].
Updated Jul 16, 2020, 8:08 AM
The Positive Thinking: I Can Win The Heart Of The One That My Heart Desires!!! Dedicated by her and to her, to succeed, thanks my MaKaMi, from your Kiamoy!!!: https://www.youtube.com/watch?v=m5HKMfRzEgM
Updated Jul 15, 2020, 8:54 PM
Starting at Minute 44:44: Ep. 31 – Top Medical Insider from MASSIVE Health Care System Blows Roof Off COVID-19 ‘Scamdemic’ – Internal Numbers ARE ALL RIGGED -- For Profit, Greed, Politics, Social "Justice". ALARMING. PLUS -- Breaking FBI Intel on Ghislaine Maxwell, Epstein: https://podcasts.google.com/feed/aHR0cHM6Ly9mZWVkcy5jYXB0aXZhdGUuZm0vdGhvbWFzLXBhaW5l/episode/OTA4YzJkOTgtYzE3ZS0xMWVhLWJmNTEtNGZiNDMxMTQ4ZDFi
Updated Jul 14, 2020, 6:53 PM
Fernando Castro-Chavez shared a memory.
2 Years Ago
Jul 14, 2019, 11:45 PM
Aún buscando compañera (Still searching for companion): Esperaba yo aquí mi salida a México desde Vancouver, Canadá, por la línea China Southern Airlines:
Reminiscing the Guangzhou airport, where the CCP of China had blocked the Facebook and the Google, but now both of them are mercilessly censoring and blocking, whomever like me wanting to say that a vaccine for this COVID-19 that was engineered by humans and deliberately released precisely in order to reboot the economies of the wold, to make the USA to fall, to have the "NWO", expressed as the absurd "New Normal", with a centralized world government and a one "only" religion as well.... but NOT on my watch! (And, from there I was briefly in Vancouver, Canada, where I took these pictures).
Updated Jul 14, 2020, 9:48 AM
Fernando Castro-Chavez shared a memory.
At the Taal volcano!!!
Updated Jul 13, 2020, 8:44 AM
Fernando Castro-Chavez shared a memory.
A year ago, on this day, I saw and hugged for the first and for the last time Vanessa Alcover Apao at the Tambayan Hostel at Malate, Manila. She gave back what she owed. Then I flew to Guangzhou, China, where I needed to use the VPN Ghost to be able to use the forbidden in China most common tools of the West in order to submit these photos: Goggle and Facebook, today also corrupted by money.
Updated Jul 13, 2020, 7:36 AM
Fernando Castro-Chavez shared a memory.
The voices of reason of Kent and Judy, again bring us a little bit of sobriety!!!:
Updated Jul 12, 2020, 10:54 AM
Lo mejor de ayer, hoy y siempre!!!
Updated Jul 12, 2020, 10:33 AM
Fernando Castro-Chavez updated his status.
Yo no he mandado un mensaje con Ws, ni siquiera sé qué es eso. Si algún hacker malvado se mete a mi Messenger e intenta "impersonarme", Dios les ayude a discernir que no soy yo. Yo no pido nada de nada, lo único que yo quisiera, ¡es que amen mucho a Dios!
Fernando Castro-Chavez shared a memory.
2 Years Ago
Jul 11, 2019, 1:41 PM
Visiting volcanoes with persons from Singapore, MX, Russia, Holland, and Philippines; below, going out of TV5, with April...
From my days in the Philippines a year ago, where things were different, not yet taken over by those evils-that-be, at the Taal Volcano and outside of the program by Raffy Tulfo. I meet a great lady living in London, @[1339687409:2048:Victoria Shaykhislamova], due to her MSc!
Updated Jul 11, 2020, 8:52 AM
It seemed that I was unable, that I could not make it with her, even if I wanted to be: https://www.youtube.com/watch?v=t1TcDHrkQYg
Updated Jul 9, 2020, 9:18 PM
Recordando a pasados engaños, por el mismo PNAC (del que Joe Biden es miembro activo al lado de los Bush) que causó el 9/11 y la crisis financiera del 2008 además del Ántrax del 2001 soltado por Bush mismo para matar al reportero Bob Stevens de "The Sun", de Florida, por fotografiar a las hijas de Bush bien drogadas y borrachas ante la vista de los varones de cantina: https://off-guardian.org/2016/09/30/30052/, https://archive.vn/rGRt0, http://docshare01.docshare.tips/files/22703/227037736.pdf y el Bush intentar también matar a todos aquellos opositores a sus políticas criminales y de guerra, tanto a políticos como de la prensa. Ahora con el COVID-19 estas tres cosas convergen: Un Bio-terrorismo deliberado para acabar con la economía de las Naciones y con las libertades individuales. Que el Señor los reprenda (dijo Migue)...
Updated Jul 9, 2020, 10:46 AM
Fernando Castro-Chavez shared a memory.
2 Years Ago
Jul 8, 2019, 7:32 PM
My dear brother in Christ Jeremiah Oliver, as a great chief himself, asked me to pay attention to the foods, these are the ones available at a food market, where there is live music daily on the night, we requested a squid, that right there they prepared for us, with coconut water flavored with mint:
These were some of the tasty things we are and sold at the big food market at Makati, Manila, Philippines. Praying every single day to be accepted every single day for the one I love from that Country, never ever taking for granted, not even for a second the time that I may be privileged to spend in person with her from now on, even in the midst of the worst of the circumstances and world situations.... due to evil men... But God is still alive forever!!!, and all of the times He is still Good with us, no matter what, and no matter anything!!!
Updated Jul 8, 2020, 7:12 AM
This one is very important footage taken by a cute lady on Chopper 4, from the WNBC station, of what could also be seen the couple of hours before the beginning of the deliberate destruction of the WTC on 9/11 by Bush, Cheney, Rumsfeld (authorizers), Silverstein (leaser), ARA and Boeing (contractors), PNAC (including the previous ones and many other very nasty individuals of their same sorts, basically a full set of repugnant enemies of America, including the current evil p.e.d.o.p.h.i.l.e Democrat candidate JOE BIDEN (Joseph Robinette Biden Jr.), Wolfowitz, Perle, Kristol, Jeb Bush, Mrs. M. K. Albright, Armitage, Bauer, Bolton, Blumenthal, Brzezinski, S. Forbes, I. Lewis Libby, John McCain, Dan Quayle, R. James Woolsey, Dov S. Zakheim (the one who sacked even more the already sacked Pentagon), Zoellick, etc., etc.: https://militarist-monitor.org/list_of_pnac_signatories_and_contributing_writers/) & Mossad (mastermind), and many others, showing what has been interpreted as also a practice-run (in the same way that the white cloaked boeing helicopters practiced the fake "planes" holographic projections overnight) of the ultimate destruction of the WTC Twin Towers by a Directed Energy Weapon (DEW), most possibly controlled from a high altitude aircraft or even a satellite, you can see the trail of the current "assay" how it was aiming from the right side, like mimicking the exit of the house there and moving towards the left from there until pointing, first briefly to the left side to poke a smaller hole in the opposite rail of the avenue, and then focusing a little longer in the one at the right side to perforate a bigger hole (after she pans to leave the scene, I have added the footage that she took earlier before her report): |
This one is very important footage taken by a cute lady on Chopper 4, from the WNBC station, of what could also be seen the couple of hours before the beginning of the deliberate destruction of the WTC on 9/11 by Bush, Cheney, Rumsfeld (authorizers), Silverstein (leaser), ARA and Boeing (contractors), PNAC (including the previous ones and many other very nasty individuals of their same sorts, basically a full set of repugnant enemies of America, including the current evil p.e.d.o.p.h.i.l.e Democrat candidate JOE BIDEN (Joseph Robinette Biden Jr.), Wolfowitz, Perle, Kristol, Jeb Bush, Mrs. M. K. Albright, Armitage, Bauer, Bolton, Blumenthal, Brzezinski, S. Forbes, I. Lewis Libby, John McCain, Dan Quayle, R. James Woolsey, Dov S. Zakheim (the one who sacked even more the already sacked Pentagon), Zoellick, etc., etc.: https://militarist-monitor.org/list_of_pnac_signatories_and_contributing_writers/) & Mossad (mastermind), and many others, showing what has been interpreted as also a practice-run (in the same way that the white cloaked boeing helicopters practiced the fake "planes" holographic projections overnight) of the ultimate destruction of the WTC Twin Towers by a Directed Energy Weapon (DEW), most possibly controlled from a high altitude aircraft or even a satellite, you can see the trail of the current "assay" how it was aiming from the right side, like mimicking the exit of the house there and moving towards the left from there until pointing, first briefly to the left side to poke a smaller hole in the opposite rail of the avenue, and then focusing a little longer in the one at the right side to perforate a bigger hole (after she pans to leave the scene, I have added the footage that she took earlier before her report):
Fernando Castro-Chavez shared a memory.
2 Years Ago
Jul 7, 2019, 8:12 AM
At the gigantic airport of Hong Kong, were my final "waiting room" for my departure to Manila had the number 509, and it was needed to be taken by a bus to lead us to such terminal
A year ago, seeking for my female companion, I went through Hong Kong, the biggest airport I have seen... current and faithful companion, I long for you girl!!!
Updated Jul 7, 2020, 8:50 AM
Hoy murió Guillermo Lares Lazarit, compañero de radio con una gran voz y una gran memoria para la declamación: https://www.youtube.com/watch?v=g22PrUTcPIA, https://www.publimetro.com.mx/mx/entretenimiento/2020/07/06/muere-guillermo-lares-lazarit-icono-la-radio-tapatia.html, y https://www.infobae.com/america/entretenimiento/2020/07/06/murio-don-justo-preciso-icono-de-la-radio-en-jalisco/
Updated Jul 6, 2020, 10:08 PM
This segment with my explanation was also removed from YouTube, a shorter version of it is in My Story here at FB Messenger right now. It was from Chopper 4 at WNBC at 6 AM of September the 11th, 2001. It shows the white "cloaked" Boeing helicopters used to pull the Holographic image of a fake "Plane 175" hitting the WTC. The three Boeing white helicopters can be seen at the left middle side of the screen, and are flying in an aligned formation and projecting a practice-run double hologram below of them and at their right side (which means in a vertical line the original and its two projections for the point of view of the viewer), the last one seems to be lagged behind and speeds up, this one is seen at the right side of the screen as the Chopper camera has moved to the left, however, this are only three of the numerous perp helicopters that were flying since overnight of 9/11 to practice over Manhattan, because other projected reflections of another set of unseen helicopters can be seen reflected near the border of the Hudson river, at the lower part of the current scene. While flying at the distance, they can be seen with a blinking intensity like a beating heart that goes up in intensity and then down, but NOT so their holographic projections!!! As those keep the same intensity!!! For example, in the Park Foreman Holo-video of the fake and very obscure and black "Plane 175" that do NOT reflects the sun, which is another telling characteristic of an hologram, you can tell between 12 to 20 cloaked helicopters on its path at its side projecting that "plane" hologram, that, no matter how much they tried, it still displayed a missing right wing from the right position cameras. |
This segment with my explanation was also removed from YouTube, a shorter version of it is in My Story here at FB Messenger right now. It was from Chopper 4 at WNBC at 6 AM of September the 11th, 2001. It shows the white "cloaked" Boeing helicopters used to pull the Holographic image of a fake "Plane 175" hitting the WTC. The three Boeing white helicopters can be seen at the left middle side of the screen, and are flying in an aligned formation and projecting a practice-run double hologram below of them and at their right side (which means in a vertical line the original and its two projections for the point of view of the viewer), the last one seems to be lagged behind and speeds up, this one is seen at the right side of the screen as the Chopper camera has moved to the left, however, this are only three of the numerous perp helicopters that were flying since overnight of 9/11 to practice over Manhattan, because other projected reflections of another set of unseen helicopters can be seen reflected near the border of the Hudson river, at the lower part of the current scene. While flying at the distance, they can be seen with a blinking intensity like a beating heart that goes up in intensity and then down, but NOT so their holographic projections!!! As those keep the same intensity!!! For example, in the Park Foreman Holo-video of the fake and very obscure and black "Plane 175" that do NOT reflects the sun, which is another telling characteristic of an hologram, you can tell between 12 to 20 cloaked helicopters on its path at its side projecting that "plane" hologram, that, no matter how much they tried, it still displayed a missing right wing from the right position cameras.
Fernando Castro-Chavez updated his status.
Fernando's most commented photo on Facebook of 2015
Sin importar lo que está pasando hoy en nuestra querida tierra, sin importar lo que ha pasado o lo que pasará, gracias a nuestro buen Dios, de una cosa estamos seguros:
Dedicated to her, in her day: https://www.youtube.com/watch?v=oo7VlD66ISM
Updated Jul 6, 2020, 6:48 AM
You tagged Karen Wierwille Martin
My letter to my old Acquaintance, as posted today at ResearchGate: "To the current director of the NIH: As a Postdoctoral of Molecular Biology, my focus has been on analyzing the sequence of the current COVID-19, it is so alarming the finding of artificiality within it, that I have written to Francis S. Collins, entitled “A Vital Letter For The Preservation Of Humanity As We Know It”:
Dr. Collins,
As I have had the blessed confidence to write to a brother in Christ since day one, I am sending you this important message.
With my best regards,
Fernando Castro-Chavez, PhD.
P.S:
I could not fit in the Letter this vital link that independently exposes the hoax imposed on humanity 19 years ago, let us do all we can to prevent this time to happen the same but in a wider scale (Most specially the roots, that are the last three chapters: 6, 7 and 8, for you that like music... good beats but disturbing lyrics): https://lbry.tv/@fdocc:b/AceBakerFinalVersionPart1:4, https://lbry.tv/@fdocc:b/AceBakerFinalVersionPart2:4
AT LEAST SIX RESEARCH GROUPS HAVE FOUND HIV INSERTS IN SARS-CoV-2
A Letter to Dr. Francis S. Collins,
Sir, Prompted by this article: Jun 25, 2020 – Health: The NIH claims joint ownership of Moderna's coronavirus vaccine: https://www.axios.com/moderna-nih-coronavirus-vaccine-ownership-agreements-22051c42-2dee-4b19-938d-099afd71f6a0.html (https://archive.vn/TArE3), I write to you, saying that we had a deep respect for you (my sister, my girl companion and my peers). The first letter I wrote to you was about Creation, in 2000, just having arrived from my country, and I wrote it in a bad English still, willing to live the American dream!!! Then, we saw you in person, and introduced ourselves, when you went to the BMC to give a speech about the Human Genome Project, I remember that you said something like: "Mendel is also there, in this slide, right there at the corner..."; then I wrote about our dreams to pursue, not only these Postdoctoral couple of jobs in Medicine, but also an MD Career, we two starting again from the scratch. Dreaming to be truthful and to really help humanity... However, now, I dedicate to you my current findings, humble, but nonetheless, they are still findings:
1) "COVID-19: AATGGTACTAAGAGG (NGTKR) = HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene (GU455503)". Finding also done by:
2) Shi Zheng-Li, from the WIV at Wuhan and co-author of Ralph Baric, and she distinctively calls it an "INSERTION" (she puts it as: GTNGTKR, GGGACCAATGGTACTAAGAGG, adding other two more, but skipping the key one: The Furin Site!), whose putative function is immunosuppressant, as she says that those INSERTIONS have: "sialic-acid-binding activity", at: Zhou, P., plus 27 et als & Zheng-Li Shi. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 2020:579:270-73, & 16pp: https://www.nature.com/articles/s41586-020-2012-7.pdf; a third group that found these unique INSERTS is that of:
3) Sørensen (identical to the previous one: GTNGTKR, but also studying, to leave no doubts, its functional span by performing 6 by 6 NT iterations containing our sequence of interest (and of many others), such as: VSGTNG, SGTNGT, TNGTKR, NGTKRF, etc.), who says in an interview, as he found many more INSERTS (saved at: https://archive.vn/7TPTc): "The INSERTED sequences have a functionality that we describe. We explain why they are essential: ...accumulated charge from inserts and salt bridges are in surface positions capable of binding with cell membrane components other than the ACE2 receptor." This statement is very important and indicates that if we realize that this virus is NOT natural we could be and have been better prepared since the start to fight against it in a more logical, rational and prepared way, which did not happen. The artificiality of the virus also makes it unsuitable for vaccination, instead of the opposite, because that is the way the human tampering of nature works, the attempted purpose of its design is to do one thing, and it happens to result just the opposite thing than what was wanted: "...the naked coronavirus spike protein as a concept for the basis of a vaccine, which we have rejected because of high risk of contamination with human-like epitopes. Analysis of the Spike protein of SARS-CoV-2 shows 78.4% similarity with human-like (HL) epitopes..." and "... A search so tailored to match against all human known proteins will give a 78.4% human similarity to the SARS-CoV-2 Spike protein, i.e if all epitopes on the 1255 amino acid long SARS-CoV-2 Spike protein can be used by antibodies then there will be 983 antibody binding sites which also could bind to epitopes on human proteins..." The original article delving in all of those technicisms is: Sørensen, B., Susrud, A. and Dalgleish, A.G. Biovacc-19: A Candidate Vaccine for Covid-19 (SARS-CoV-2) Developed from Analysis of its General Method of Action for Infectivity. QRB Discovery (by Cambridge University Press) 2020:17 pp [Accepted Manuscript]: https://doi.org/10.1017/qrd.2020.8, so, this important article clearly indicates that if we do NOT realize the real origin and the real nature of this virus, we will continue deceived as per its treatment and its strategies of attack, and will be responsible for having on purpose dimmed the light of its artificial origin. Especially when we all are aware that the authors of "The Proximal…", Andersen et al. Nat. Med. 2020 article has been written by reefers that have ever been used for political purposes rather than scientific ones. So, apart as these three independent findings of that and many more related HIV sequences, we have another two sets of witnesses, totaling FIVE independent groups finding this: Mine, Zheng-Li's, and Sørensen's, but also:
4) Pradhan, from the Indian group that was forced to withdraw its article, who calls the contained sequence under consideration as the previous ones: "INSERT 1": TNGTKR, elongating the set of meaningful nucleotides as: TCTGGGACCAATGGTACTAAGAGG (SGTNGTKR): Pradhan, P. et al. Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag. Biorxiv 2020: 14 pp. (Withdrawn, 128 comments): https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1, they start describing their findings as follows: "We found four new insertions in the protein of 2019-nCoV- “GTNGTKR” (IS1)...", but this is not all, but also a fifth group, being this the one integrated by:
5) Perez and Montagnier (2008 Nobel Prize in Medicine, precisely for his discovery of the HIV virus), and they describe our found sequence within, together with a couple of tens more: TCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTG (SGTNGTKRFDNP..., finding them in here, fragments of SIV joined to the HIV-1A that I found, and sown in point "1"), from these sequences found by them, they start and end their meaningful conclusions, coming from the wisest of men, as follows: "1) 18 RNA fragments of homology equal or more than 80% with human or simian retroviruses have been found in the COVID_19 genome; 2) These fragments are 18 to 30 nucleotides long and therefore have the potential to modify the gene expression of Covid19. We have named them external Informative Elements or EIE; 3) These EIE are not dispersed randomly, but are concentrated in a small part of the COVID_19 genome... ...everything converges towards possible laboratory manipulations which contributed to modifications of the genome of COVID_19, but also, very probably much older SARS, with perhaps this double objective of vaccine design and of "gain of function" in terms of penetration of this virus into the cell. This analysis, made in silico, is dedicated to the real authors of Coronavirus COVID_19. It belongs only to them to describe their own experiments and why it turned into a world disaster: 400 000 lives, more than those taken by the two atomic bombs of Hiroshima and Nagasaki. We, the survivors, should take lessons from this serious alert for the future of humanity. We urge our colleagues scientists and medical doctors to respect ethical rules as expressed by Hippocrates oath: do not harm, never and never!"; an earlier manuscript of them can be found at: Perez, J.-C., and Montagnier, L. COVID-19, SARS and Bats Coronaviruses Genomes Unexpected Exogenous RNA Sequences. ResearchGate & OSF 2020:43 pp. [Older Manuscript]: https://osf.io/d9e5g/download/?format=pdf. I started my letter saying that I used to have respect for you. However, the standing taken as to ignore the real origins documented by these five research groups and by countless others, of the whole pre-planning of the current Pandemic by COVID-19, has made me to change my current opinion about you.
6) Arumugham also discusses such “Artificial selection at work… via recombination with HIV-1 derived inserts and selecting the viruses for efficient human kidney cell infection”, and my comment is again that to notice this artificial origin of COVID-19 is very important to do the proper treatment to patients, and to prevent another thing like this from emerging out of a Gain of Function “research”: Arumugham, V. Root cause of COVID-19? Biotechnology’s dirty secret: Contamination. Bioinformatics evidence demonstrates that SARS-CoV-2 was created in a laboratory, unlikely to be a bioweapon but most likely a result of sloppy experiments. Zenodo 2020:9 pp. (Manuscript saved at: https://archive.vn/N79Ci): https://zenodo.org/record/3766463#.Xuu9RTpKjIW
My experience on finding human artifacts on genomes dates back to the EcoRI palindromic linker that is contaminating thousands of sequences in the Genbank: Castro-Chavez, F. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes. DNA Cell Biol. 2012, 31(2):151-63: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3272245/
The freedoms of the whole humanity are at stake and the good God The Creator that you deeply respect, has put you in a key position as to be able to revert as soon as possible the current decline of the human values, and of the human nature in general, and this all because of a deliberate release of the current Sars-CoV-2. 9/11 was the first False Flag Operation aimed at stealing as much freedoms as possible from the human race, and the Fake Anthrax Attack of 2001 had the same purpose, releasing a pre-planned and very anti-patriotic document called the "Patriot" Act, which also included an immunity clause preventing the Pharmaceutical Industry of even more liabilities, but it was contested by the population, and it was removed. So, I wish to stop the GoF initiatives. Here we are today, contesting the "official" narrative of the current Plandemic as we did in the past with the “official” narratives of 9/11 when we discovered nano-bombs and fake planes injected into the TV screens. I expect to publish this letter on the open after you have read it. Only history will tell if TRUTH was able to win on this time over darkness, or if the criminals will get away once more... With my same thinking as at the beginning of the current letter (but praying that this could very soon change),
Fernando Castro-Chavez, PhD.
P. S.
My ongoing work can be found at the ResearchGate, while many pieces of it have been removed from the Facebook and from the YouTube by some heartless and brainless censors appointed by the WHO and by their owner, Bill Gates, apparently the mastermind chosen by the globalists to pull this event of an artificially manufactured viral harm for the whole of humanity. But as Mordechai told to Esther: "If you do nothing about it, God will raise somebody else to redeem us of this plague, because our clamors for freedom and for justice have already reached the Heavens". Jesus said that it will not be so easy for the believers to overcome evil in the current times, but that it could be possible. As Christian believers, we believe that as long as we continue over the earth, the total fruition of the plans of darkness can NOT prosper, and you may be a key member of the Body of Christ in order to fulfill such restraining against the forces of evil of this world. Thus far, the next are some of the sequences that seem to be inserts (some of them seem to have been started to be tampered since the RaTG13 "experiment" of Shi Zheng-Li, a genome she had since 2013 but that she did not publish until 2020 after the first Sars-CoV-2 had been published in China, genome that of the RaTG13 (previously published in part twice with different names that included the number 4991, which is dishonesty in science to change the names of the sequences, and that is what Shi just did!) which has been used, ironically, even with all its methodological anomalies to, precisely attempt to undermine the artificiality of the inserts, even two sequences published earlier by the Military of China seem to have been already tampered to make them more infectious, this is what happens when you only have the sequences provided by them with nobody else corroborating their authenticity), so, I may use the "probable" inserts clause, mostly from HIV-1, some few from HIV-2 and one from SIV (as explained by Perez & Montagnier, 2020). So, the number of artificial sequences is growing as research progresses, that is why, when people tries to discredit some of these from being artificially made, the burden is over them to explain how all of them got INSERTED into one same viral genome, which may have required a same animal cell with multiple different viruses and even bacteria exchanging only the specific required portions and no more, which is something naturally implausible but completely possible within a lab setting (then I add here the list from my previous posting in response to Jennifer Clarkson, adding that there, (most of those sequences are concatenated sequences)."
I have also added here my last comparison of the sequences found in Nsp3 by A. V., highly specific both to COVID-19 and to HIV-1.
The link by hero Robert F. Kennedy Jr. denouncing the big conflict of interests in which the NIH is involved: https://www.instagram.com/p/CCAcwVkHCec
And this Fourth of July, I present here some of the current sounds of my dear nation: https://archive.vn/THJ2h, https://ourrescue.org/, https://qmap.pub/ (saved at, as per today: https://archive.vn/Us7O8)...": https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031
Dr. Collins,
As I have had the blessed confidence to write to a brother in Christ since day one, I am sending you this important message.
With my best regards,
Fernando Castro-Chavez, PhD.
P.S:
I could not fit in the Letter this vital link that independently exposes the hoax imposed on humanity 19 years ago, let us do all we can to prevent this time to happen the same but in a wider scale (Most specially the roots, that are the last three chapters: 6, 7 and 8, for you that like music... good beats but disturbing lyrics): https://lbry.tv/@fdocc:b/AceBakerFinalVersionPart1:4, https://lbry.tv/@fdocc:b/AceBakerFinalVersionPart2:4
AT LEAST SIX RESEARCH GROUPS HAVE FOUND HIV INSERTS IN SARS-CoV-2
A Letter to Dr. Francis S. Collins,
Sir, Prompted by this article: Jun 25, 2020 – Health: The NIH claims joint ownership of Moderna's coronavirus vaccine: https://www.axios.com/moderna-nih-coronavirus-vaccine-ownership-agreements-22051c42-2dee-4b19-938d-099afd71f6a0.html (https://archive.vn/TArE3), I write to you, saying that we had a deep respect for you (my sister, my girl companion and my peers). The first letter I wrote to you was about Creation, in 2000, just having arrived from my country, and I wrote it in a bad English still, willing to live the American dream!!! Then, we saw you in person, and introduced ourselves, when you went to the BMC to give a speech about the Human Genome Project, I remember that you said something like: "Mendel is also there, in this slide, right there at the corner..."; then I wrote about our dreams to pursue, not only these Postdoctoral couple of jobs in Medicine, but also an MD Career, we two starting again from the scratch. Dreaming to be truthful and to really help humanity... However, now, I dedicate to you my current findings, humble, but nonetheless, they are still findings:
1) "COVID-19: AATGGTACTAAGAGG (NGTKR) = HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene (GU455503)". Finding also done by:
2) Shi Zheng-Li, from the WIV at Wuhan and co-author of Ralph Baric, and she distinctively calls it an "INSERTION" (she puts it as: GTNGTKR, GGGACCAATGGTACTAAGAGG, adding other two more, but skipping the key one: The Furin Site!), whose putative function is immunosuppressant, as she says that those INSERTIONS have: "sialic-acid-binding activity", at: Zhou, P., plus 27 et als & Zheng-Li Shi. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 2020:579:270-73, & 16pp: https://www.nature.com/articles/s41586-020-2012-7.pdf; a third group that found these unique INSERTS is that of:
3) Sørensen (identical to the previous one: GTNGTKR, but also studying, to leave no doubts, its functional span by performing 6 by 6 NT iterations containing our sequence of interest (and of many others), such as: VSGTNG, SGTNGT, TNGTKR, NGTKRF, etc.), who says in an interview, as he found many more INSERTS (saved at: https://archive.vn/7TPTc): "The INSERTED sequences have a functionality that we describe. We explain why they are essential: ...accumulated charge from inserts and salt bridges are in surface positions capable of binding with cell membrane components other than the ACE2 receptor." This statement is very important and indicates that if we realize that this virus is NOT natural we could be and have been better prepared since the start to fight against it in a more logical, rational and prepared way, which did not happen. The artificiality of the virus also makes it unsuitable for vaccination, instead of the opposite, because that is the way the human tampering of nature works, the attempted purpose of its design is to do one thing, and it happens to result just the opposite thing than what was wanted: "...the naked coronavirus spike protein as a concept for the basis of a vaccine, which we have rejected because of high risk of contamination with human-like epitopes. Analysis of the Spike protein of SARS-CoV-2 shows 78.4% similarity with human-like (HL) epitopes..." and "... A search so tailored to match against all human known proteins will give a 78.4% human similarity to the SARS-CoV-2 Spike protein, i.e if all epitopes on the 1255 amino acid long SARS-CoV-2 Spike protein can be used by antibodies then there will be 983 antibody binding sites which also could bind to epitopes on human proteins..." The original article delving in all of those technicisms is: Sørensen, B., Susrud, A. and Dalgleish, A.G. Biovacc-19: A Candidate Vaccine for Covid-19 (SARS-CoV-2) Developed from Analysis of its General Method of Action for Infectivity. QRB Discovery (by Cambridge University Press) 2020:17 pp [Accepted Manuscript]: https://doi.org/10.1017/qrd.2020.8, so, this important article clearly indicates that if we do NOT realize the real origin and the real nature of this virus, we will continue deceived as per its treatment and its strategies of attack, and will be responsible for having on purpose dimmed the light of its artificial origin. Especially when we all are aware that the authors of "The Proximal…", Andersen et al. Nat. Med. 2020 article has been written by reefers that have ever been used for political purposes rather than scientific ones. So, apart as these three independent findings of that and many more related HIV sequences, we have another two sets of witnesses, totaling FIVE independent groups finding this: Mine, Zheng-Li's, and Sørensen's, but also:
4) Pradhan, from the Indian group that was forced to withdraw its article, who calls the contained sequence under consideration as the previous ones: "INSERT 1": TNGTKR, elongating the set of meaningful nucleotides as: TCTGGGACCAATGGTACTAAGAGG (SGTNGTKR): Pradhan, P. et al. Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag. Biorxiv 2020: 14 pp. (Withdrawn, 128 comments): https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1, they start describing their findings as follows: "We found four new insertions in the protein of 2019-nCoV- “GTNGTKR” (IS1)...", but this is not all, but also a fifth group, being this the one integrated by:
5) Perez and Montagnier (2008 Nobel Prize in Medicine, precisely for his discovery of the HIV virus), and they describe our found sequence within, together with a couple of tens more: TCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTG (SGTNGTKRFDNP..., finding them in here, fragments of SIV joined to the HIV-1A that I found, and sown in point "1"), from these sequences found by them, they start and end their meaningful conclusions, coming from the wisest of men, as follows: "1) 18 RNA fragments of homology equal or more than 80% with human or simian retroviruses have been found in the COVID_19 genome; 2) These fragments are 18 to 30 nucleotides long and therefore have the potential to modify the gene expression of Covid19. We have named them external Informative Elements or EIE; 3) These EIE are not dispersed randomly, but are concentrated in a small part of the COVID_19 genome... ...everything converges towards possible laboratory manipulations which contributed to modifications of the genome of COVID_19, but also, very probably much older SARS, with perhaps this double objective of vaccine design and of "gain of function" in terms of penetration of this virus into the cell. This analysis, made in silico, is dedicated to the real authors of Coronavirus COVID_19. It belongs only to them to describe their own experiments and why it turned into a world disaster: 400 000 lives, more than those taken by the two atomic bombs of Hiroshima and Nagasaki. We, the survivors, should take lessons from this serious alert for the future of humanity. We urge our colleagues scientists and medical doctors to respect ethical rules as expressed by Hippocrates oath: do not harm, never and never!"; an earlier manuscript of them can be found at: Perez, J.-C., and Montagnier, L. COVID-19, SARS and Bats Coronaviruses Genomes Unexpected Exogenous RNA Sequences. ResearchGate & OSF 2020:43 pp. [Older Manuscript]: https://osf.io/d9e5g/download/?format=pdf. I started my letter saying that I used to have respect for you. However, the standing taken as to ignore the real origins documented by these five research groups and by countless others, of the whole pre-planning of the current Pandemic by COVID-19, has made me to change my current opinion about you.
6) Arumugham also discusses such “Artificial selection at work… via recombination with HIV-1 derived inserts and selecting the viruses for efficient human kidney cell infection”, and my comment is again that to notice this artificial origin of COVID-19 is very important to do the proper treatment to patients, and to prevent another thing like this from emerging out of a Gain of Function “research”: Arumugham, V. Root cause of COVID-19? Biotechnology’s dirty secret: Contamination. Bioinformatics evidence demonstrates that SARS-CoV-2 was created in a laboratory, unlikely to be a bioweapon but most likely a result of sloppy experiments. Zenodo 2020:9 pp. (Manuscript saved at: https://archive.vn/N79Ci): https://zenodo.org/record/3766463#.Xuu9RTpKjIW
My experience on finding human artifacts on genomes dates back to the EcoRI palindromic linker that is contaminating thousands of sequences in the Genbank: Castro-Chavez, F. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes. DNA Cell Biol. 2012, 31(2):151-63: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3272245/
The freedoms of the whole humanity are at stake and the good God The Creator that you deeply respect, has put you in a key position as to be able to revert as soon as possible the current decline of the human values, and of the human nature in general, and this all because of a deliberate release of the current Sars-CoV-2. 9/11 was the first False Flag Operation aimed at stealing as much freedoms as possible from the human race, and the Fake Anthrax Attack of 2001 had the same purpose, releasing a pre-planned and very anti-patriotic document called the "Patriot" Act, which also included an immunity clause preventing the Pharmaceutical Industry of even more liabilities, but it was contested by the population, and it was removed. So, I wish to stop the GoF initiatives. Here we are today, contesting the "official" narrative of the current Plandemic as we did in the past with the “official” narratives of 9/11 when we discovered nano-bombs and fake planes injected into the TV screens. I expect to publish this letter on the open after you have read it. Only history will tell if TRUTH was able to win on this time over darkness, or if the criminals will get away once more... With my same thinking as at the beginning of the current letter (but praying that this could very soon change),
Fernando Castro-Chavez, PhD.
P. S.
My ongoing work can be found at the ResearchGate, while many pieces of it have been removed from the Facebook and from the YouTube by some heartless and brainless censors appointed by the WHO and by their owner, Bill Gates, apparently the mastermind chosen by the globalists to pull this event of an artificially manufactured viral harm for the whole of humanity. But as Mordechai told to Esther: "If you do nothing about it, God will raise somebody else to redeem us of this plague, because our clamors for freedom and for justice have already reached the Heavens". Jesus said that it will not be so easy for the believers to overcome evil in the current times, but that it could be possible. As Christian believers, we believe that as long as we continue over the earth, the total fruition of the plans of darkness can NOT prosper, and you may be a key member of the Body of Christ in order to fulfill such restraining against the forces of evil of this world. Thus far, the next are some of the sequences that seem to be inserts (some of them seem to have been started to be tampered since the RaTG13 "experiment" of Shi Zheng-Li, a genome she had since 2013 but that she did not publish until 2020 after the first Sars-CoV-2 had been published in China, genome that of the RaTG13 (previously published in part twice with different names that included the number 4991, which is dishonesty in science to change the names of the sequences, and that is what Shi just did!) which has been used, ironically, even with all its methodological anomalies to, precisely attempt to undermine the artificiality of the inserts, even two sequences published earlier by the Military of China seem to have been already tampered to make them more infectious, this is what happens when you only have the sequences provided by them with nobody else corroborating their authenticity), so, I may use the "probable" inserts clause, mostly from HIV-1, some few from HIV-2 and one from SIV (as explained by Perez & Montagnier, 2020). So, the number of artificial sequences is growing as research progresses, that is why, when people tries to discredit some of these from being artificially made, the burden is over them to explain how all of them got INSERTED into one same viral genome, which may have required a same animal cell with multiple different viruses and even bacteria exchanging only the specific required portions and no more, which is something naturally implausible but completely possible within a lab setting (then I add here the list from my previous posting in response to Jennifer Clarkson, adding that there, (most of those sequences are concatenated sequences)."
I have also added here my last comparison of the sequences found in Nsp3 by A. V., highly specific both to COVID-19 and to HIV-1.
The link by hero Robert F. Kennedy Jr. denouncing the big conflict of interests in which the NIH is involved: https://www.instagram.com/p/CCAcwVkHCec
And this Fourth of July, I present here some of the current sounds of my dear nation: https://archive.vn/THJ2h, https://ourrescue.org/, https://qmap.pub/ (saved at, as per today: https://archive.vn/Us7O8)...": https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031
Exposing another layer of deception on 9/11, not only the TV Fakery used to improve the appearance of the non-existent plane, but a HOLOGRAM indeed was seen and filmed, moving at a speed of 580 MPH, something impossible for a real plane, plus, not only Nano-Atomic energy seems to have been used, or "Super-Thermate" (but Steven E. Jones seem to be a shill paid by Romney, both Mormons, because being he a Nuclear Physicist that worked at LOS ALAMOS, of anybody else, he should have been the one acquainted with the results of the USGS reported below, and that the "planes" where HOLOGRAMS, as also seen below, and he plays the "oblivious", which seems to be extremely disingenuous for me, his deliberately limited and close-minded standing does not adds-up to the full set of the available evidence!!!), but most especially the most advanced at the time "Directed Energy Weapon" so as to change from solid Iron to dust in a whim most of the iron of the WTC (at least some 80% of that Iron was transformed into microparticles), by using several technologies to simulate the "planes" and to actually destroy the WTC the clever planners have now sown the seeds of division amongst the students of what really happened on 9/11, so that is sad, the way ones attack the others like wolfs against felines... so, from this video, just tone down the attack that the maker does against almost everybody else researching 9/11: https://www.youtube.com/watch?v=CrzNeZUp0tU, like he attacks unmercifully Bollyn, but I think he has something good in his work; he attacks Baker, but I think he also has something useful in his work, he attacks Gage, founder of Architects and Engineers for 9/11 truth, then he praises Wood, even when she also is shortsighted dismissing the Nano-Atomic trace elements reported both by Cahill and by the USGS, she also ignores molten metal that was fuming during months as per the atomic fission, the cracking of the compression, also called the "meteorite", and the carbon nanotubes found inside the lungs of the first responders... so, that behavior of him reduces the value on the way he presents his case, even if a lot of information is good, such as the symmetrical QuasiCrystals that we saw before in the Israeli Nobel Prize that earlier @[506429089:2048:Michael Jagdeo] introduced to me (there we see that Nobel Chemist from Israel who developed the HOLOGRAMS for the 9/11 WTC "planes" illusion at approx. time of 1:13:26) sent to me, as some of the Israeli-Chinese most advanced Holographic technology at the time of 9/11 to have produced the illusion of planes when all it was were HOLOGRAMS melting into the WTC towers, HOLOGRAMS melting into the Pentagon and Shanksville, PA, while using DEW plus other kinds of explosive technologies, especially at the WTC... so shame on Bush, Cheney, Rumsfeld, PNAC and Mossad that pulled the deception of 9/11!!!
Updated Jul 4, 2020, 3:21 PM
Fernando Castro-Chavez shared a memory.
For God and Country!!!! Let Truth, Goodness and Justice still prevail while we continue on this still God-given to us whole planet earth!!! Kudos to the rescuers of thousands upon thousands of children that were reduced from the worst situations by their evil captors! Way to go Mr. Trump!!!!
Updated Jul 4, 2020, 7:08 AM
This is the second part of the video that I had originally in the YouTube: https://lbry.tv/@fdocc:b/AceBakerFinalVersionPart2:4
Updated Jul 2, 2020, 11:12 AM
After having this video removed by the YouTube, I went to upload the first part of it at LBRY: https://lbry.tv/@fdocc:b/AceBakerFinalVersionPart1:4
Updated Jul 2, 2020, 9:20 AM
Fernando Castro-Chavez updated his status.
From Dear Robert F. Kennedy Jr.: https://www.instagram.com/p/CCAcwVkHCec/
One of the BEST researches on why and how the supposed "planes" hitting the WTC on 9/11 were completely CGI, false, there were no real planes hitting the WTC, a 580 MPH Tomhawk missile disguised as "plane", as any little mistake by real "planes" and completely incompetent to fly an airplane patsies, would had jeopardized the, planned during 30 years operation by Bush, Cheney, Rumsfeld, PNAC and by Mossad:
Updated Jul 1, 2020, 3:21 PM
Two Big Excerpts:
"[1]
June 7, 2020
...
Mr. President,
In recent months we have been witnessing the formation of two opposing sides that I would call Biblical: the children of light and the children of darkness. The children of light constitute the most conspicuous part of humanity, while the children of darkness represent an absolute minority. And yet the former are the object of a sort of discrimination which places them in a situation of moral inferiority with respect to their adversaries, who often hold strategic positions in government, in politics, in the economy and in the media. In an apparently inexplicable way, the good are held hostage by the wicked and by those who help them either out of self-interest or fearfulness.
These two sides, which have a Biblical nature, follow the clear separation between the offspring of the Woman and the offspring of the Serpent. On the one hand, there are those who, although they have a thousand defects and weaknesses, are motivated by the desire to do good, to be honest, to raise a family, to engage in work, to give prosperity to their homeland, to help the needy, and, in obedience to the Law of God, to merit the Kingdom of Heaven. On the other hand, there are those who serve themselves, who do not hold any moral principles, who want to demolish the family and the nation, exploit workers to make themselves unduly wealthy, foment internal divisions and wars, and accumulate power and money: for them the fallacious illusion of temporal well-being will one day – if they do not repent – yield to the terrible fate that awaits them, far from God, in eternal damnation.
We will also discover that the riots in these days were provoked by those who, seeing that the virus is inevitably fading and that the social alarm of the pandemic is waning, necessarily have had to provoke civil disturbances, because they would be followed by repression which, although legitimate, could be condemned as an unjustified aggression against the population. The same thing is also happening in Europe, in perfect synchrony. It is quite clear that the use of street protests is instrumental to the purposes of those who would like to see someone elected in the upcoming presidential elections who embodies the goals of the deep state and who expresses those goals faithfully and with conviction. It will not be surprising if, in a few months, we learn once again that hidden behind these acts of vandalism and violence there are those who hope to profit from the dissolution of the social order so as to build a world without freedom: Solve et Coagula, as the Masonic adage teaches.
Although it may seem disconcerting, the opposing alignments I have described are also found in religious circles. There are faithful Shepherds who care for the flock of Christ, but there are also mercenary infidels who seek to scatter the flock and hand the sheep over to be devoured by ravenous wolves. It is not surprising that these mercenaries are allies of the children of darkness and hate the children of light: just as there is a deep state, there is also a deep church that betrays its duties and forswears its proper commitments before God. Thus the Invisible Enemy, whom good rulers fight against in public affairs, is also fought against by good shepherds in the ecclesiastical sphere. It is a spiritual battle, which I spoke about in my recent Appeal which was published on May 8.In society, Mr. President, these two opposing realities co-exist as eternal enemies, just as God and Satan are eternal enemies. And it appears that the children of darkness – whom we may easily identify with the deep state which you wisely oppose and which is fiercely waging war against you in these days – have decided to show their cards, so to speak, by now revealing their plans. They seem to be so certain of already having everything under control that they have laid aside that circumspection that until now had at least partially concealed their true intentions. The investigations already under way will reveal the true responsibility of those who managed the COVID emergency not only in the area of health care but also in politics, the economy, and the media. We will probably find that in this colossal operation of social engineering there are people who have decided the fate of humanity, arrogating to themselves the right to act against the will of citizens and their representatives in the governments of nations.
__
[2]
For the first time, the United States has in you a President who courageously defends the right to life, who is not ashamed to denounce the persecution of Christians throughout the world, who speaks of Jesus Christ and the right of citizens to freedom of worship. Your participation in the March for Life, and more recently your proclamation of the month of April as National Child Abuse Prevention Month, are actions that confirm which side you wish to fight on. And I dare to believe that both of us are on the same side in this battle, albeit with different weapons.
For this reason, I believe that the attack to which you were subjected after your visit to the National Shrine of Saint John Paul II is part of the orchestrated media narrative which seeks not to fight racism and bring social order, but to aggravate dispositions; not to bring justice, but to legitimize violence and crime; not to serve the truth, but to favor one political faction. And it is disconcerting that there are Bishops – such as those whom I recently denounced – who, by their words, prove that they are aligned on the opposing side. They are subservient to the deep state, to globalism, to aligned thought, to the New World Order which they invoke ever more frequently in the name of a universal brotherhood which has nothing Christian about it, but which evokes the Masonic ideals of those who want to dominate the world by driving God out of the courts, out of schools, out of families, and perhaps even out of churches.
The American people are mature and have now understood how much the mainstream media does not want to spread the truth but seeks to silence and distort it, spreading the lie that is useful for the purposes of their masters. However, it is important that the good – who are the majority – wake up from their sluggishness and do not accept being deceived by a minority of dishonest people with unavowable purposes. It is necessary that the good, the children of light, come together and make their voices heard. What more effective way is there to do this, Mr. President, than by prayer, asking the Lord to protect you, the United States, and all of humanity from this enormous attack of the Enemy? Before the power of prayer, the deceptions of the children of darkness will collapse, their plots will be revealed, their betrayal will be shown, their frightening power will end in nothing, brought to light and exposed for what it is: an infernal deception.
Mr. President, my prayer is constantly turned to the beloved American nation, where I had the privilege and honor of being sent by Pope Benedict XVI as Apostolic Nuncio. In this dramatic and decisive hour for all of humanity, I am praying for you and also for all those who are at your side in the government of the United States. I trust that the American people are united with me and you in prayer to Almighty God.
United against the Invisible Enemy of all humanity, I bless you and the First Lady, the beloved American nation, and all men and women of good will.
+ Carlo Maria Viganò
Titular Archbishop of Ulpiana
Former Apostolic Nuncio to the United States of America."
"[1]
June 7, 2020
...
Mr. President,
In recent months we have been witnessing the formation of two opposing sides that I would call Biblical: the children of light and the children of darkness. The children of light constitute the most conspicuous part of humanity, while the children of darkness represent an absolute minority. And yet the former are the object of a sort of discrimination which places them in a situation of moral inferiority with respect to their adversaries, who often hold strategic positions in government, in politics, in the economy and in the media. In an apparently inexplicable way, the good are held hostage by the wicked and by those who help them either out of self-interest or fearfulness.
These two sides, which have a Biblical nature, follow the clear separation between the offspring of the Woman and the offspring of the Serpent. On the one hand, there are those who, although they have a thousand defects and weaknesses, are motivated by the desire to do good, to be honest, to raise a family, to engage in work, to give prosperity to their homeland, to help the needy, and, in obedience to the Law of God, to merit the Kingdom of Heaven. On the other hand, there are those who serve themselves, who do not hold any moral principles, who want to demolish the family and the nation, exploit workers to make themselves unduly wealthy, foment internal divisions and wars, and accumulate power and money: for them the fallacious illusion of temporal well-being will one day – if they do not repent – yield to the terrible fate that awaits them, far from God, in eternal damnation.
We will also discover that the riots in these days were provoked by those who, seeing that the virus is inevitably fading and that the social alarm of the pandemic is waning, necessarily have had to provoke civil disturbances, because they would be followed by repression which, although legitimate, could be condemned as an unjustified aggression against the population. The same thing is also happening in Europe, in perfect synchrony. It is quite clear that the use of street protests is instrumental to the purposes of those who would like to see someone elected in the upcoming presidential elections who embodies the goals of the deep state and who expresses those goals faithfully and with conviction. It will not be surprising if, in a few months, we learn once again that hidden behind these acts of vandalism and violence there are those who hope to profit from the dissolution of the social order so as to build a world without freedom: Solve et Coagula, as the Masonic adage teaches.
Although it may seem disconcerting, the opposing alignments I have described are also found in religious circles. There are faithful Shepherds who care for the flock of Christ, but there are also mercenary infidels who seek to scatter the flock and hand the sheep over to be devoured by ravenous wolves. It is not surprising that these mercenaries are allies of the children of darkness and hate the children of light: just as there is a deep state, there is also a deep church that betrays its duties and forswears its proper commitments before God. Thus the Invisible Enemy, whom good rulers fight against in public affairs, is also fought against by good shepherds in the ecclesiastical sphere. It is a spiritual battle, which I spoke about in my recent Appeal which was published on May 8.In society, Mr. President, these two opposing realities co-exist as eternal enemies, just as God and Satan are eternal enemies. And it appears that the children of darkness – whom we may easily identify with the deep state which you wisely oppose and which is fiercely waging war against you in these days – have decided to show their cards, so to speak, by now revealing their plans. They seem to be so certain of already having everything under control that they have laid aside that circumspection that until now had at least partially concealed their true intentions. The investigations already under way will reveal the true responsibility of those who managed the COVID emergency not only in the area of health care but also in politics, the economy, and the media. We will probably find that in this colossal operation of social engineering there are people who have decided the fate of humanity, arrogating to themselves the right to act against the will of citizens and their representatives in the governments of nations.
__
[2]
For the first time, the United States has in you a President who courageously defends the right to life, who is not ashamed to denounce the persecution of Christians throughout the world, who speaks of Jesus Christ and the right of citizens to freedom of worship. Your participation in the March for Life, and more recently your proclamation of the month of April as National Child Abuse Prevention Month, are actions that confirm which side you wish to fight on. And I dare to believe that both of us are on the same side in this battle, albeit with different weapons.
For this reason, I believe that the attack to which you were subjected after your visit to the National Shrine of Saint John Paul II is part of the orchestrated media narrative which seeks not to fight racism and bring social order, but to aggravate dispositions; not to bring justice, but to legitimize violence and crime; not to serve the truth, but to favor one political faction. And it is disconcerting that there are Bishops – such as those whom I recently denounced – who, by their words, prove that they are aligned on the opposing side. They are subservient to the deep state, to globalism, to aligned thought, to the New World Order which they invoke ever more frequently in the name of a universal brotherhood which has nothing Christian about it, but which evokes the Masonic ideals of those who want to dominate the world by driving God out of the courts, out of schools, out of families, and perhaps even out of churches.
The American people are mature and have now understood how much the mainstream media does not want to spread the truth but seeks to silence and distort it, spreading the lie that is useful for the purposes of their masters. However, it is important that the good – who are the majority – wake up from their sluggishness and do not accept being deceived by a minority of dishonest people with unavowable purposes. It is necessary that the good, the children of light, come together and make their voices heard. What more effective way is there to do this, Mr. President, than by prayer, asking the Lord to protect you, the United States, and all of humanity from this enormous attack of the Enemy? Before the power of prayer, the deceptions of the children of darkness will collapse, their plots will be revealed, their betrayal will be shown, their frightening power will end in nothing, brought to light and exposed for what it is: an infernal deception.
Mr. President, my prayer is constantly turned to the beloved American nation, where I had the privilege and honor of being sent by Pope Benedict XVI as Apostolic Nuncio. In this dramatic and decisive hour for all of humanity, I am praying for you and also for all those who are at your side in the government of the United States. I trust that the American people are united with me and you in prayer to Almighty God.
United against the Invisible Enemy of all humanity, I bless you and the First Lady, the beloved American nation, and all men and women of good will.
+ Carlo Maria Viganò
Titular Archbishop of Ulpiana
Former Apostolic Nuncio to the United States of America."
And God told us: You will renew your strength like the eagle, you just need to keep on moving, you just need to keep going, I WILL take care of all the needed resources, but Sweet Child of Mine: MOVE!!!
Updated Jul 1, 2020, 10:09 AM
What lies beyond, the Great Beyond, God knows, but also we could, if we just had our soaring wings like eagles... but the day will come, to do like the angels do, the invisible traveling around all earth through the skies... and the traveling to every single corner of this Universe that belongs to US: The Children of our Dear GOD!!!
Updated Jul 1, 2020, 10:08 AM
It reminds me of that great moment when we are learning to fly, in the twinkling of an eye, instantly from these beauties to some even more greater than still the eye has never seen and the ear has never heard of.... about their unfathomable songs!!!
Updated Jul 1, 2020, 10:05 AM
Nature is oblivious to what dirty men hold in their brains, Nature just goes on and on and on with Life!!! So do we, but we do well with an eternal life that we are carrying inside!!! Cheers with a cold beer from the current mountains, for God, for Country, for our spiritual family, and for His wondrous Nature!!!
Updated Jul 1, 2020, 10:03 AM
Ever Green!!! God says that this Earth is to remain forever, and there will be a new earth, my nugget of a brain can not fathom all that He is saying, but I just believe!!! He will do it and His good creation, as it was perfect, is also fit to remain, how will He do it? He KNOWS, not me!
Updated Jul 1, 2020, 9:59 AM
Landscapes, Sweet Scapes, Great Escapes!!!
Updated Jul 1, 2020, 9:57 AM
God, this is all that I needed, Lady, Horizons, Freedom, Fresh Air To Breathe, what else from Your Heavens do You have in store for me???
Updated Jul 1, 2020, 9:56 AM
Look Stinky Satan, I am here, in one feet, behind me is the abyss, but here in front of me is my sweet Lord and my Rock, I am scared about nothing, I have no leash surrounding my mouth, I am not a servant of twisted men, I am a DOULOS of Jesus!!! And he says: Stay Put!!!
Updated Jul 1, 2020, 9:55 AM
At the border of the abyss, with a good partner, companion, lady and rock, nothing else matters!!!
Updated Jul 1, 2020, 9:52 AM
Rivers, Hikes, Critters, God, we can extend as long as God wants us to stay here, out of the ravaging anger of the crazy men on earth, from these heavens in the power invested by God to us we command: Satan, stay frozen, with no movement whatsoever, we order you to be restrained in full, until we are gone, then you can get loose as long as you wish, but NOT now, stay confined to that little corner of this planet!!! We command you that, in the living name of our Boss, Our Sweet Jesus!!!
Updated Jul 1, 2020, 9:51 AM
Eating what the Nature of our Good God provides, we are completely oblivious to the pre-meditated scare that heinous humans are imposing over all of the humanity, we have GOD and that is ALL!!!
Updated Jul 1, 2020, 9:48 AM
And the day will come, when we will just, as Christians, disappear in the clouds from this earth, then divisions, prejudices, judgmental stances, despite and scorn will finally be over amongst Christians!!! I am more happy with Jesus about that than about anything else!!!
Updated Jul 1, 2020, 9:45 AM
We can be at the border of the precipice, but with God, this is like nothing to worry about!!!
Updated Jul 1, 2020, 9:43 AM
His WORDS and WORKS say it all:
Updated Jul 1, 2020, 9:41 AM
Under the suspended rock, like that proverbial sword over our heads, but with a GOD that stops them from falling over us, until our last mission for GOD is completed over this, still good earth where our God rules (as we born-again ones are still walking over it!!!)
Updated Jul 1, 2020, 9:39 AM
Landscapes belonging to our own Skyscapes!!!
Updated Jul 1, 2020, 9:35 AM
Millions of uncharted organisms are still all around us, they are for our free leisure and enjoyment!!! Sorry Gates, you will never be able to own everything!!!
Updated Jul 1, 2020, 9:34 AM
And God says: "I am the God of the Waters, I live surrounded by waters, I am the generator of living waters, I am the one that lets you be a perennial fountain of living waters"!!!
Updated Jul 1, 2020, 9:32 AM
When humans in high places became the real pests, just remember 9/11 sponsored by Bush himself and by Mossad, or COVID-19 sponsored by Gates and by the CCP, the little beasts of the field became our most faithful companions!!!
Updated Jul 1, 2020, 9:31 AM
There is a free space, there is a free sky, there is a natural essence that I can inhale, and I am feeling good!!!
Updated Jul 1, 2020, 9:28 AM
Horizons with our real three stripes of Creation: Blue, Green and White in all of their possible combinations:
Updated Jul 1, 2020, 9:27 AM
The beauty of freedom!!! Of nature, and of the perennial sense that God is Really Here for US, protecting us and taking care of even the smallest need of us, His dearly children!!! Not because we "deserve" them, but because HE is our Father!!!
Updated Jul 1, 2020, 9:26 AM
Fragments that present some of the things that demonstrate the high technology used to bring down the WTC-1 and WTC-2, being the nano-atomic signature that destroyed those towers the ever present correlation of Strontium and Barium in the WTC dust, plus the abundant presence of Tritium on the water of the Hudson river; in Spanish I presented that earlier as: https://www.youtube.com/watch?v=3X2RYw0huik and https://www.youtube.com/watch?v=6q3Zuq0n03, exposing the lies of the past helps as antidote for the lies of the present, and at least our closest ones are aware as not to let down their CONFIDENCE on the protection of God no matter what! But as researcher, I think that it is my duty to point out these things, even if nobody else will listen, I DO NOT care about popularity, but about telling the truth, if many see it, great! If nobody sees it, also great because at least we are doing our JOB as unto the Lord and not unto men, that was the teaching of Jeremiah, you see, even Paul, was first worshipped and then stoned, in the very same day!!!: https://www.researchgate.net/post/Ninth_Sequence_Of_Events_WTC_NY_9_11_01_3-D_Reconstruction_of_those_Attacks_Based_on_its_Recorded_Videos_and_Photos_and_the_Best_Integrative_Software |
Fragments that present some of the things that demonstrate the high technology used to bring down the WTC-1 and WTC-2, being the nano-atomic signature that destroyed those towers the ever present correlation of Strontium and Barium in the WTC dust, plus the abundant presence of Tritium on the water of the Hudson river; in Spanish I presented that earlier as: https://www.youtube.com/watch?v=3X2RYw0huik and https://www.youtube.com/watch?v=6q3Zuq0n03, exposing the lies of the past helps as antidote for the lies of the present, and at least our closest ones are aware as not to let down their CONFIDENCE on the protection of God no matter what! But as researcher, I think that it is my duty to point out these things, even if nobody else will listen, I DO NOT care about popularity, but about telling the truth, if many see it, great! If nobody sees it, also great because at least we are doing our JOB as unto the Lord and not unto men, that was the teaching of Jeremiah, you see, even Paul, was first worshipped and then stoned, in the very same day!!!: https://www.researchgate.net/post/Ninth_Sequence_Of_Events_WTC_NY_9_11_01_3-D_Reconstruction_of_those_Attacks_Based_on_its_Recorded_Videos_and_Photos_and_the_Best_Integrative_Software
On 9/11, real Airplanes do not perforate both sides of an Iron structure, but nano-nuclear explosives do...., plus special effects of sound and imaging input on the videos to make the pre planted explosive charges look like "planes": https://www.youtube.com/watch?v=T_ssENU8OAw (In this movie, the aspects that I investigated in due time appear in minutes 2:06:22 to 2:17:44, https://pubmed.ncbi.nlm.nih.gov/21743816/, Figs. 2 and 4, always seeking the truth to be known, NOT at all a personal recognition): so, exposing the lie from 2001 help us understand the current lie of 2020, interlaced with real tragedy...
Basically, we are living today at once, all the worst things that were done during the dark and perverted administration of earthly demons Bush, Cheney and Rumsfeld, from a 9/11 (that they themselves DID with the help of Mossad) in slow motion and in steroids, to the 2008 financial crisis..., their aim is to gain control of every living human being on earth, using the necessary tactics to scare as many humans as they can, by using a completely sold-out to the devil mainstream media, as we read within the pages of one of their many footprints, their awful PNAC membership document:
Missing my Beloved Girl: https://www.youtube.com/watch?v=SG3yW9t5j70
Updated Jun 27, 2020, 10:23 PM
Thus far, the corrupt Deep State at the Pentagon has stolen $35 Trillion Dollars from the American Citizens: https://archive.vn/GE0dt (SIXTEEN times MORE than what Trump has given to those COVID-19 jobless Citizens of the USA!!! (thus far, I do NOT want, not even a penny of that money!!!), and it may be even way far more!), in 2013 its robbery was supposedly of $8.5 Trillions (but again, it may be way far more, one woman (one of the many) was devoted during 15 years only to "doctoring" the accounting books): https://archive.vn/Qnc1l, by 9/11 and the next year, the steal was of $3.2 Trillion Dollars, plus other $2.9 Trillions also unaccounted for, so, in 2002 the steal was of $6.1 Trillions, as per the sums seen at: https://www.youtube.com/watch?v=n3xgjxJwedA, in the selected excerpt of that video, we can see ex-CIA Robert Baer, the real-life character of Clooney's "Syriana", indicating that the insiders that knew of the Bush Administration - PNAC plan to produce the "self-inflicted" (with Mossad help) 9/11, did a lot of money in the Stock Market and the Put Options (The completely useless media has never investigated those claims nor those of Bob Kerrey, ex-9/11 Commissioner stated in one comment of my previous posting about 9/11 being prepared at least since the 70s, and the WTC was inaugurated in 1973... is the USA already "fried" by infiltrated Zionist traitors: https://archive.vn/HEAxR coupled to "those money lovers" of every nation, to the point of NO return....??? Only God knows) |
Thus far, the corrupt Deep State at the Pentagon has stolen $35 Trillion Dollars from the American Citizens: https://archive.vn/GE0dt (SIXTEEN times MORE than what Trump has given to those COVID-19 jobless Citizens of the USA!!! (thus far, I do NOT want, not even a penny of that money!!!), and it may be even way far more!), in 2013 its robbery was supposedly of $8.5 Trillions (but again, it may be way far more, one woman (one of the many) was devoted during 15 years only to "doctoring" the accounting books): https://archive.vn/Qnc1l, by 9/11 and the next year, the steal was of $3.2 Trillion Dollars, plus other $2.9 Trillions also unaccounted for, so, in 2002 the steal was of $6.1 Trillions, as per the sums seen at: https://www.youtube.com/watch?v=n3xgjxJwedA, in the selected excerpt of that video, we can see ex-CIA Robert Baer, the real-life character of Clooney's "Syriana", indicating that the insiders that knew of the Bush Administration - PNAC plan to produce the "self-inflicted" (with Mossad help) 9/11, did a lot of money in the Stock Market and the Put Options (The completely useless media has never investigated those claims nor those of Bob Kerrey, ex-9/11 Commissioner stated in one comment of my previous posting about 9/11 being prepared at least since the 70s, and the WTC was inaugurated in 1973... is the USA already "fried" by infiltrated Zionist traitors: https://archive.vn/HEAxR coupled to "those money lovers" of every nation, to the point of NO return....??? Only God knows)
My posting of today at RG goes as follows: Recently, bold Meryl Nass declared to Dr. Mercola: "...I do have an extensive background in biological warfare and I know what kinds of things have been created in the past, what it takes, where they may be made and how it has been done. So, I remained curious. And then in the end of February, the later part of February, a group of scientists wrote a piece that was published in The Lancet and it was a very curious piece to me... It didn't make sense. Yeah. And these were very prominent people, including the former head of the National Science Foundation, one of the former top people at CDC and other very prominent people. What they said is, "We need to quash the rumors of the fact that this came from a lab. That is conspiracy theory and we need to get rid of it. We have to stand with our colleagues in China. We all need to work together. We can't start problems with the Chinese basically." And so what this group was doing in a
very short, less than a page, brief letter, was conflating the idea that this might've come from a lab with the fact that that would interfere with the US-China relationship. And we couldn't interfere with that because we needed China's information and maybe China's products to fight the coronavirus. / So we had to put this idea aside. Well, I scratched my head and said, "That doesn't really make sense, but okay, these are political people." Then a couple of weeks later, an article came out in Nature Medicine, which said, "Here we have the scientific proof that this did not come from a lab. That there are certain things about this virus." And they talked about the two things that have been identified by others as the most problematic. These two sites on the spike genome, which seemed to enhance the tropism and the binding. So it just makes it easier for the virus to get into human cells. And they took these two areas and said, "Look, these mutations that are found in the new CoV-2 virus, which are not seen in any of the other bat viruses anywhere near it must have come from the wild because these weren't created in the ways that we virologists would have created it."
To read the full interview: https://mercola.fileburst.com/PDF/ExpertInterviewTranscripts/Interview-MerylNass-WhyAreInfluentialVirologistsInsistingontheNaturalOriginofSARSCoV2.pdf, and she continues:
"We already have ways to create these things, and it wasn't done that way. And two, we did some computer imaging and designing and we decided that based on the computer model, this was not the ideal spike formulation. And so if a geneticist, a virologists was doing this, they would have used the computer model and they didn't and therefore this must have come from the wild. Well, that was a really crazy argument because it didn't make any scientific sense, it was a lot of hand-waving assertions, but the evidence was not there because clearly if you understand that those were two highly virulent mutations that could well have been added to a preexisting coronavirus, you would know that in fact each of those could well have been added in a lab by a variety of techniques including the old passage technique, which is what Pasteur used to make vaccines in 1880.
So, passage has been around for a long time, but it is still used and there's a good possibility that it was used in this case. Because if you take cells that are not – if you take, sorry, viruses that are not particularly adapted to the human ACE-2 inhibitor but are adapted to another animals is ACE-2 inhibitor and passage them in human tissue culture with the ACE-2 receptor. Over time, they will develop improved, receptor binding. So it's actually a likely way that this coronavirus might've been produced. So anyway, I read that article and I said, "This is complete nonsense. I can't believe Nature Medicine published it"!!! And the two groups of authors, the one from The Lancet and the one from Nature
Medicine have consistently referred to each other as they've been interviewed."
To see her bold interview: https://articles.mercola.com/sites/articles/archive/2020/06/14/how-did-coronavirus-originate.aspx, and she pursues her clear and keen observations:
"Science Magazine did a short piece on The Lancet article. USA Today did a piece on the Nature Medicine article. And then the actual head of the National Institutes of Health, Dr. Francis Collins wrote a blog post or somebody wrote it for him saying, "Now we have the scientific answer. This piece in Nature Medicine has put to rest any thoughts that this could be a lab construct. That's a conspiracy theory. We have no room for conspiracy theories. This is the end of discussion.""
It was just the beginning of the research and the shitty, bloodless politicians were already closing the book!!! And she continues very interestingly:
"So I wrote a couple of blog posts about that and I said, "Well, this is really curious." Now the first thing I thought about the Nature Medicine article was, "Did these people actually write it?" Because it's such a piece of scientific nonsense that any real scientist reading it, if you can read the language, would not accept it, would dismiss it out of hand. So were they asked to place their names on those piece of junk?, in order to get it into a journal and create this smokescreen around the fact that this is "a naturally occurring coronavirus"?"
"If you look at the names, there were five authors, I knew of a couple of them. One was a fellow named Robert Garry, who I have had some interactions with over the last 22 years, another one was Ian Lipkin. And I happened to show this piece to a friend of mine, Ed Hooper, who wrote a well-known book called, “The River: A Journey to the Source of HIV and AIDS.” And he noted that the three other authors had all challenged – This book, The River, (which) is about the origin of AIDS. How did AIDS jump into the human population... Ed makes a very strong case and has put out additional evidence in the intervening 20-plus years since he wrote it, that it's much more likely that the jump into humans was because an oral polio vaccine was grown on monkey kidneys in the Belgian Congo. And that those monkey kidneys probably had the precursor to HIV"!!!
So it is interesting that three of these authors had actually challenged him on his AIDS origin theory and now they're challenging the coronavirus origin theory, which made me wonder, "Are these people who have PhDs but can be pulled out by the political medical establishment to try to push theories or ideas that are politically desirable"???
WOOOW, I want to have the guts that Nass has!!! Then, Mercola, after saying that the Andersen et al. Nature Medicine, 2020 piece of crap is "just a bunch of hogwash" asks her about the work of Deigin, "because it's an incredible article", "It's deep science for sure", "pretty strong compelling evidence and research that suggests that this was manipulated in some way and not of natural origin" and she said:
"Yeah, a little detail. So an author named Yuri Deigin, D-E-I-G-I-N, did his own research and published a massive discussion of all the coronavirus research that has gone on since 1999 that is relevant to that SARS-CoV-2, and he particularly discusses these two mutations. One, the furin cleavage site and the other is the receptor binding area. And he talks about all the research that's been done on that and the different ways you can make changes and how changes like what we're seeing now have in fact been done by corona researchers over the past 20 years. / And he analyzes everything very, very finely. It's like Ed Hooper's book. He sort of goes in and out and around and discusses every aspect. And when you finish reading that article, you are convinced that it's almost certain that, well in my mind, maybe not in yours, that these two mutations were put there deliberately. Whether they were done by passage, whether they were done by CRISPR or whether another method was used, scientists did know the implications in terms of increasing virulence of both of these mutations. So, I invite you to read that piece": https://medium.com/@yurideigin/lab-made-cov2-genealogy-through-the-lens-of-gain-of-function-research-f96dd7413748, Yri Deigin Interviewed: https://www.youtube.com/watch?v=q5SRrsr-Iug, and she continues, after Mercola asks to her: "do you have any other thoughts on its origin and how it might have entered the population? Because it seems somewhat odd that it could spread so quickly if it was just zoonotically transmitted. It almost instantaneously traveled throughout the entire world... epidemiologically doesn't seem to make sense"!!!:
"...you're right. It came on us suddenly. / Last month, ABC News said that back in November, the intelligence community was noting a lot of things that were different about Hubei and Wuhan. Whatever signals they were looking at, cell phone messages, people going to work, whatever, that they had a warning that something was going on there. So I think that's interesting, if that is true, that ABC News said they had four sources for the story and then someone in the administration the next day denied that they had been given this intelligence. So I don't know. So if we have to push back the date of when this started, there are more possibilities. I don't want to say any more about the Wuhan World [sic: War Military of the World] Games except that they occurred in October and ended at the end of October. / And there were military members competing in military Olympics from at least 40 or 50 countries in the world in Wuhan. The other thing I want to say is, just because an epidemic appears to have started in Wuhan, doesn't mean that it came from a lab in Wuhan. And let me give you a couple of other examples. There was a sudden amazing instantaneous outbreak of cholera in Peru in January of 1991. / There had not been cholera in the Western hemisphere for almost 100 years at that point. And it started just about simultaneously in three coastal towns in Peru. There was a Navy medical research center in Lima, Peru at that time. Those particular NAMRU research centers have been accused of having a biological warfare as well as a biological defense purpose, I don't know. / But just to say, there was a U.S. biological lab, military biological lab in Peru when this outbreak started. Nobody pointed to that U.S. lab and said, "The cholera came from that lab." When there was the Ebola outbreak in West Africa, again, more than 1000 miles from where any Ebola cases had ever been reported in 2014, maybe '13, guess who had a lab in Kenema, Sierra Leone, right where the outbreak started? Robert Garry. The same Garry who was a co-author of the Nature Medicine paper, who also had sort of fought with me back 20 years ago regarding the nature of the problems with anthrax vaccine."
"He and another person – even though he's a virologist, suddenly he got into the bacterial antibody and vaccine issue. And he did an experiment and said that the problem with anthrax vaccine was there was squalene in it. Squalene is a natural product, but it can cause autoimmune effects. It is one of the precursors to making cholesterol. So we all have squalene in our bodies, but where it is, is controlled. He said, "Look, there was some-" and squalene can be added to vaccines as an adjuvant to make them stronger so that you need to lose less antigen in the vaccine. He said, "Look, the problem with the anthrax vaccine, both in 1998 and back in the Gulf War was that they had added squalene to it and that's what made everybody sick." / And a book called “Vaccine A,” was written about that. And I was harassed by the author of the book who wanted me to accept this hypothesis. That the whole problem with anthrax vaccine was that squalene had been added. Now, thing is, I'm no fan of squalene in vaccines, adjuvants have side effects in some people. And so I have nothing against that theory, it's just that there was other evidence that showed it was wrong. For example, people who actually got anthrax from the anthrax letters had a complicated group of symptoms in a way similar to this complicated group of symptoms the coronavirus sufferers have now. / And their symptoms resembled in many ways the symptoms that people have from anthrax vaccine. Okay? The people who got anthrax from the anthrax letters, there was no squalene in it, they just got anthrax spores. The vaccine contained many different anthrax products. Products made – it's a very dirty vaccine. Anthrax vaccine is not processed extensively. So basically RNA, DNA and proteins, all sorts of molecules were in the vaccine and each batch was different than every other batch. And I believe that some of those products were what were making the soldiers ill."
"I think Garry came up with this theory because the idea was, if that theory was accepted that squalene was the whole problem, well then the government could just say, "Okay, we're not going to make any anthrax vaccine with squalene and now you'll have to be happy. We've taken out the bad ingredient and now, roll up your sleeves." And, so that was my experience with him. Ed Hooper had a different experience. He actually made an arrangement to meet with Ed Hooper talking about original AIDS cases. And then he didn't show up for the appointment. And when Ed went back to his hotel room, Garry shows up at the hotel room saying, "This is a cloak-and-dagger thing and I had to test you and that's why I'm here now." / So, Garry is an unusual individual, like I said, Ebola, AIDS, anthrax, he’s somehow, he's a virologist, but he's somehow into all these highly controversial organisms. And seems to want to push the government line on whatever it is he's doing. Like, "My lab had nothing to do with the Ebola outbreak in Kenema, Sierra Leone.""
Yeah riiiight...... NOOOO, it has everything to do with that!!!!
"...coronavirus research over the last 20 years has been done in many countries in Europe, in many labs in the U.S. in Japan, Singapore, China, and probably other places. And it has often been funded by multiple funders. So funders have included the Australian Government, different branches of NIH, but primarily Fauci's NIAID, the National Science Foundation and USAID, surprisingly because you would think USAID is an aid agency. There have also been organizations like the EcoHealth Alliance, which have served as pass-throughs for the funding so that NIAID or USAID would give money to EcoHealth Alliance and then EcoHealth Alliance would dole it out to the BSL-4 lab in Wuhan and other places and would participate with them in research. / And most of the most prominent researchers have gone back and forth. It's very complicated. There's a lot of back and forth. And Europe has funded this research too. So, Dr... – I don't know how to pronounce her name exactly, Zhengli Shi, has worked in the United States and our researchers have worked in China, Ian Lipkin has a post in China. And he was an expert who advise the Saudis on MERS, which is another cousin of SARS and advised the Chinese on SARS. And he was over in China at the beginning of this epidemic doing something regarding SARS too. So Ed Holmes works with them. So these people work together, they're funded... The Chinese, the Australians, the Europeans and the Americans fund all this work. / I can't explain to you why that happens and what are the underlying goals. What I can say is that there may be interest on the part of all these countries to be able to keep an eye on what everyone else is doing. So that by encouraging scientists to work in these different labs, they think and develop friendships, personal relationships and all of this joint funding. Some of this research is funded by five different institutes from three or four different countries. I assume that that may be part of it. So getting back to what you said about the research funding and then being cut off, gain-of-function research has been controversial since it began being discussed. In 2014 in the United States only and for NIH only, there was a pause on gain-of-function research for three organisms only. And those were MERS, SARS and avian flu. Probably because they were getting to a point where these things had been developed to be aerosolized and more virulent. And there was a lot of controversy in the scientific literature. / However, even though, I don't know, about 20 research projects were stopped, a number of them, maybe half, were then given permission to continue. And Ralph Baric's work with the Chinese researchers was one of those that was given permission to continue during this three-year slowdown. And back at the end of 2017, the slowdown was taken away and everybody was allowed to go back and do whatever gain-of-function research they wanted..."
"...some people are saying there are two or three or four small, six to 10 amino acid segments that look like bits of HIV and that they're inserted in different places, they may have effects on the immune response. I don't know. I think that information will gradually appear."
"...in my own research I have found, Anthony Fauci to be a hypocritical fraud, who pretends he knows nothing about coronaviruses and he's funded over 100 million dollars of coronavirus research out of NIAID. So, there he is, he looks so gentle and he doesn't give you any details about anything, but he knows a lot of details."
"...having dealt with many people who've died or developed tissue disorders, all sorts of terrible complications from anthrax vaccine and smallpox vaccine and sometimes other vaccines, ...I don't think vaccines should be looked on as risk-free. They're clearly not risk-free. Medical interventions should be done thoughtfully. Oh, let me also point out that talking about these characters that I discussed earlier, Ian Lipkin, one of the authors of the Nature Med piece, has been used to publish about chronic fatigue syndrome and autism. And he spent 10 or more years looking for an infectious cause of autism, excess weight in the mother or maybe in the father, all sorts of things but not vaccines."
Note: This other tenebrous character, a sidekick of Fauci, like the other Ebola-causing pest mentioned before, all of them alike Robert Gallo, just tools to enforce the "official" narrative of the Deep State of Fauci et al. Well, that beast was the advisor of the 2011 movie "Contagion", so they basically were in bed with the Anthrax scare of 2001, in concoction with the abominable Bush, Cheney, Rumsfeld, Rove... with spreading the Ebola and the HIV in Africa, (plus the release of Sars 1, H1N1, etc...) and with the current enactment of this "Plandemic", just as Gates and the WHO, Hopkins and WEF of his property are: Useful idiots!!!, useful pieces of crap!!!, useful disposable tools to enforce the hard lines of the pervert Deep State!!!: https://archive.vn/FeTCi
"So, again, I think he is likely – When you look at what these folks investigate, Lipkin or Bob Garry in particular, you'll see that they just jump from one thing like vaccines to Ebola, to SARS, to Gulf War syndrome. I mean, they're jumping from one highly controversial subject to the next and always pushing the government line on what that is and usually, the line that there is no treatment. So, yeah, I totally agree with you. Vaccines are – once you inject a vaccine, you can't take it out. At least with drugs, for most of them, the effect wears off in a short time."
Then, Mercola adds, about that imbecile serving "alien" interests that sooner or later will kill him!: "Lipkin ...was used to discredit Mikovits... He got a $30 million grant after publishing the paper that discredited Mikovits." And she continues:
"Yes. And Lipkin also has been involved with Peter Daszak. Lipkin has given Daszak a position in his little organization at Columbia. And Daszak is transferring funds, but Lipkin is also getting lots of funds from NIAID but Daszak is transferring funds to do all of this corona research around the world as well as NIH directly funding and others."
"...30 years ago when I was writing papers about the potential risks of biological defense research, we had a lot less biological defense research going on. And the risks were significant. Everybody agrees that these labs leak. I told you there were maybe 600 or more BSL-3s in the United States and hundreds others around the world. So, let me actually give you a few examples from a paper by Dr. Martin Furmansky who is a physician who looked at lab escapes. He pointed out that there was a lab in England and there were several smallpox escapes from that lab to a room below. And that two people died. And after the second one happened, I think it was around 1980, the lab director killed himself. / That there were huge outbreaks of Venezuelan equine encephalitis, thousands and thousands of people in Latin America. And it turned out all to be due to improperly inactivated vaccines. So the disease they were vaccinating all these livestock for was actually giving them the disease and giving it to humans also, thousands and thousands. You don't hear about that. He points out that the 1977 H1N1 outbreak, every year there's a flu pandemic. And in 1977 the pandemic started in China or Russia, probably from vaccine that had been defrosted because that particular strain, H1N1 had not been around in the world for 21 years. And genetically it looked almost identical to the strains that were around in the late '40s and 1950s, early '50s. So that whole pandemic was a lab escape... it started in the borderland of Russia and China. We made our own, but it was probably done in the expectation that we were going to have an outbreak. And so they were trying to, whoever took it out of the freezer was probably, that's the implication, trying to make a vaccine for 1977. Our swine flu was 1977. It was I think '76 where the recruit died at Fort Dix and then
all the machinery of the United States government and the manufacturers got together to create very rapidly, a swine flu vaccine to save the United States. / Abysmal failure. First of all, there was no outbreak. So had the people at the CDC and HHS been honest with the American public, they would have told them, "Hey, there's no outbreak. We're just going to cancel the vaccine program. You don't need it." But it had developed a life of its own. Harvey Fineberg, I believe, co-authored this fabulous book about it for the National Academy of Sciences, that the next DHHS secretary had requested. And I recommend, I mean it's a fabulous read because he was working under the Secretary of Health and Human Services, he was able to interview everybody in government. And he tells you the inside story of what went on during that year. All the infighting, all the different reasons why a vaccine was made for disease that didn't exist. And then given and then found to cause Guillain-Barre and 4,000 people applied for money back from the government / This was the first time the government gave a liability waiver to vaccine manufacturers. And I think it was what gave them the idea that in the future they could get liability waivers for all their vaccines... eventually got passed in 1986 and it serves as the foundation for their insulation from any liability for damages with the product that they're providing. / So if your vaccine is on the childhood schedule, according to CDC, you have your liability waived. But as of the 2016, 21st Century Cures Act, if the CDC recommends any vaccine for a pregnant woman, liability is waived for that vaccine. And you can license a vaccine using real-world evidence and you don't necessarily have to do clinical trials to license vaccines according to that act, which was passed and signed by Obama in December 2016. And as soon as every new vaccine is licensed, the CDC is required to put it in front of the Advisory Committee on Immunization Practices at their next meeting, for consideration to be added to the childhood schedule. / So we can look forward perhaps to many more vaccines being waived. And also there's a special waiver program for pandemic and emergency vaccines and drugs. So all the vaccines, all the drugs that are designated for use during this pandemic will have a waiver of liability. And as far as I know, this hasn't changed. The maximum a person can get is $250,000 for the government, even for a death or permanent total disability. / You don't go to vaccine court for this, you actually have to apply to HHS. So HHS pays you, HHS is a judge and the jury, and there is no appeal. I know it boggles the mind."
"...There needs to be an end of gain-of- function research. I think maybe if this is better – if the people realize, if the population understands that this is what your Congress and your scientists have given us, just because everyone was trying to do a CYA. The Congress was trying to throw money at a problem. Nobody was doing oversight. And all these agencies, agencies at the level of secretaries like the VA, HHS, Homeland security, FEMA, there's eight different agencies that are responsible for doing some pandemic preparedness. And 15 other organizations within the Federal Government. / ...much of this was spent just buying things like anthrax and smallpox vaccine that are probably unnecessary, very expensive, would never be used and not buying personal protective equipment and things that should be used. There's about $200 million or $300 million a year designated for hospital preparedness in these funds but it doesn't get spent on the things we would normally consider it should be spent on. So, I think that if all the countries of the world got together because all their populations are so angry about what has happened, and said, "We don't want any more of this." And everybody can inspect everybody else's labs, we can all make sure that what you're doing is actually going to be pro-life instead of anti-life, we would be a lot better off."
"...as far as the anthrax attacks go, the person who was ultimately accused after he died, after he was driven to his death by the FBI was Bruce Ivins who was a friend of mine. And the FBI actually never had any proof that Ivins had done it, nor that the anthrax actually even came from the flask that they said it came from, that was in Ivins’ possession, but was available to over 100 other people. So when the National Academy of Sciences report came out a year after the FBI decided to close the case, and they did that because they knew they didn't want to deal with what was going to be in that report, the National Academy of Sciences group said, "We can't say where this anthrax came from." / So who was the perpetrator or what group was the perpetrator? And the United States Government did have stores of anthrax. It probably had a store that it had retained in 1975 after it had a hidden in
Becton Dickinson. After the biological weapons program was shut down, they selectively saved some toxins and bad things and put them in private hands. That's been documented in a congressional hearing. And I cited that in a congressional testimony I gave in 2001. / And we also had anthrax that had been made during a probably illegal program during the Clinton Administration. And certainly there could have been other anthrax made here or in other countries. And a cabal got it and used it to perpetrate the anthrax letters. So, it's easy to blame – I mean the FBI needed somebody to blame. Bruce Ivins was the third or fourth different person that they had decided to focus on because they kept losing their earlier people. They tried to set up a number of people to take the blame for that case. So I don't know about Wuhan, I tend to think that these big things are probably done by big organizations rather than individual lone nuts...."
"Good God!!!"! (Said Hastings to Hercule Poirot)... my head is spinning...: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031 Added, as per Biol. Rubio's request: The Daszak attempt to darken the scene (mentioned by Nass at the start of her exposition):
https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)30418-9/fulltext, and its repeaters: https://www.genomeweb.com/letter-condemns-virus-conspiracy-theories (This appeared some weeks before the other political piece of crap, also mentioned by her, this one by young dupe Andersen et al. Nat. Med. 2020: (https://www.nature.com/articles/s41591-020-0820-9).
very short, less than a page, brief letter, was conflating the idea that this might've come from a lab with the fact that that would interfere with the US-China relationship. And we couldn't interfere with that because we needed China's information and maybe China's products to fight the coronavirus. / So we had to put this idea aside. Well, I scratched my head and said, "That doesn't really make sense, but okay, these are political people." Then a couple of weeks later, an article came out in Nature Medicine, which said, "Here we have the scientific proof that this did not come from a lab. That there are certain things about this virus." And they talked about the two things that have been identified by others as the most problematic. These two sites on the spike genome, which seemed to enhance the tropism and the binding. So it just makes it easier for the virus to get into human cells. And they took these two areas and said, "Look, these mutations that are found in the new CoV-2 virus, which are not seen in any of the other bat viruses anywhere near it must have come from the wild because these weren't created in the ways that we virologists would have created it."
To read the full interview: https://mercola.fileburst.com/PDF/ExpertInterviewTranscripts/Interview-MerylNass-WhyAreInfluentialVirologistsInsistingontheNaturalOriginofSARSCoV2.pdf, and she continues:
"We already have ways to create these things, and it wasn't done that way. And two, we did some computer imaging and designing and we decided that based on the computer model, this was not the ideal spike formulation. And so if a geneticist, a virologists was doing this, they would have used the computer model and they didn't and therefore this must have come from the wild. Well, that was a really crazy argument because it didn't make any scientific sense, it was a lot of hand-waving assertions, but the evidence was not there because clearly if you understand that those were two highly virulent mutations that could well have been added to a preexisting coronavirus, you would know that in fact each of those could well have been added in a lab by a variety of techniques including the old passage technique, which is what Pasteur used to make vaccines in 1880.
So, passage has been around for a long time, but it is still used and there's a good possibility that it was used in this case. Because if you take cells that are not – if you take, sorry, viruses that are not particularly adapted to the human ACE-2 inhibitor but are adapted to another animals is ACE-2 inhibitor and passage them in human tissue culture with the ACE-2 receptor. Over time, they will develop improved, receptor binding. So it's actually a likely way that this coronavirus might've been produced. So anyway, I read that article and I said, "This is complete nonsense. I can't believe Nature Medicine published it"!!! And the two groups of authors, the one from The Lancet and the one from Nature
Medicine have consistently referred to each other as they've been interviewed."
To see her bold interview: https://articles.mercola.com/sites/articles/archive/2020/06/14/how-did-coronavirus-originate.aspx, and she pursues her clear and keen observations:
"Science Magazine did a short piece on The Lancet article. USA Today did a piece on the Nature Medicine article. And then the actual head of the National Institutes of Health, Dr. Francis Collins wrote a blog post or somebody wrote it for him saying, "Now we have the scientific answer. This piece in Nature Medicine has put to rest any thoughts that this could be a lab construct. That's a conspiracy theory. We have no room for conspiracy theories. This is the end of discussion.""
It was just the beginning of the research and the shitty, bloodless politicians were already closing the book!!! And she continues very interestingly:
"So I wrote a couple of blog posts about that and I said, "Well, this is really curious." Now the first thing I thought about the Nature Medicine article was, "Did these people actually write it?" Because it's such a piece of scientific nonsense that any real scientist reading it, if you can read the language, would not accept it, would dismiss it out of hand. So were they asked to place their names on those piece of junk?, in order to get it into a journal and create this smokescreen around the fact that this is "a naturally occurring coronavirus"?"
"If you look at the names, there were five authors, I knew of a couple of them. One was a fellow named Robert Garry, who I have had some interactions with over the last 22 years, another one was Ian Lipkin. And I happened to show this piece to a friend of mine, Ed Hooper, who wrote a well-known book called, “The River: A Journey to the Source of HIV and AIDS.” And he noted that the three other authors had all challenged – This book, The River, (which) is about the origin of AIDS. How did AIDS jump into the human population... Ed makes a very strong case and has put out additional evidence in the intervening 20-plus years since he wrote it, that it's much more likely that the jump into humans was because an oral polio vaccine was grown on monkey kidneys in the Belgian Congo. And that those monkey kidneys probably had the precursor to HIV"!!!
So it is interesting that three of these authors had actually challenged him on his AIDS origin theory and now they're challenging the coronavirus origin theory, which made me wonder, "Are these people who have PhDs but can be pulled out by the political medical establishment to try to push theories or ideas that are politically desirable"???
WOOOW, I want to have the guts that Nass has!!! Then, Mercola, after saying that the Andersen et al. Nature Medicine, 2020 piece of crap is "just a bunch of hogwash" asks her about the work of Deigin, "because it's an incredible article", "It's deep science for sure", "pretty strong compelling evidence and research that suggests that this was manipulated in some way and not of natural origin" and she said:
"Yeah, a little detail. So an author named Yuri Deigin, D-E-I-G-I-N, did his own research and published a massive discussion of all the coronavirus research that has gone on since 1999 that is relevant to that SARS-CoV-2, and he particularly discusses these two mutations. One, the furin cleavage site and the other is the receptor binding area. And he talks about all the research that's been done on that and the different ways you can make changes and how changes like what we're seeing now have in fact been done by corona researchers over the past 20 years. / And he analyzes everything very, very finely. It's like Ed Hooper's book. He sort of goes in and out and around and discusses every aspect. And when you finish reading that article, you are convinced that it's almost certain that, well in my mind, maybe not in yours, that these two mutations were put there deliberately. Whether they were done by passage, whether they were done by CRISPR or whether another method was used, scientists did know the implications in terms of increasing virulence of both of these mutations. So, I invite you to read that piece": https://medium.com/@yurideigin/lab-made-cov2-genealogy-through-the-lens-of-gain-of-function-research-f96dd7413748, Yri Deigin Interviewed: https://www.youtube.com/watch?v=q5SRrsr-Iug, and she continues, after Mercola asks to her: "do you have any other thoughts on its origin and how it might have entered the population? Because it seems somewhat odd that it could spread so quickly if it was just zoonotically transmitted. It almost instantaneously traveled throughout the entire world... epidemiologically doesn't seem to make sense"!!!:
"...you're right. It came on us suddenly. / Last month, ABC News said that back in November, the intelligence community was noting a lot of things that were different about Hubei and Wuhan. Whatever signals they were looking at, cell phone messages, people going to work, whatever, that they had a warning that something was going on there. So I think that's interesting, if that is true, that ABC News said they had four sources for the story and then someone in the administration the next day denied that they had been given this intelligence. So I don't know. So if we have to push back the date of when this started, there are more possibilities. I don't want to say any more about the Wuhan World [sic: War Military of the World] Games except that they occurred in October and ended at the end of October. / And there were military members competing in military Olympics from at least 40 or 50 countries in the world in Wuhan. The other thing I want to say is, just because an epidemic appears to have started in Wuhan, doesn't mean that it came from a lab in Wuhan. And let me give you a couple of other examples. There was a sudden amazing instantaneous outbreak of cholera in Peru in January of 1991. / There had not been cholera in the Western hemisphere for almost 100 years at that point. And it started just about simultaneously in three coastal towns in Peru. There was a Navy medical research center in Lima, Peru at that time. Those particular NAMRU research centers have been accused of having a biological warfare as well as a biological defense purpose, I don't know. / But just to say, there was a U.S. biological lab, military biological lab in Peru when this outbreak started. Nobody pointed to that U.S. lab and said, "The cholera came from that lab." When there was the Ebola outbreak in West Africa, again, more than 1000 miles from where any Ebola cases had ever been reported in 2014, maybe '13, guess who had a lab in Kenema, Sierra Leone, right where the outbreak started? Robert Garry. The same Garry who was a co-author of the Nature Medicine paper, who also had sort of fought with me back 20 years ago regarding the nature of the problems with anthrax vaccine."
"He and another person – even though he's a virologist, suddenly he got into the bacterial antibody and vaccine issue. And he did an experiment and said that the problem with anthrax vaccine was there was squalene in it. Squalene is a natural product, but it can cause autoimmune effects. It is one of the precursors to making cholesterol. So we all have squalene in our bodies, but where it is, is controlled. He said, "Look, there was some-" and squalene can be added to vaccines as an adjuvant to make them stronger so that you need to lose less antigen in the vaccine. He said, "Look, the problem with the anthrax vaccine, both in 1998 and back in the Gulf War was that they had added squalene to it and that's what made everybody sick." / And a book called “Vaccine A,” was written about that. And I was harassed by the author of the book who wanted me to accept this hypothesis. That the whole problem with anthrax vaccine was that squalene had been added. Now, thing is, I'm no fan of squalene in vaccines, adjuvants have side effects in some people. And so I have nothing against that theory, it's just that there was other evidence that showed it was wrong. For example, people who actually got anthrax from the anthrax letters had a complicated group of symptoms in a way similar to this complicated group of symptoms the coronavirus sufferers have now. / And their symptoms resembled in many ways the symptoms that people have from anthrax vaccine. Okay? The people who got anthrax from the anthrax letters, there was no squalene in it, they just got anthrax spores. The vaccine contained many different anthrax products. Products made – it's a very dirty vaccine. Anthrax vaccine is not processed extensively. So basically RNA, DNA and proteins, all sorts of molecules were in the vaccine and each batch was different than every other batch. And I believe that some of those products were what were making the soldiers ill."
"I think Garry came up with this theory because the idea was, if that theory was accepted that squalene was the whole problem, well then the government could just say, "Okay, we're not going to make any anthrax vaccine with squalene and now you'll have to be happy. We've taken out the bad ingredient and now, roll up your sleeves." And, so that was my experience with him. Ed Hooper had a different experience. He actually made an arrangement to meet with Ed Hooper talking about original AIDS cases. And then he didn't show up for the appointment. And when Ed went back to his hotel room, Garry shows up at the hotel room saying, "This is a cloak-and-dagger thing and I had to test you and that's why I'm here now." / So, Garry is an unusual individual, like I said, Ebola, AIDS, anthrax, he’s somehow, he's a virologist, but he's somehow into all these highly controversial organisms. And seems to want to push the government line on whatever it is he's doing. Like, "My lab had nothing to do with the Ebola outbreak in Kenema, Sierra Leone.""
Yeah riiiight...... NOOOO, it has everything to do with that!!!!
"...coronavirus research over the last 20 years has been done in many countries in Europe, in many labs in the U.S. in Japan, Singapore, China, and probably other places. And it has often been funded by multiple funders. So funders have included the Australian Government, different branches of NIH, but primarily Fauci's NIAID, the National Science Foundation and USAID, surprisingly because you would think USAID is an aid agency. There have also been organizations like the EcoHealth Alliance, which have served as pass-throughs for the funding so that NIAID or USAID would give money to EcoHealth Alliance and then EcoHealth Alliance would dole it out to the BSL-4 lab in Wuhan and other places and would participate with them in research. / And most of the most prominent researchers have gone back and forth. It's very complicated. There's a lot of back and forth. And Europe has funded this research too. So, Dr... – I don't know how to pronounce her name exactly, Zhengli Shi, has worked in the United States and our researchers have worked in China, Ian Lipkin has a post in China. And he was an expert who advise the Saudis on MERS, which is another cousin of SARS and advised the Chinese on SARS. And he was over in China at the beginning of this epidemic doing something regarding SARS too. So Ed Holmes works with them. So these people work together, they're funded... The Chinese, the Australians, the Europeans and the Americans fund all this work. / I can't explain to you why that happens and what are the underlying goals. What I can say is that there may be interest on the part of all these countries to be able to keep an eye on what everyone else is doing. So that by encouraging scientists to work in these different labs, they think and develop friendships, personal relationships and all of this joint funding. Some of this research is funded by five different institutes from three or four different countries. I assume that that may be part of it. So getting back to what you said about the research funding and then being cut off, gain-of-function research has been controversial since it began being discussed. In 2014 in the United States only and for NIH only, there was a pause on gain-of-function research for three organisms only. And those were MERS, SARS and avian flu. Probably because they were getting to a point where these things had been developed to be aerosolized and more virulent. And there was a lot of controversy in the scientific literature. / However, even though, I don't know, about 20 research projects were stopped, a number of them, maybe half, were then given permission to continue. And Ralph Baric's work with the Chinese researchers was one of those that was given permission to continue during this three-year slowdown. And back at the end of 2017, the slowdown was taken away and everybody was allowed to go back and do whatever gain-of-function research they wanted..."
"...some people are saying there are two or three or four small, six to 10 amino acid segments that look like bits of HIV and that they're inserted in different places, they may have effects on the immune response. I don't know. I think that information will gradually appear."
"...in my own research I have found, Anthony Fauci to be a hypocritical fraud, who pretends he knows nothing about coronaviruses and he's funded over 100 million dollars of coronavirus research out of NIAID. So, there he is, he looks so gentle and he doesn't give you any details about anything, but he knows a lot of details."
"...having dealt with many people who've died or developed tissue disorders, all sorts of terrible complications from anthrax vaccine and smallpox vaccine and sometimes other vaccines, ...I don't think vaccines should be looked on as risk-free. They're clearly not risk-free. Medical interventions should be done thoughtfully. Oh, let me also point out that talking about these characters that I discussed earlier, Ian Lipkin, one of the authors of the Nature Med piece, has been used to publish about chronic fatigue syndrome and autism. And he spent 10 or more years looking for an infectious cause of autism, excess weight in the mother or maybe in the father, all sorts of things but not vaccines."
Note: This other tenebrous character, a sidekick of Fauci, like the other Ebola-causing pest mentioned before, all of them alike Robert Gallo, just tools to enforce the "official" narrative of the Deep State of Fauci et al. Well, that beast was the advisor of the 2011 movie "Contagion", so they basically were in bed with the Anthrax scare of 2001, in concoction with the abominable Bush, Cheney, Rumsfeld, Rove... with spreading the Ebola and the HIV in Africa, (plus the release of Sars 1, H1N1, etc...) and with the current enactment of this "Plandemic", just as Gates and the WHO, Hopkins and WEF of his property are: Useful idiots!!!, useful pieces of crap!!!, useful disposable tools to enforce the hard lines of the pervert Deep State!!!: https://archive.vn/FeTCi
"So, again, I think he is likely – When you look at what these folks investigate, Lipkin or Bob Garry in particular, you'll see that they just jump from one thing like vaccines to Ebola, to SARS, to Gulf War syndrome. I mean, they're jumping from one highly controversial subject to the next and always pushing the government line on what that is and usually, the line that there is no treatment. So, yeah, I totally agree with you. Vaccines are – once you inject a vaccine, you can't take it out. At least with drugs, for most of them, the effect wears off in a short time."
Then, Mercola adds, about that imbecile serving "alien" interests that sooner or later will kill him!: "Lipkin ...was used to discredit Mikovits... He got a $30 million grant after publishing the paper that discredited Mikovits." And she continues:
"Yes. And Lipkin also has been involved with Peter Daszak. Lipkin has given Daszak a position in his little organization at Columbia. And Daszak is transferring funds, but Lipkin is also getting lots of funds from NIAID but Daszak is transferring funds to do all of this corona research around the world as well as NIH directly funding and others."
"...30 years ago when I was writing papers about the potential risks of biological defense research, we had a lot less biological defense research going on. And the risks were significant. Everybody agrees that these labs leak. I told you there were maybe 600 or more BSL-3s in the United States and hundreds others around the world. So, let me actually give you a few examples from a paper by Dr. Martin Furmansky who is a physician who looked at lab escapes. He pointed out that there was a lab in England and there were several smallpox escapes from that lab to a room below. And that two people died. And after the second one happened, I think it was around 1980, the lab director killed himself. / That there were huge outbreaks of Venezuelan equine encephalitis, thousands and thousands of people in Latin America. And it turned out all to be due to improperly inactivated vaccines. So the disease they were vaccinating all these livestock for was actually giving them the disease and giving it to humans also, thousands and thousands. You don't hear about that. He points out that the 1977 H1N1 outbreak, every year there's a flu pandemic. And in 1977 the pandemic started in China or Russia, probably from vaccine that had been defrosted because that particular strain, H1N1 had not been around in the world for 21 years. And genetically it looked almost identical to the strains that were around in the late '40s and 1950s, early '50s. So that whole pandemic was a lab escape... it started in the borderland of Russia and China. We made our own, but it was probably done in the expectation that we were going to have an outbreak. And so they were trying to, whoever took it out of the freezer was probably, that's the implication, trying to make a vaccine for 1977. Our swine flu was 1977. It was I think '76 where the recruit died at Fort Dix and then
all the machinery of the United States government and the manufacturers got together to create very rapidly, a swine flu vaccine to save the United States. / Abysmal failure. First of all, there was no outbreak. So had the people at the CDC and HHS been honest with the American public, they would have told them, "Hey, there's no outbreak. We're just going to cancel the vaccine program. You don't need it." But it had developed a life of its own. Harvey Fineberg, I believe, co-authored this fabulous book about it for the National Academy of Sciences, that the next DHHS secretary had requested. And I recommend, I mean it's a fabulous read because he was working under the Secretary of Health and Human Services, he was able to interview everybody in government. And he tells you the inside story of what went on during that year. All the infighting, all the different reasons why a vaccine was made for disease that didn't exist. And then given and then found to cause Guillain-Barre and 4,000 people applied for money back from the government / This was the first time the government gave a liability waiver to vaccine manufacturers. And I think it was what gave them the idea that in the future they could get liability waivers for all their vaccines... eventually got passed in 1986 and it serves as the foundation for their insulation from any liability for damages with the product that they're providing. / So if your vaccine is on the childhood schedule, according to CDC, you have your liability waived. But as of the 2016, 21st Century Cures Act, if the CDC recommends any vaccine for a pregnant woman, liability is waived for that vaccine. And you can license a vaccine using real-world evidence and you don't necessarily have to do clinical trials to license vaccines according to that act, which was passed and signed by Obama in December 2016. And as soon as every new vaccine is licensed, the CDC is required to put it in front of the Advisory Committee on Immunization Practices at their next meeting, for consideration to be added to the childhood schedule. / So we can look forward perhaps to many more vaccines being waived. And also there's a special waiver program for pandemic and emergency vaccines and drugs. So all the vaccines, all the drugs that are designated for use during this pandemic will have a waiver of liability. And as far as I know, this hasn't changed. The maximum a person can get is $250,000 for the government, even for a death or permanent total disability. / You don't go to vaccine court for this, you actually have to apply to HHS. So HHS pays you, HHS is a judge and the jury, and there is no appeal. I know it boggles the mind."
"...There needs to be an end of gain-of- function research. I think maybe if this is better – if the people realize, if the population understands that this is what your Congress and your scientists have given us, just because everyone was trying to do a CYA. The Congress was trying to throw money at a problem. Nobody was doing oversight. And all these agencies, agencies at the level of secretaries like the VA, HHS, Homeland security, FEMA, there's eight different agencies that are responsible for doing some pandemic preparedness. And 15 other organizations within the Federal Government. / ...much of this was spent just buying things like anthrax and smallpox vaccine that are probably unnecessary, very expensive, would never be used and not buying personal protective equipment and things that should be used. There's about $200 million or $300 million a year designated for hospital preparedness in these funds but it doesn't get spent on the things we would normally consider it should be spent on. So, I think that if all the countries of the world got together because all their populations are so angry about what has happened, and said, "We don't want any more of this." And everybody can inspect everybody else's labs, we can all make sure that what you're doing is actually going to be pro-life instead of anti-life, we would be a lot better off."
"...as far as the anthrax attacks go, the person who was ultimately accused after he died, after he was driven to his death by the FBI was Bruce Ivins who was a friend of mine. And the FBI actually never had any proof that Ivins had done it, nor that the anthrax actually even came from the flask that they said it came from, that was in Ivins’ possession, but was available to over 100 other people. So when the National Academy of Sciences report came out a year after the FBI decided to close the case, and they did that because they knew they didn't want to deal with what was going to be in that report, the National Academy of Sciences group said, "We can't say where this anthrax came from." / So who was the perpetrator or what group was the perpetrator? And the United States Government did have stores of anthrax. It probably had a store that it had retained in 1975 after it had a hidden in
Becton Dickinson. After the biological weapons program was shut down, they selectively saved some toxins and bad things and put them in private hands. That's been documented in a congressional hearing. And I cited that in a congressional testimony I gave in 2001. / And we also had anthrax that had been made during a probably illegal program during the Clinton Administration. And certainly there could have been other anthrax made here or in other countries. And a cabal got it and used it to perpetrate the anthrax letters. So, it's easy to blame – I mean the FBI needed somebody to blame. Bruce Ivins was the third or fourth different person that they had decided to focus on because they kept losing their earlier people. They tried to set up a number of people to take the blame for that case. So I don't know about Wuhan, I tend to think that these big things are probably done by big organizations rather than individual lone nuts...."
"Good God!!!"! (Said Hastings to Hercule Poirot)... my head is spinning...: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031 Added, as per Biol. Rubio's request: The Daszak attempt to darken the scene (mentioned by Nass at the start of her exposition):
https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)30418-9/fulltext, and its repeaters: https://www.genomeweb.com/letter-condemns-virus-conspiracy-theories (This appeared some weeks before the other political piece of crap, also mentioned by her, this one by young dupe Andersen et al. Nat. Med. 2020: (https://www.nature.com/articles/s41591-020-0820-9).
My posting of today at RG goes as follows: Recently, bold Meryl Nass declared to Dr. Mercola: "...I do have an extensive background in biological warfare and I know what kinds of things have been created in the past, what it takes, where they may be made and how it has been done. So, I remained curious. And then in the end of February, the later part of February, a group of scientists wrote a piece that was published in The Lancet and it was a very curious piece to me... It didn't make sense. Yeah. And these were very prominent people, including the former head of the National Science Foundation, one of the former top people at CDC and other very prominent people. What they said is, "We need to quash the rumors of the fact that this came from a lab. That is conspiracy theory and we need to get rid of it. We have to stand with our colleagues in China. We all need to work together. We can't start problems with the Chinese basically." And so what this group was doing in a
very short, less than a page, brief letter, was conflating the idea that this might've come from a lab with the fact that that would interfere with the US-China relationship. And we couldn't interfere with that because we needed China's information and maybe China's products to fight the coronavirus. / So we had to put this idea aside. Well, I scratched my head and said, "That doesn't really make sense, but okay, these are political people." Then a couple of weeks later, an article came out in Nature Medicine, which said, "Here we have the scientific proof that this did not come from a lab. That there are certain things about this virus." And they talked about the two things that have been identified by others as the most problematic. These two sites on the spike genome, which seemed to enhance the tropism and the binding. So it just makes it easier for the virus to get into human cells. And they took these two areas and said, "Look, these mutations that are found in the new CoV-2 virus, which are not seen in any of the other bat viruses anywhere near it must have come from the wild because these weren't created in the ways that we virologists would have created it."
To read the full interview: https://mercola.fileburst.com/PDF/ExpertInterviewTranscripts/Interview-MerylNass-WhyAreInfluentialVirologistsInsistingontheNaturalOriginofSARSCoV2.pdf, and she continues:
"We already have ways to create these things, and it wasn't done that way. And two, we did some computer imaging and designing and we decided that based on the computer model, this was not the ideal spike formulation. And so if a geneticist, a virologists was doing this, they would have used the computer model and they didn't and therefore this must have come from the wild. Well, that was a really crazy argument because it didn't make any scientific sense, it was a lot of hand-waving assertions, but the evidence was not there because clearly if you understand that those were two highly virulent mutations that could well have been added to a preexisting coronavirus, you would know that in fact each of those could well have been added in a lab by a variety of techniques including the old passage technique, which is what Pasteur used to make vaccines in 1880.
So, passage has been around for a long time, but it is still used and there's a good possibility that it was used in this case. Because if you take cells that are not – if you take, sorry, viruses that are not particularly adapted to the human ACE-2 inhibitor but are adapted to another animals is ACE-2 inhibitor and passage them in human tissue culture with the ACE-2 receptor. Over time, they will develop improved, receptor binding. So it's actually a likely way that this coronavirus might've been produced. So anyway, I read that article and I said, "This is complete nonsense. I can't believe Nature Medicine published it"!!! And the two groups of authors, the one from The Lancet and the one from Nature
Medicine have consistently referred to each other as they've been interviewed."
To see her bold interview: https://articles.mercola.com/sites/articles/archive/2020/06/14/how-did-coronavirus-originate.aspx, and she pursues her clear and keen observations:
"Science Magazine did a short piece on The Lancet article. USA Today did a piece on the Nature Medicine article. And then the actual head of the National Institutes of Health, Dr. Francis Collins wrote a blog post or somebody wrote it for him saying, "Now we have the scientific answer. This piece in Nature Medicine has put to rest any thoughts that this could be a lab construct. That's a conspiracy theory. We have no room for conspiracy theories. This is the end of discussion.""
It was just the beginning of the research and the shitty, bloodless politicians were already closing the book!!! And she continues very interestingly:
"So I wrote a couple of blog posts about that and I said, "Well, this is really curious." Now the first thing I thought about the Nature Medicine article was, "Did these people actually write it?" Because it's such a piece of scientific nonsense that any real scientist reading it, if you can read the language, would not accept it, would dismiss it out of hand. So were they asked to place their names on those piece of junk?, in order to get it into a journal and create this smokescreen around the fact that this is "a naturally occurring coronavirus"?"
"If you look at the names, there were five authors, I knew of a couple of them. One was a fellow named Robert Garry, who I have had some interactions with over the last 22 years, another one was Ian Lipkin. And I happened to show this piece to a friend of mine, Ed Hooper, who wrote a well-known book called, “The River: A Journey to the Source of HIV and AIDS.” And he noted that the three other authors had all challenged – This book, The River, (which) is about the origin of AIDS. How did AIDS jump into the human population... Ed makes a very strong case and has put out additional evidence in the intervening 20-plus years since he wrote it, that it's much more likely that the jump into humans was because an oral polio vaccine was grown on monkey kidneys in the Belgian Congo. And that those monkey kidneys probably had the precursor to HIV"!!!
So it is interesting that three of these authors had actually challenged him on his AIDS origin theory and now they're challenging the coronavirus origin theory, which made me wonder, "Are these people who have PhDs but can be pulled out by the political medical establishment to try to push theories or ideas that are politically desirable"???
WOOOW, I want to have the guts that Nass has!!! Then, Mercola, after saying that the Andersen et al. Nature Medicine, 2020 piece of crap is "just a bunch of hogwash" asks her about the work of Deigin, "because it's an incredible article", "It's deep science for sure", "pretty strong compelling evidence and research that suggests that this was manipulated in some way and not of natural origin" and she said:
"Yeah, a little detail. So an author named Yuri Deigin, D-E-I-G-I-N, did his own research and published a massive discussion of all the coronavirus research that has gone on since 1999 that is relevant to that SARS-CoV-2, and he particularly discusses these two mutations. One, the furin cleavage site and the other is the receptor binding area. And he talks about all the research that's been done on that and the different ways you can make changes and how changes like what we're seeing now have in fact been done by corona researchers over the past 20 years. / And he analyzes everything very, very finely. It's like Ed Hooper's book. He sort of goes in and out and around and discusses every aspect. And when you finish reading that article, you are convinced that it's almost certain that, well in my mind, maybe not in yours, that these two mutations were put there deliberately. Whether they were done by passage, whether they were done by CRISPR or whether another method was used, scientists did know the implications in terms of increasing virulence of both of these mutations. So, I invite you to read that piece": https://medium.com/@yurideigin/lab-made-cov2-genealogy-through-the-lens-of-gain-of-function-research-f96dd7413748, Yri Deigin Interviewed: https://www.youtube.com/watch?v=q5SRrsr-Iug, and she continues, after Mercola asks to her: "do you have any other thoughts on its origin and how it might have entered the population? Because it seems somewhat odd that it could spread so quickly if it was just zoonotically transmitted. It almost instantaneously traveled throughout the entire world... epidemiologically doesn't seem to make sense"!!!:
"...you're right. It came on us suddenly. / Last month, ABC News said that back in November, the intelligence community was noting a lot of things that were different about Hubei and Wuhan. Whatever signals they were looking at, cell phone messages, people going to work, whatever, that they had a warning that something was going on there. So I think that's interesting, if that is true, that ABC News said they had four sources for the story and then someone in the administration the next day denied that they had been given this intelligence. So I don't know. So if we have to push back the date of when this started, there are more possibilities. I don't want to say any more about the Wuhan World [sic: War Military of the World] Games except that they occurred in October and ended at the end of October. / And there were military members competing in military Olympics from at least 40 or 50 countries in the world in Wuhan. The other thing I want to say is, just because an epidemic appears to have started in Wuhan, doesn't mean that it came from a lab in Wuhan. And let me give you a couple of other examples. There was a sudden amazing instantaneous outbreak of cholera in Peru in January of 1991. / There had not been cholera in the Western hemisphere for almost 100 years at that point. And it started just about simultaneously in three coastal towns in Peru. There was a Navy medical research center in Lima, Peru at that time. Those particular NAMRU research centers have been accused of having a biological warfare as well as a biological defense purpose, I don't know. / But just to say, there was a U.S. biological lab, military biological lab in Peru when this outbreak started. Nobody pointed to that U.S. lab and said, "The cholera came from that lab." When there was the Ebola outbreak in West Africa, again, more than 1000 miles from where any Ebola cases had ever been reported in 2014, maybe '13, guess who had a lab in Kenema, Sierra Leone, right where the outbreak started? Robert Garry. The same Garry who was a co-author of the Nature Medicine paper, who also had sort of fought with me back 20 years ago regarding the nature of the problems with anthrax vaccine."
"He and another person – even though he's a virologist, suddenly he got into the bacterial antibody and vaccine issue. And he did an experiment and said that the problem with anthrax vaccine was there was squalene in it. Squalene is a natural product, but it can cause autoimmune effects. It is one of the precursors to making cholesterol. So we all have squalene in our bodies, but where it is, is controlled. He said, "Look, there was some-" and squalene can be added to vaccines as an adjuvant to make them stronger so that you need to lose less antigen in the vaccine. He said, "Look, the problem with the anthrax vaccine, both in 1998 and back in the Gulf War was that they had added squalene to it and that's what made everybody sick." / And a book called “Vaccine A,” was written about that. And I was harassed by the author of the book who wanted me to accept this hypothesis. That the whole problem with anthrax vaccine was that squalene had been added. Now, thing is, I'm no fan of squalene in vaccines, adjuvants have side effects in some people. And so I have nothing against that theory, it's just that there was other evidence that showed it was wrong. For example, people who actually got anthrax from the anthrax letters had a complicated group of symptoms in a way similar to this complicated group of symptoms the coronavirus sufferers have now. / And their symptoms resembled in many ways the symptoms that people have from anthrax vaccine. Okay? The people who got anthrax from the anthrax letters, there was no squalene in it, they just got anthrax spores. The vaccine contained many different anthrax products. Products made – it's a very dirty vaccine. Anthrax vaccine is not processed extensively. So basically RNA, DNA and proteins, all sorts of molecules were in the vaccine and each batch was different than every other batch. And I believe that some of those products were what were making the soldiers ill."
"I think Garry came up with this theory because the idea was, if that theory was accepted that squalene was the whole problem, well then the government could just say, "Okay, we're not going to make any anthrax vaccine with squalene and now you'll have to be happy. We've taken out the bad ingredient and now, roll up your sleeves." And, so that was my experience with him. Ed Hooper had a different experience. He actually made an arrangement to meet with Ed Hooper talking about original AIDS cases. And then he didn't show up for the appointment. And when Ed went back to his hotel room, Garry shows up at the hotel room saying, "This is a cloak-and-dagger thing and I had to test you and that's why I'm here now." / So, Garry is an unusual individual, like I said, Ebola, AIDS, anthrax, he’s somehow, he's a virologist, but he's somehow into all these highly controversial organisms. And seems to want to push the government line on whatever it is he's doing. Like, "My lab had nothing to do with the Ebola outbreak in Kenema, Sierra Leone.""
Yeah riiiight...... NOOOO, it has everything to do with that!!!!
"...coronavirus research over the last 20 years has been done in many countries in Europe, in many labs in the U.S. in Japan, Singapore, China, and probably other places. And it has often been funded by multiple funders. So funders have included the Australian Government, different branches of NIH, but primarily Fauci's NIAID, the National Science Foundation and USAID, surprisingly because you would think USAID is an aid agency. There have also been organizations like the EcoHealth Alliance, which have served as pass-throughs for the funding so that NIAID or USAID would give money to EcoHealth Alliance and then EcoHealth Alliance would dole it out to the BSL-4 lab in Wuhan and other places and would participate with them in research. / And most of the most prominent researchers have gone back and forth. It's very complicated. There's a lot of back and forth. And Europe has funded this research too. So, Dr... – I don't know how to pronounce her name exactly, Zhengli Shi, has worked in the United States and our researchers have worked in China, Ian Lipkin has a post in China. And he was an expert who advise the Saudis on MERS, which is another cousin of SARS and advised the Chinese on SARS. And he was over in China at the beginning of this epidemic doing something regarding SARS too. So Ed Holmes works with them. So these people work together, they're funded... The Chinese, the Australians, the Europeans and the Americans fund all this work. / I can't explain to you why that happens and what are the underlying goals. What I can say is that there may be interest on the part of all these countries to be able to keep an eye on what everyone else is doing. So that by encouraging scientists to work in these different labs, they think and develop friendships, personal relationships and all of this joint funding. Some of this research is funded by five different institutes from three or four different countries. I assume that that may be part of it. So getting back to what you said about the research funding and then being cut off, gain-of-function research has been controversial since it began being discussed. In 2014 in the United States only and for NIH only, there was a pause on gain-of-function research for three organisms only. And those were MERS, SARS and avian flu. Probably because they were getting to a point where these things had been developed to be aerosolized and more virulent. And there was a lot of controversy in the scientific literature. / However, even though, I don't know, about 20 research projects were stopped, a number of them, maybe half, were then given permission to continue. And Ralph Baric's work with the Chinese researchers was one of those that was given permission to continue during this three-year slowdown. And back at the end of 2017, the slowdown was taken away and everybody was allowed to go back and do whatever gain-of-function research they wanted..."
"...some people are saying there are two or three or four small, six to 10 amino acid segments that look like bits of HIV and that they're inserted in different places, they may have effects on the immune response. I don't know. I think that information will gradually appear."
"...in my own research I have found, Anthony Fauci to be a hypocritical fraud, who pretends he knows nothing about coronaviruses and he's funded over 100 million dollars of coronavirus research out of NIAID. So, there he is, he looks so gentle and he doesn't give you any details about anything, but he knows a lot of details."
"...having dealt with many people who've died or developed tissue disorders, all sorts of terrible complications from anthrax vaccine and smallpox vaccine and sometimes other vaccines, ...I don't think vaccines should be looked on as risk-free. They're clearly not risk-free. Medical interventions should be done thoughtfully. Oh, let me also point out that talking about these characters that I discussed earlier, Ian Lipkin, one of the authors of the Nature Med piece, has been used to publish about chronic fatigue syndrome and autism. And he spent 10 or more years looking for an infectious cause of autism, excess weight in the mother or maybe in the father, all sorts of things but not vaccines."
Note: This other tenebrous character, a sidekick of Fauci, like the other Ebola-causing pest mentioned before, all of them alike Robert Gallo, just tools to enforce the "official" narrative of the Deep State of Fauci et al. Well, that beast was the advisor of the 2011 movie "Contagion", so they basically were in bed with the Anthrax scare of 2001, in concoction with the abominable Bush, Cheney, Rumsfeld, Rove... with spreading the Ebola and the HIV in Africa, (plus the release of Sars 1, H1N1, etc...) and with the current enactment of this "Plandemic", just as Gates and the WHO, Hopkins and WEF of his property are: Useful idiots!!!, useful pieces of crap!!!, useful disposable tools to enforce the hard lines of the pervert Deep State!!!: https://archive.vn/FeTCi
"So, again, I think he is likely – When you look at what these folks investigate, Lipkin or Bob Garry in particular, you'll see that they just jump from one thing like vaccines to Ebola, to SARS, to Gulf War syndrome. I mean, they're jumping from one highly controversial subject to the next and always pushing the government line on what that is and usually, the line that there is no treatment. So, yeah, I totally agree with you. Vaccines are – once you inject a vaccine, you can't take it out. At least with drugs, for most of them, the effect wears off in a short time."
Then, Mercola adds, about that imbecile serving "alien" interests that sooner or later will kill him!: "Lipkin ...was used to discredit Mikovits... He got a $30 million grant after publishing the paper that discredited Mikovits." And she continues:
"Yes. And Lipkin also has been involved with Peter Daszak. Lipkin has given Daszak a position in his little organization at Columbia. And Daszak is transferring funds, but Lipkin is also getting lots of funds from NIAID but Daszak is transferring funds to do all of this corona research around the world as well as NIH directly funding and others."
"...30 years ago when I was writing papers about the potential risks of biological defense research, we had a lot less biological defense research going on. And the risks were significant. Everybody agrees that these labs leak. I told you there were maybe 600 or more BSL-3s in the United States and hundreds others around the world. So, let me actually give you a few examples from a paper by Dr. Martin Furmansky who is a physician who looked at lab escapes. He pointed out that there was a lab in England and there were several smallpox escapes from that lab to a room below. And that two people died. And after the second one happened, I think it was around 1980, the lab director killed himself. / That there were huge outbreaks of Venezuelan equine encephalitis, thousands and thousands of people in Latin America. And it turned out all to be due to improperly inactivated vaccines. So the disease they were vaccinating all these livestock for was actually giving them the disease and giving it to humans also, thousands and thousands. You don't hear about that. He points out that the 1977 H1N1 outbreak, every year there's a flu pandemic. And in 1977 the pandemic started in China or Russia, probably from vaccine that had been defrosted because that particular strain, H1N1 had not been around in the world for 21 years. And genetically it looked almost identical to the strains that were around in the late '40s and 1950s, early '50s. So that whole pandemic was a lab escape... it started in the borderland of Russia and China. We made our own, but it was probably done in the expectation that we were going to have an outbreak. And so they were trying to, whoever took it out of the freezer was probably, that's the implication, trying to make a vaccine for 1977. Our swine flu was 1977. It was I think '76 where the recruit died at Fort Dix and then
all the machinery of the United States government and the manufacturers got together to create very rapidly, a swine flu vaccine to save the United States. / Abysmal failure. First of all, there was no outbreak. So had the people at the CDC and HHS been honest with the American public, they would have told them, "Hey, there's no outbreak. We're just going to cancel the vaccine program. You don't need it." But it had developed a life of its own. Harvey Fineberg, I believe, co-authored this fabulous book about it for the National Academy of Sciences, that the next DHHS secretary had requested. And I recommend, I mean it's a fabulous read because he was working under the Secretary of Health and Human Services, he was able to interview everybody in government. And he tells you the inside story of what went on during that year. All the infighting, all the different reasons why a vaccine was made for disease that didn't exist. And then given and then found to cause Guillain-Barre and 4,000 people applied for money back from the government / This was the first time the government gave a liability waiver to vaccine manufacturers. And I think it was what gave them the idea that in the future they could get liability waivers for all their vaccines... eventually got passed in 1986 and it serves as the foundation for their insulation from any liability for damages with the product that they're providing. / So if your vaccine is on the childhood schedule, according to CDC, you have your liability waived. But as of the 2016, 21st Century Cures Act, if the CDC recommends any vaccine for a pregnant woman, liability is waived for that vaccine. And you can license a vaccine using real-world evidence and you don't necessarily have to do clinical trials to license vaccines according to that act, which was passed and signed by Obama in December 2016. And as soon as every new vaccine is licensed, the CDC is required to put it in front of the Advisory Committee on Immunization Practices at their next meeting, for consideration to be added to the childhood schedule. / So we can look forward perhaps to many more vaccines being waived. And also there's a special waiver program for pandemic and emergency vaccines and drugs. So all the vaccines, all the drugs that are designated for use during this pandemic will have a waiver of liability. And as far as I know, this hasn't changed. The maximum a person can get is $250,000 for the government, even for a death or permanent total disability. / You don't go to vaccine court for this, you actually have to apply to HHS. So HHS pays you, HHS is a judge and the jury, and there is no appeal. I know it boggles the mind."
"...There needs to be an end of gain-of- function research. I think maybe if this is better – if the people realize, if the population understands that this is what your Congress and your scientists have given us, just because everyone was trying to do a CYA. The Congress was trying to throw money at a problem. Nobody was doing oversight. And all these agencies, agencies at the level of secretaries like the VA, HHS, Homeland security, FEMA, there's eight different agencies that are responsible for doing some pandemic preparedness. And 15 other organizations within the Federal Government. / ...much of this was spent just buying things like anthrax and smallpox vaccine that are probably unnecessary, very expensive, would never be used and not buying personal protective equipment and things that should be used. There's about $200 million or $300 million a year designated for hospital preparedness in these funds but it doesn't get spent on the things we would normally consider it should be spent on. So, I think that if all the countries of the world got together because all their populations are so angry about what has happened, and said, "We don't want any more of this." And everybody can inspect everybody else's labs, we can all make sure that what you're doing is actually going to be pro-life instead of anti-life, we would be a lot better off."
"...as far as the anthrax attacks go, the person who was ultimately accused after he died, after he was driven to his death by the FBI was Bruce Ivins who was a friend of mine. And the FBI actually never had any proof that Ivins had done it, nor that the anthrax actually even came from the flask that they said it came from, that was in Ivins’ possession, but was available to over 100 other people. So when the National Academy of Sciences report came out a year after the FBI decided to close the case, and they did that because they knew they didn't want to deal with what was going to be in that report, the National Academy of Sciences group said, "We can't say where this anthrax came from." / So who was the perpetrator or what group was the perpetrator? And the United States Government did have stores of anthrax. It probably had a store that it had retained in 1975 after it had a hidden in
Becton Dickinson. After the biological weapons program was shut down, they selectively saved some toxins and bad things and put them in private hands. That's been documented in a congressional hearing. And I cited that in a congressional testimony I gave in 2001. / And we also had anthrax that had been made during a probably illegal program during the Clinton Administration. And certainly there could have been other anthrax made here or in other countries. And a cabal got it and used it to perpetrate the anthrax letters. So, it's easy to blame – I mean the FBI needed somebody to blame. Bruce Ivins was the third or fourth different person that they had decided to focus on because they kept losing their earlier people. They tried to set up a number of people to take the blame for that case. So I don't know about Wuhan, I tend to think that these big things are probably done by big organizations rather than individual lone nuts...."
"Good God!!!"! (Said Hastings to Hercule Poirot)... my head is spinning...: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031 Added, as per Biol. Rubio's request: The Daszak attempt to darken the scene (mentioned by Nass at the start of her exposition):
https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)30418-9/fulltext, and its repeaters: https://www.genomeweb.com/letter-condemns-virus-conspiracy-theories (This appeared some weeks before the other political piece of crap, also mentioned by her, this one by young dupe Andersen et al. Nat. Med. 2020: (https://www.nature.com/articles/s41591-020-0820-9).
very short, less than a page, brief letter, was conflating the idea that this might've come from a lab with the fact that that would interfere with the US-China relationship. And we couldn't interfere with that because we needed China's information and maybe China's products to fight the coronavirus. / So we had to put this idea aside. Well, I scratched my head and said, "That doesn't really make sense, but okay, these are political people." Then a couple of weeks later, an article came out in Nature Medicine, which said, "Here we have the scientific proof that this did not come from a lab. That there are certain things about this virus." And they talked about the two things that have been identified by others as the most problematic. These two sites on the spike genome, which seemed to enhance the tropism and the binding. So it just makes it easier for the virus to get into human cells. And they took these two areas and said, "Look, these mutations that are found in the new CoV-2 virus, which are not seen in any of the other bat viruses anywhere near it must have come from the wild because these weren't created in the ways that we virologists would have created it."
To read the full interview: https://mercola.fileburst.com/PDF/ExpertInterviewTranscripts/Interview-MerylNass-WhyAreInfluentialVirologistsInsistingontheNaturalOriginofSARSCoV2.pdf, and she continues:
"We already have ways to create these things, and it wasn't done that way. And two, we did some computer imaging and designing and we decided that based on the computer model, this was not the ideal spike formulation. And so if a geneticist, a virologists was doing this, they would have used the computer model and they didn't and therefore this must have come from the wild. Well, that was a really crazy argument because it didn't make any scientific sense, it was a lot of hand-waving assertions, but the evidence was not there because clearly if you understand that those were two highly virulent mutations that could well have been added to a preexisting coronavirus, you would know that in fact each of those could well have been added in a lab by a variety of techniques including the old passage technique, which is what Pasteur used to make vaccines in 1880.
So, passage has been around for a long time, but it is still used and there's a good possibility that it was used in this case. Because if you take cells that are not – if you take, sorry, viruses that are not particularly adapted to the human ACE-2 inhibitor but are adapted to another animals is ACE-2 inhibitor and passage them in human tissue culture with the ACE-2 receptor. Over time, they will develop improved, receptor binding. So it's actually a likely way that this coronavirus might've been produced. So anyway, I read that article and I said, "This is complete nonsense. I can't believe Nature Medicine published it"!!! And the two groups of authors, the one from The Lancet and the one from Nature
Medicine have consistently referred to each other as they've been interviewed."
To see her bold interview: https://articles.mercola.com/sites/articles/archive/2020/06/14/how-did-coronavirus-originate.aspx, and she pursues her clear and keen observations:
"Science Magazine did a short piece on The Lancet article. USA Today did a piece on the Nature Medicine article. And then the actual head of the National Institutes of Health, Dr. Francis Collins wrote a blog post or somebody wrote it for him saying, "Now we have the scientific answer. This piece in Nature Medicine has put to rest any thoughts that this could be a lab construct. That's a conspiracy theory. We have no room for conspiracy theories. This is the end of discussion.""
It was just the beginning of the research and the shitty, bloodless politicians were already closing the book!!! And she continues very interestingly:
"So I wrote a couple of blog posts about that and I said, "Well, this is really curious." Now the first thing I thought about the Nature Medicine article was, "Did these people actually write it?" Because it's such a piece of scientific nonsense that any real scientist reading it, if you can read the language, would not accept it, would dismiss it out of hand. So were they asked to place their names on those piece of junk?, in order to get it into a journal and create this smokescreen around the fact that this is "a naturally occurring coronavirus"?"
"If you look at the names, there were five authors, I knew of a couple of them. One was a fellow named Robert Garry, who I have had some interactions with over the last 22 years, another one was Ian Lipkin. And I happened to show this piece to a friend of mine, Ed Hooper, who wrote a well-known book called, “The River: A Journey to the Source of HIV and AIDS.” And he noted that the three other authors had all challenged – This book, The River, (which) is about the origin of AIDS. How did AIDS jump into the human population... Ed makes a very strong case and has put out additional evidence in the intervening 20-plus years since he wrote it, that it's much more likely that the jump into humans was because an oral polio vaccine was grown on monkey kidneys in the Belgian Congo. And that those monkey kidneys probably had the precursor to HIV"!!!
So it is interesting that three of these authors had actually challenged him on his AIDS origin theory and now they're challenging the coronavirus origin theory, which made me wonder, "Are these people who have PhDs but can be pulled out by the political medical establishment to try to push theories or ideas that are politically desirable"???
WOOOW, I want to have the guts that Nass has!!! Then, Mercola, after saying that the Andersen et al. Nature Medicine, 2020 piece of crap is "just a bunch of hogwash" asks her about the work of Deigin, "because it's an incredible article", "It's deep science for sure", "pretty strong compelling evidence and research that suggests that this was manipulated in some way and not of natural origin" and she said:
"Yeah, a little detail. So an author named Yuri Deigin, D-E-I-G-I-N, did his own research and published a massive discussion of all the coronavirus research that has gone on since 1999 that is relevant to that SARS-CoV-2, and he particularly discusses these two mutations. One, the furin cleavage site and the other is the receptor binding area. And he talks about all the research that's been done on that and the different ways you can make changes and how changes like what we're seeing now have in fact been done by corona researchers over the past 20 years. / And he analyzes everything very, very finely. It's like Ed Hooper's book. He sort of goes in and out and around and discusses every aspect. And when you finish reading that article, you are convinced that it's almost certain that, well in my mind, maybe not in yours, that these two mutations were put there deliberately. Whether they were done by passage, whether they were done by CRISPR or whether another method was used, scientists did know the implications in terms of increasing virulence of both of these mutations. So, I invite you to read that piece": https://medium.com/@yurideigin/lab-made-cov2-genealogy-through-the-lens-of-gain-of-function-research-f96dd7413748, Yri Deigin Interviewed: https://www.youtube.com/watch?v=q5SRrsr-Iug, and she continues, after Mercola asks to her: "do you have any other thoughts on its origin and how it might have entered the population? Because it seems somewhat odd that it could spread so quickly if it was just zoonotically transmitted. It almost instantaneously traveled throughout the entire world... epidemiologically doesn't seem to make sense"!!!:
"...you're right. It came on us suddenly. / Last month, ABC News said that back in November, the intelligence community was noting a lot of things that were different about Hubei and Wuhan. Whatever signals they were looking at, cell phone messages, people going to work, whatever, that they had a warning that something was going on there. So I think that's interesting, if that is true, that ABC News said they had four sources for the story and then someone in the administration the next day denied that they had been given this intelligence. So I don't know. So if we have to push back the date of when this started, there are more possibilities. I don't want to say any more about the Wuhan World [sic: War Military of the World] Games except that they occurred in October and ended at the end of October. / And there were military members competing in military Olympics from at least 40 or 50 countries in the world in Wuhan. The other thing I want to say is, just because an epidemic appears to have started in Wuhan, doesn't mean that it came from a lab in Wuhan. And let me give you a couple of other examples. There was a sudden amazing instantaneous outbreak of cholera in Peru in January of 1991. / There had not been cholera in the Western hemisphere for almost 100 years at that point. And it started just about simultaneously in three coastal towns in Peru. There was a Navy medical research center in Lima, Peru at that time. Those particular NAMRU research centers have been accused of having a biological warfare as well as a biological defense purpose, I don't know. / But just to say, there was a U.S. biological lab, military biological lab in Peru when this outbreak started. Nobody pointed to that U.S. lab and said, "The cholera came from that lab." When there was the Ebola outbreak in West Africa, again, more than 1000 miles from where any Ebola cases had ever been reported in 2014, maybe '13, guess who had a lab in Kenema, Sierra Leone, right where the outbreak started? Robert Garry. The same Garry who was a co-author of the Nature Medicine paper, who also had sort of fought with me back 20 years ago regarding the nature of the problems with anthrax vaccine."
"He and another person – even though he's a virologist, suddenly he got into the bacterial antibody and vaccine issue. And he did an experiment and said that the problem with anthrax vaccine was there was squalene in it. Squalene is a natural product, but it can cause autoimmune effects. It is one of the precursors to making cholesterol. So we all have squalene in our bodies, but where it is, is controlled. He said, "Look, there was some-" and squalene can be added to vaccines as an adjuvant to make them stronger so that you need to lose less antigen in the vaccine. He said, "Look, the problem with the anthrax vaccine, both in 1998 and back in the Gulf War was that they had added squalene to it and that's what made everybody sick." / And a book called “Vaccine A,” was written about that. And I was harassed by the author of the book who wanted me to accept this hypothesis. That the whole problem with anthrax vaccine was that squalene had been added. Now, thing is, I'm no fan of squalene in vaccines, adjuvants have side effects in some people. And so I have nothing against that theory, it's just that there was other evidence that showed it was wrong. For example, people who actually got anthrax from the anthrax letters had a complicated group of symptoms in a way similar to this complicated group of symptoms the coronavirus sufferers have now. / And their symptoms resembled in many ways the symptoms that people have from anthrax vaccine. Okay? The people who got anthrax from the anthrax letters, there was no squalene in it, they just got anthrax spores. The vaccine contained many different anthrax products. Products made – it's a very dirty vaccine. Anthrax vaccine is not processed extensively. So basically RNA, DNA and proteins, all sorts of molecules were in the vaccine and each batch was different than every other batch. And I believe that some of those products were what were making the soldiers ill."
"I think Garry came up with this theory because the idea was, if that theory was accepted that squalene was the whole problem, well then the government could just say, "Okay, we're not going to make any anthrax vaccine with squalene and now you'll have to be happy. We've taken out the bad ingredient and now, roll up your sleeves." And, so that was my experience with him. Ed Hooper had a different experience. He actually made an arrangement to meet with Ed Hooper talking about original AIDS cases. And then he didn't show up for the appointment. And when Ed went back to his hotel room, Garry shows up at the hotel room saying, "This is a cloak-and-dagger thing and I had to test you and that's why I'm here now." / So, Garry is an unusual individual, like I said, Ebola, AIDS, anthrax, he’s somehow, he's a virologist, but he's somehow into all these highly controversial organisms. And seems to want to push the government line on whatever it is he's doing. Like, "My lab had nothing to do with the Ebola outbreak in Kenema, Sierra Leone.""
Yeah riiiight...... NOOOO, it has everything to do with that!!!!
"...coronavirus research over the last 20 years has been done in many countries in Europe, in many labs in the U.S. in Japan, Singapore, China, and probably other places. And it has often been funded by multiple funders. So funders have included the Australian Government, different branches of NIH, but primarily Fauci's NIAID, the National Science Foundation and USAID, surprisingly because you would think USAID is an aid agency. There have also been organizations like the EcoHealth Alliance, which have served as pass-throughs for the funding so that NIAID or USAID would give money to EcoHealth Alliance and then EcoHealth Alliance would dole it out to the BSL-4 lab in Wuhan and other places and would participate with them in research. / And most of the most prominent researchers have gone back and forth. It's very complicated. There's a lot of back and forth. And Europe has funded this research too. So, Dr... – I don't know how to pronounce her name exactly, Zhengli Shi, has worked in the United States and our researchers have worked in China, Ian Lipkin has a post in China. And he was an expert who advise the Saudis on MERS, which is another cousin of SARS and advised the Chinese on SARS. And he was over in China at the beginning of this epidemic doing something regarding SARS too. So Ed Holmes works with them. So these people work together, they're funded... The Chinese, the Australians, the Europeans and the Americans fund all this work. / I can't explain to you why that happens and what are the underlying goals. What I can say is that there may be interest on the part of all these countries to be able to keep an eye on what everyone else is doing. So that by encouraging scientists to work in these different labs, they think and develop friendships, personal relationships and all of this joint funding. Some of this research is funded by five different institutes from three or four different countries. I assume that that may be part of it. So getting back to what you said about the research funding and then being cut off, gain-of-function research has been controversial since it began being discussed. In 2014 in the United States only and for NIH only, there was a pause on gain-of-function research for three organisms only. And those were MERS, SARS and avian flu. Probably because they were getting to a point where these things had been developed to be aerosolized and more virulent. And there was a lot of controversy in the scientific literature. / However, even though, I don't know, about 20 research projects were stopped, a number of them, maybe half, were then given permission to continue. And Ralph Baric's work with the Chinese researchers was one of those that was given permission to continue during this three-year slowdown. And back at the end of 2017, the slowdown was taken away and everybody was allowed to go back and do whatever gain-of-function research they wanted..."
"...some people are saying there are two or three or four small, six to 10 amino acid segments that look like bits of HIV and that they're inserted in different places, they may have effects on the immune response. I don't know. I think that information will gradually appear."
"...in my own research I have found, Anthony Fauci to be a hypocritical fraud, who pretends he knows nothing about coronaviruses and he's funded over 100 million dollars of coronavirus research out of NIAID. So, there he is, he looks so gentle and he doesn't give you any details about anything, but he knows a lot of details."
"...having dealt with many people who've died or developed tissue disorders, all sorts of terrible complications from anthrax vaccine and smallpox vaccine and sometimes other vaccines, ...I don't think vaccines should be looked on as risk-free. They're clearly not risk-free. Medical interventions should be done thoughtfully. Oh, let me also point out that talking about these characters that I discussed earlier, Ian Lipkin, one of the authors of the Nature Med piece, has been used to publish about chronic fatigue syndrome and autism. And he spent 10 or more years looking for an infectious cause of autism, excess weight in the mother or maybe in the father, all sorts of things but not vaccines."
Note: This other tenebrous character, a sidekick of Fauci, like the other Ebola-causing pest mentioned before, all of them alike Robert Gallo, just tools to enforce the "official" narrative of the Deep State of Fauci et al. Well, that beast was the advisor of the 2011 movie "Contagion", so they basically were in bed with the Anthrax scare of 2001, in concoction with the abominable Bush, Cheney, Rumsfeld, Rove... with spreading the Ebola and the HIV in Africa, (plus the release of Sars 1, H1N1, etc...) and with the current enactment of this "Plandemic", just as Gates and the WHO, Hopkins and WEF of his property are: Useful idiots!!!, useful pieces of crap!!!, useful disposable tools to enforce the hard lines of the pervert Deep State!!!: https://archive.vn/FeTCi
"So, again, I think he is likely – When you look at what these folks investigate, Lipkin or Bob Garry in particular, you'll see that they just jump from one thing like vaccines to Ebola, to SARS, to Gulf War syndrome. I mean, they're jumping from one highly controversial subject to the next and always pushing the government line on what that is and usually, the line that there is no treatment. So, yeah, I totally agree with you. Vaccines are – once you inject a vaccine, you can't take it out. At least with drugs, for most of them, the effect wears off in a short time."
Then, Mercola adds, about that imbecile serving "alien" interests that sooner or later will kill him!: "Lipkin ...was used to discredit Mikovits... He got a $30 million grant after publishing the paper that discredited Mikovits." And she continues:
"Yes. And Lipkin also has been involved with Peter Daszak. Lipkin has given Daszak a position in his little organization at Columbia. And Daszak is transferring funds, but Lipkin is also getting lots of funds from NIAID but Daszak is transferring funds to do all of this corona research around the world as well as NIH directly funding and others."
"...30 years ago when I was writing papers about the potential risks of biological defense research, we had a lot less biological defense research going on. And the risks were significant. Everybody agrees that these labs leak. I told you there were maybe 600 or more BSL-3s in the United States and hundreds others around the world. So, let me actually give you a few examples from a paper by Dr. Martin Furmansky who is a physician who looked at lab escapes. He pointed out that there was a lab in England and there were several smallpox escapes from that lab to a room below. And that two people died. And after the second one happened, I think it was around 1980, the lab director killed himself. / That there were huge outbreaks of Venezuelan equine encephalitis, thousands and thousands of people in Latin America. And it turned out all to be due to improperly inactivated vaccines. So the disease they were vaccinating all these livestock for was actually giving them the disease and giving it to humans also, thousands and thousands. You don't hear about that. He points out that the 1977 H1N1 outbreak, every year there's a flu pandemic. And in 1977 the pandemic started in China or Russia, probably from vaccine that had been defrosted because that particular strain, H1N1 had not been around in the world for 21 years. And genetically it looked almost identical to the strains that were around in the late '40s and 1950s, early '50s. So that whole pandemic was a lab escape... it started in the borderland of Russia and China. We made our own, but it was probably done in the expectation that we were going to have an outbreak. And so they were trying to, whoever took it out of the freezer was probably, that's the implication, trying to make a vaccine for 1977. Our swine flu was 1977. It was I think '76 where the recruit died at Fort Dix and then
all the machinery of the United States government and the manufacturers got together to create very rapidly, a swine flu vaccine to save the United States. / Abysmal failure. First of all, there was no outbreak. So had the people at the CDC and HHS been honest with the American public, they would have told them, "Hey, there's no outbreak. We're just going to cancel the vaccine program. You don't need it." But it had developed a life of its own. Harvey Fineberg, I believe, co-authored this fabulous book about it for the National Academy of Sciences, that the next DHHS secretary had requested. And I recommend, I mean it's a fabulous read because he was working under the Secretary of Health and Human Services, he was able to interview everybody in government. And he tells you the inside story of what went on during that year. All the infighting, all the different reasons why a vaccine was made for disease that didn't exist. And then given and then found to cause Guillain-Barre and 4,000 people applied for money back from the government / This was the first time the government gave a liability waiver to vaccine manufacturers. And I think it was what gave them the idea that in the future they could get liability waivers for all their vaccines... eventually got passed in 1986 and it serves as the foundation for their insulation from any liability for damages with the product that they're providing. / So if your vaccine is on the childhood schedule, according to CDC, you have your liability waived. But as of the 2016, 21st Century Cures Act, if the CDC recommends any vaccine for a pregnant woman, liability is waived for that vaccine. And you can license a vaccine using real-world evidence and you don't necessarily have to do clinical trials to license vaccines according to that act, which was passed and signed by Obama in December 2016. And as soon as every new vaccine is licensed, the CDC is required to put it in front of the Advisory Committee on Immunization Practices at their next meeting, for consideration to be added to the childhood schedule. / So we can look forward perhaps to many more vaccines being waived. And also there's a special waiver program for pandemic and emergency vaccines and drugs. So all the vaccines, all the drugs that are designated for use during this pandemic will have a waiver of liability. And as far as I know, this hasn't changed. The maximum a person can get is $250,000 for the government, even for a death or permanent total disability. / You don't go to vaccine court for this, you actually have to apply to HHS. So HHS pays you, HHS is a judge and the jury, and there is no appeal. I know it boggles the mind."
"...There needs to be an end of gain-of- function research. I think maybe if this is better – if the people realize, if the population understands that this is what your Congress and your scientists have given us, just because everyone was trying to do a CYA. The Congress was trying to throw money at a problem. Nobody was doing oversight. And all these agencies, agencies at the level of secretaries like the VA, HHS, Homeland security, FEMA, there's eight different agencies that are responsible for doing some pandemic preparedness. And 15 other organizations within the Federal Government. / ...much of this was spent just buying things like anthrax and smallpox vaccine that are probably unnecessary, very expensive, would never be used and not buying personal protective equipment and things that should be used. There's about $200 million or $300 million a year designated for hospital preparedness in these funds but it doesn't get spent on the things we would normally consider it should be spent on. So, I think that if all the countries of the world got together because all their populations are so angry about what has happened, and said, "We don't want any more of this." And everybody can inspect everybody else's labs, we can all make sure that what you're doing is actually going to be pro-life instead of anti-life, we would be a lot better off."
"...as far as the anthrax attacks go, the person who was ultimately accused after he died, after he was driven to his death by the FBI was Bruce Ivins who was a friend of mine. And the FBI actually never had any proof that Ivins had done it, nor that the anthrax actually even came from the flask that they said it came from, that was in Ivins’ possession, but was available to over 100 other people. So when the National Academy of Sciences report came out a year after the FBI decided to close the case, and they did that because they knew they didn't want to deal with what was going to be in that report, the National Academy of Sciences group said, "We can't say where this anthrax came from." / So who was the perpetrator or what group was the perpetrator? And the United States Government did have stores of anthrax. It probably had a store that it had retained in 1975 after it had a hidden in
Becton Dickinson. After the biological weapons program was shut down, they selectively saved some toxins and bad things and put them in private hands. That's been documented in a congressional hearing. And I cited that in a congressional testimony I gave in 2001. / And we also had anthrax that had been made during a probably illegal program during the Clinton Administration. And certainly there could have been other anthrax made here or in other countries. And a cabal got it and used it to perpetrate the anthrax letters. So, it's easy to blame – I mean the FBI needed somebody to blame. Bruce Ivins was the third or fourth different person that they had decided to focus on because they kept losing their earlier people. They tried to set up a number of people to take the blame for that case. So I don't know about Wuhan, I tend to think that these big things are probably done by big organizations rather than individual lone nuts...."
"Good God!!!"! (Said Hastings to Hercule Poirot)... my head is spinning...: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031 Added, as per Biol. Rubio's request: The Daszak attempt to darken the scene (mentioned by Nass at the start of her exposition):
https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)30418-9/fulltext, and its repeaters: https://www.genomeweb.com/letter-condemns-virus-conspiracy-theories (This appeared some weeks before the other political piece of crap, also mentioned by her, this one by young dupe Andersen et al. Nat. Med. 2020: (https://www.nature.com/articles/s41591-020-0820-9).
Fernando Castro-Chavez wrote on Jean-claude Perez's timeline.
Happy Birthday And God's Provisions!!! Great Works with Luc Montagnier, Worth of a Lifetime!!!
Richard Dearlove, quien fue jefe del MI6 desde 1999 hasta 2004 indica que ha leído documentos clasificados que indican que COVID-19 se originó en el Wuhan Institute of Virology (el infame WIV del CCP chino): https://www.abc.es/internacional/abci-exdirector-dice-coronavirus-liberado-laboratorio-chino-accidente-202006041225_noticia.html, ¿qué hace falta entonces para colgarle el cascabel al "gato"???? ¿Huevecillos a la... no-diabla???
Updated Jun 25, 2020, 3:41 PM
Fernando Castro-Chavez shared a video from the playlist TruthinMedia w/ Ben Swann Podcast.
More and More Scientists Are Confirming This: COVID-19 Was Altered in a Lab to Better Attack Humans, so the Whole Pandemic is Artificial and Man-Made!!!:
Updated Jun 24, 2020, 1:20 PM
Fernando Castro-Chavez
"Beautiful Souls: The Courage and Conscience of Ordinary People in Extraordinary Times":
Updated Jun 23, 2020, 7:57 PM
My recent posting (hoping the "#$%!%&@ let it stand) at my ResearchGate COVID-19 inquiry, witn more than 12,400 readers, but never with as many as what intense videos get: https://www.facebook.com/KardagarCoaching/videos/713879892781432/ "Describing the Sorensen key article: https://archive.vn/7TPTc
And, thanks again to Biol. Rubio, here we have the bold statements of Sorensen, way far better than anything that I could be able to say on the issue:
"In a new peer-reviewed paper published together with Professor Angus Dalgleish of St George’s Hospital at the University of London, Sorensen claimed the novel coronavirus SARS-CoV-2 is not natural in origin."
"...published (https://www.cambridge.org/core/services/aop-cambridge-core/content/view/DBBC0FA6E3763B0067CAAD8F3363E527/S2633289220000083a.pdf/biovacc19_a_candidate_vaccine_for_covid19_sarscov2_developed_from_analysis_of_its_general_method_of_action_for_infectivity.pdf) in the Quarterly Review of Biophysics, the authors found that the coronavirus’s spike protein contains sequences that appear to be artificially inserted. “The inserted sequences should never have been published. Had it been today, it would never have happened. It was a big mistake the Chinese made. The inserted sequences have a functionality that we describe. We explain why they are essential. But the Chinese pointed to them first,” Sørensen told the NRK (https://www.nrk.no/norge/norsk-forsker-skaper-strid-om-virusets-opphav_-_-dette-viruset-har-ikke-en-naturlig-opprinnelse-1.15043634, he is talking about the original paper from January (see few links above) of Zheng-Li Shi where she "whistle-blows", and that may... just may save her..., that COVID-19 contained INSERTS with a specific function of camouflage, hence, immunosuppressive, but she, seemingly on purpose, "fails" to mention the most important feature that the PRRA was also artificially inserted..., similar to her "failure" to say that RaTG13, another artificially modified sequence, "ancestor" of Sars-CoV-2, had been quoted by her two previous times with different names including the 4991 numeral...)".
"INSERTS: These are the sequences Sorensen thinks point to that the virus has no natural origin. The sequences were first described by Chinese scientists (which means Zheng-Li Shi, the main suspect, herself!!!: https://www.nature.com/articles/s41586-020-2012-7.pdf )"
"The eye opening claims also found that the virus had been doctored to bind to humans: “We are aware that these findings could have political significance and raise troubling questions... it was already fully adapted to humans. According to Sørensen, this is quite unusual for viruses that cross species barriers... the virus has properties that differ greatly from SARS, and which have never been detected in nature.”
"The specific receptor binding motif (RBM) is located on the sequence (437-508), while the receptor binding domain (RBD) has a broader location (319-541) ref. https://www.uniprot.org/uniprot/P0DTC2. The charged cysteine associated domains are Cys131-Cys166, Cys336- Cys361, Cys391-Cys525…Cys538-Cys590. As can be seen, there is a high concentration of positive charged surface exposed amino acids within the receptor domain next to the receptor binding motif."
"Sørensen said, “When we technically describe the virus, we see that it has not come about in a natural development. It’s done by Americans and Chinese, as part of what’s called “gain of function” studies. It is done all over the world. You say you don’t (my note here is that here is making reference to all those pregnant of conflict of interests beings that have denied that it is possible to obtain in a Lab a virus such as COVID-19, such as "idiots" (deliberately) Fauci, Gates, Osterholm, Andersen et al., Baric, Holmes, Gisaid (Gis-NO-aid), the CCP, etc.), but it happens all the time in advanced labs.”
"These data reveal the biological structure of SARS-CoV-2 Spike and confirm that accumulated charge from inserts and salt bridges are in surface positions capable of binding with cell membrane components other than the ACE2 receptor."
Being the previous one a very profound note to really tackle and defeat COVID-19.
"...the naked coronavirus spike protein as a concept for the basis of a vaccine, which we have rejected because of high risk of contamination with human-like epitopes. Analysis of the Spike protein of SARS-CoV-2 shows 78.4% similarity with human-like (HL) epitopes..." and "... A search so tailored to match against all human known proteins will give a 78.4% human similarity to the SARS-CoV-2 Spike protein, i.e if all epitopes on the 1255 amino acid long SARS-CoV-2 Spike protein can be used by antibodies then there will be 983 antibody binding sites which also could bind to epitopes on human proteins..." (Which is like promoting Auto-immunity, which is what thousands of carelessly designed vaccines are causing in a stupid and naïve humanity that allows their little ones and even themselves to be pinched by THEIR deadly potions!!!)
Another key finding to beware of the scum scam of Gates and Fauci killer "vaccines".
"...antibodies can only recognize 5-6 amino acids..."
Another key point that redeems 5 amino acid peptides or "epitopes" from being dismissed by sold-out to the "killers" trolls (paid by the perps).
"The initial paper was rejected by well-known journals such as Nature and the Journal of Virology back in April before the manuscript of the paper was later accepted and published on Cambridge University Press website... The conclusions of the study were also dismissed by Imperial College London and the Francis Crick Institute."
Another very important note, because here you can see who are the ones sold-out for money and "aligned" with Gates and with the CCP!!!! (And who is not-yet bought by Gates...).
So, because even if "a good intention" by researchers of "vaccines" is there, they will never know what will be added to them by the criminal cabal of the "Big Pharma" now owned by the CCP (yes, it all started by the allures of the "cheap labor", and now is killing the morals of the whole humanity, something as bad or een worst, as it persists, than the real deaths of the elderly and the sick by this artificial COVID-19 virus), here is an "antidote" against vaccination (the other is the sheer belief in miracles, as per nothing that is injected into you, Christian, will poison your body...): https://www.wellnessdoc.com/1200studies/, and its momentous links: https://www.wellnessdoc.com/wp-content/uploads/2020/05/1200-studies-The-Truth-Will-Prevail-v2.6_05-05-20.pdf and https://www.wellnessdoc.com/wp-content/uploads/2019/10/The-measles-vaccine-narrative-is-collapsing-Updated-10-09-19.pdf
Ah, and an "extra", regarding how Gates is fully involved in this artificial Pandemic from the start, we talked earlier about his desire to "Reboot" humanity with the "pretext" of COVID-19, "implementing" a one world (his, THEIR "New World Order" agenda, NWO), "attempting" (and I say that because as long as born-again Christians are still on earth, we will keep on annoying their plans and frustrating their devices as best as we can!!!) to establish: A one world religion, a one world economy and a one world government... so, the sold-out to gates Johns Hopkins University and now the WEF, are into, the first, into lying and increasing the numbers, and the second into, the "reboot" desire of Gates, they call it "The Great Reset", figure that out!!! But we are here to stop that from happening in full (once we are gone, they for sure will go ahead and fulfill all of their darkest dreams, including that dream of Soros (also contemplated with "salivation" by "its" (because he rather toss himself into the abyss, indicated Jesus) accomplices of the most corrupt, deceiving, and perverse Catholic Priesthood), the pedophiliac, which I vomit in the face!!!).
Ah!, in the spirit of the great crippled detective of fiction Columbo, "one more thing...": https://archive.vn/59lW7 "
And, thanks again to Biol. Rubio, here we have the bold statements of Sorensen, way far better than anything that I could be able to say on the issue:
"In a new peer-reviewed paper published together with Professor Angus Dalgleish of St George’s Hospital at the University of London, Sorensen claimed the novel coronavirus SARS-CoV-2 is not natural in origin."
"...published (https://www.cambridge.org/core/services/aop-cambridge-core/content/view/DBBC0FA6E3763B0067CAAD8F3363E527/S2633289220000083a.pdf/biovacc19_a_candidate_vaccine_for_covid19_sarscov2_developed_from_analysis_of_its_general_method_of_action_for_infectivity.pdf) in the Quarterly Review of Biophysics, the authors found that the coronavirus’s spike protein contains sequences that appear to be artificially inserted. “The inserted sequences should never have been published. Had it been today, it would never have happened. It was a big mistake the Chinese made. The inserted sequences have a functionality that we describe. We explain why they are essential. But the Chinese pointed to them first,” Sørensen told the NRK (https://www.nrk.no/norge/norsk-forsker-skaper-strid-om-virusets-opphav_-_-dette-viruset-har-ikke-en-naturlig-opprinnelse-1.15043634, he is talking about the original paper from January (see few links above) of Zheng-Li Shi where she "whistle-blows", and that may... just may save her..., that COVID-19 contained INSERTS with a specific function of camouflage, hence, immunosuppressive, but she, seemingly on purpose, "fails" to mention the most important feature that the PRRA was also artificially inserted..., similar to her "failure" to say that RaTG13, another artificially modified sequence, "ancestor" of Sars-CoV-2, had been quoted by her two previous times with different names including the 4991 numeral...)".
"INSERTS: These are the sequences Sorensen thinks point to that the virus has no natural origin. The sequences were first described by Chinese scientists (which means Zheng-Li Shi, the main suspect, herself!!!: https://www.nature.com/articles/s41586-020-2012-7.pdf )"
"The eye opening claims also found that the virus had been doctored to bind to humans: “We are aware that these findings could have political significance and raise troubling questions... it was already fully adapted to humans. According to Sørensen, this is quite unusual for viruses that cross species barriers... the virus has properties that differ greatly from SARS, and which have never been detected in nature.”
"The specific receptor binding motif (RBM) is located on the sequence (437-508), while the receptor binding domain (RBD) has a broader location (319-541) ref. https://www.uniprot.org/uniprot/P0DTC2. The charged cysteine associated domains are Cys131-Cys166, Cys336- Cys361, Cys391-Cys525…Cys538-Cys590. As can be seen, there is a high concentration of positive charged surface exposed amino acids within the receptor domain next to the receptor binding motif."
"Sørensen said, “When we technically describe the virus, we see that it has not come about in a natural development. It’s done by Americans and Chinese, as part of what’s called “gain of function” studies. It is done all over the world. You say you don’t (my note here is that here is making reference to all those pregnant of conflict of interests beings that have denied that it is possible to obtain in a Lab a virus such as COVID-19, such as "idiots" (deliberately) Fauci, Gates, Osterholm, Andersen et al., Baric, Holmes, Gisaid (Gis-NO-aid), the CCP, etc.), but it happens all the time in advanced labs.”
"These data reveal the biological structure of SARS-CoV-2 Spike and confirm that accumulated charge from inserts and salt bridges are in surface positions capable of binding with cell membrane components other than the ACE2 receptor."
Being the previous one a very profound note to really tackle and defeat COVID-19.
"...the naked coronavirus spike protein as a concept for the basis of a vaccine, which we have rejected because of high risk of contamination with human-like epitopes. Analysis of the Spike protein of SARS-CoV-2 shows 78.4% similarity with human-like (HL) epitopes..." and "... A search so tailored to match against all human known proteins will give a 78.4% human similarity to the SARS-CoV-2 Spike protein, i.e if all epitopes on the 1255 amino acid long SARS-CoV-2 Spike protein can be used by antibodies then there will be 983 antibody binding sites which also could bind to epitopes on human proteins..." (Which is like promoting Auto-immunity, which is what thousands of carelessly designed vaccines are causing in a stupid and naïve humanity that allows their little ones and even themselves to be pinched by THEIR deadly potions!!!)
Another key finding to beware of the scum scam of Gates and Fauci killer "vaccines".
"...antibodies can only recognize 5-6 amino acids..."
Another key point that redeems 5 amino acid peptides or "epitopes" from being dismissed by sold-out to the "killers" trolls (paid by the perps).
"The initial paper was rejected by well-known journals such as Nature and the Journal of Virology back in April before the manuscript of the paper was later accepted and published on Cambridge University Press website... The conclusions of the study were also dismissed by Imperial College London and the Francis Crick Institute."
Another very important note, because here you can see who are the ones sold-out for money and "aligned" with Gates and with the CCP!!!! (And who is not-yet bought by Gates...).
So, because even if "a good intention" by researchers of "vaccines" is there, they will never know what will be added to them by the criminal cabal of the "Big Pharma" now owned by the CCP (yes, it all started by the allures of the "cheap labor", and now is killing the morals of the whole humanity, something as bad or een worst, as it persists, than the real deaths of the elderly and the sick by this artificial COVID-19 virus), here is an "antidote" against vaccination (the other is the sheer belief in miracles, as per nothing that is injected into you, Christian, will poison your body...): https://www.wellnessdoc.com/1200studies/, and its momentous links: https://www.wellnessdoc.com/wp-content/uploads/2020/05/1200-studies-The-Truth-Will-Prevail-v2.6_05-05-20.pdf and https://www.wellnessdoc.com/wp-content/uploads/2019/10/The-measles-vaccine-narrative-is-collapsing-Updated-10-09-19.pdf
Ah, and an "extra", regarding how Gates is fully involved in this artificial Pandemic from the start, we talked earlier about his desire to "Reboot" humanity with the "pretext" of COVID-19, "implementing" a one world (his, THEIR "New World Order" agenda, NWO), "attempting" (and I say that because as long as born-again Christians are still on earth, we will keep on annoying their plans and frustrating their devices as best as we can!!!) to establish: A one world religion, a one world economy and a one world government... so, the sold-out to gates Johns Hopkins University and now the WEF, are into, the first, into lying and increasing the numbers, and the second into, the "reboot" desire of Gates, they call it "The Great Reset", figure that out!!! But we are here to stop that from happening in full (once we are gone, they for sure will go ahead and fulfill all of their darkest dreams, including that dream of Soros (also contemplated with "salivation" by "its" (because he rather toss himself into the abyss, indicated Jesus) accomplices of the most corrupt, deceiving, and perverse Catholic Priesthood), the pedophiliac, which I vomit in the face!!!).
Ah!, in the spirit of the great crippled detective of fiction Columbo, "one more thing...": https://archive.vn/59lW7 "
As Luc Montagnier said: “When the lies take the elevator, the truth takes the stairs. Even if it takes longer, the truth always ends up coming!”; so, befriend @[100001604190174:2048:Kent Heckenlively] as he holds a motherload of good information, and also download the both things here: https://www.wellnessdoc.com/1200studies/, from that free PDF book available there: "All of the learning and behavioral conditions have a prevalence much higher in boys... autoimmune diseases have a much higher prevalence in females", we can defeat lies because LIGHT is what dissipates DARKNESS!!! Of course, first in the spiritual, but also in the natural, just check how the light of the day makes the awful insects hide away!!!
Updated Jun 22, 2020, 9:18 AM
Fernando Castro-Chavez shared a memory.
4 Years Ago
Jun 20, 2017, 11:38 AM
Aquí estoy hoy, trabajando libremente para el Señor, compartiendo Sus maravillas, lo cual, en realidad, es en sí: ¡más que suficiente como para bendecir la vida! (Cualquier otra cosa que se necesite, ¡vendrá por añadidura!, es decir, sin siquiera mover un dedo): https://youtu.be/F3FCUC0M1I4 Aquí los Salmos por la victoria de Dios en tiempos de Ezequías, sin que él tuviera nada que hacer, excepto creer, orar, y proclamar la grandeza de Dios como El Libertador; así también nosotros... y, acerca del ser profetas: https://youtu.be/RYLcnzJzPfw (mi lectura de los Salmos 51 al 55, con el 14).
So...
Updated Jun 20, 2020, 12:23 PM
Joel W. Hay, an expert, states that if we check the blood banks worldwide, we will find antibodies for COVID-19 since September of 2019 (As the CCP at Wuhan left its airports wide open so as for the whole world to be infected in this unconventional "III World War"). When people was forced to stay at home and all those CONTROL tactics, the herd immunity that starts with the little ones was already at work in the world!!! The numbers are being INFLATED worldwide through bribes and malpractice, while the real cases, if there is no FEAR, are treatable!!! The full interview: https://www.youtube.com/watch?v=RdpFD8GuIS4, and the amazing shows covering what the paid by the CCP - Gates Big Pharma are not letting you to see on the every single day more and more valueless TV: https://www.youtube.com/channel/UCq6oOuhSx7ESreh6m9LGy6Q; Some research articles of him: https://pubmed.ncbi.nlm.nih.gov/?term=%22Hay+J%22+USC |
Joel W. Hay, an expert, states that if we check the blood banks worldwide, we will find antibodies for COVID-19 since September of 2019 (As the CCP at Wuhan left its airports wide open so as for the whole world to be infected in this unconventional "III World War"). When people was forced to stay at home and all those CONTROL tactics, the herd immunity that starts with the little ones was already at work in the world!!! The numbers are being INFLATED worldwide through bribes and malpractice, while the real cases, if there is no FEAR, are treatable!!! The full interview: https://www.youtube.com/watch?v=RdpFD8GuIS4, and the amazing shows covering what the paid by the CCP - Gates Big Pharma are not letting you to see on the every single day more and more valueless TV: https://www.youtube.com/channel/UCq6oOuhSx7ESreh6m9LGy6Q; Some research articles of him: https://pubmed.ncbi.nlm.nih.gov/?term=%22Hay+J%22+USC
Memories, at the Far Distance, the Song That I Sent to Her, and She used to Drive my VEHICLE: https://www.youtube.com/watch?v=VOFxUM7aOzs
Updated Jun 17, 2020, 9:23 PM
More Evidence of What is Really Going On With This Attempt By Gates To Take Over Humanity With A Deliberate Release And Pre-Planned COVID-19: https://www.youtube.com/watch?v=kIngGuof9E0, also featured in this program the great and bold @[100051043734270:2048:Nicole Sirotek]!
Updated Jun 15, 2020, 8:05 PM
Fernando Castro-Chavez updated his status.
I am proud of the character and boldness of Robert F. Kennedy Jr., and the least that I can do to demonstrate that is to repost his amazing and useful messages that make us THINK!!!:
Fernando Castro-Chavez shared a memory.
4 Years Ago
Jun 15, 2017, 7:01 PM
Aquí, con mi papá Manuel, y con mi mejor amigo del norte, y hermano cristiano en Cristo, Gabriel Oliver. Y, quiero yo felicitar a mi papá, y recordar su oración que dice antes de irse a dormir:
"Dios, gracias por darme un día más.
Gracias por mi vida y por mis seres queridos:
Por mi esposa, por mis hijos y nietos;
Ayúdalos a llevar a cabo
Los proyectos de su vida,
Para que te conozcan cada día más,
Por el amor que le tienes a tu hijo Jesucristo,"
Amén.
A Trio still alive and kicking!!!
Updated Jun 15, 2020, 7:27 AM
Por todos lados escucho que les están pagando a los familiares de fallecidos para que le pongan al acta de defunción que fue por COVID-19 aunque no lo sea: NO se dejen sobornar, por favor, el futuro inmediato de todo el mundo está en juego, ¿por qué por unos cuantos centavos le vamos a permitir a Gates que nos implante su microchip como si fuéramos "ganado" de su propiedad?: https://archive.vn/XlWXp (aquí, un corrupto sinvergüenza, como abundan en los puestos médicos políticos ahora, agregó de un jalón dos mil más supuestos muertos del COVID-19 para que fueran 5,000, cuando sólo había 3,000 en Chile, y aún ese número de tres mil parece estar sumamente inflado y es dudoso!!!); estas exageraciones para tener al mundo asustado están sucediendo por todo el mundo, y de la honestidad del ser humano depende salir de esta, con la ayuda de Dios. This reminds me of early postings: https://www.facebook.com/photo.php?fbid=3200200840032570&set=a.110933362292682&type=3 and: https://www.youtube.com/watch?v=s4p8DM8rKJI, https://www.facebook.com/fernando.castrochavez.90/posts/3232722346780419, as well as the enormous amount of false positives that the media does not even dare to report: https://archive.vn/XlWXp, and the excessive money that they pay in dollars to hospitals in the USA for reporting "positive" cases: https://archive.vn/0dwH3
Updated Jun 14, 2020, 11:43 AM
Updated Jun 14, 2020, 9:15 AM
Updated Jun 14, 2020, 9:14 AM
Updated Jun 14, 2020, 9:13 AM
Updated Jun 14, 2020, 9:13 AM
Updated Jun 14, 2020, 9:12 AM
Updated Jun 14, 2020, 9:12 AM
Updated Jun 14, 2020, 9:11 AM
Updated Jun 14, 2020, 9:10 AM
The beauties of nature, of Creation, while hiking the Appalachian Mountains, while hiding of "the little wrath of crazy men", that is absolutely palid when compared to the real and upcoming one sponsored by our dear and loving of truth and of good Dad!
Updated Jun 14, 2020, 9:10 AM
A las muchas preguntas que me hacen en Mensajes Personales, especialmente la negra me pidió versiones en español de esas películas que considero son mucho más importantes aún que lo que estamos padeciendo hoy, pues habla de una "mala leche" procedente de los corazones que están causando ello desde hace muchos años..., y con más razón ahora... por lo que sólo Dios...: https://lbry.tv/@Matrix:0/Vaxxed-Documental-robertdeniro:b, , https://lbry.tv/@HechosParaDifundir:5/mercurio-en-las-vacunas-trace-amounts:8, https://lbry.tv/@HechosParaDifundir:5/mercurio-en-las-vacunas-trace-amounts-2:e; ésta es la que aún no he encontrado en español: https://www.youtube.com/watch?v=_TxXcarO7p0, also in: https://lbry.tv/Vaxxed-II---The-People's-Truth-(2019)-Documentary:c; luego de esto secundario, me preguntan si sirve el "HIDRÓXIDO DE CLORO", y ésta ha sido mi respuesta: "Me puse a buscar, y éstos siete artículos dicen que sí sirve (la FDA de EE UU dice que no, pero no hay que hacerle caso pues está del lado de la gente corrupta que ha organizado esta pandemia, así como todas las agencias médicas de EE UU están vendidas al mal, así la OMS y la ONU también), pero gracias a Dios tenemos a Dios que nos protege y sí, usemos si nos vemos en la necesidad de usar algo, usemos aquello que Dios nos inspire para prevenir, y aún para sanar, entonces estas siete referencias aparecieron en la primera hoja de búsqueda, lo que indica que sí sirve:
1)
https://pubmed.ncbi.nlm.nih.gov/18089729/: https://www.microbiologyresearch.org/content/journal/jgv/10.1099/vir.0.83393-0,
2)
https://medcraveonline.com/IJVV/chlorine-dioxide-clo2-as-a-non-toxic-antimicrobial-agent-for-virus-bacteria-and-yeast-candida-albicans.html, 3) 3) https://academic.oup.com/femsle/article/44/3/335/554262.
4) https://www.sciencedirect.com/science/article/abs/pii/S004313549600276X,
5)
https://www.karger.com/Article/Abstract/444503,
6) https://benthamopen.com/contents/pdf/TOANTIMJ/TOANTIMJ-2-71.pdf,
7)
https://akjournals.com/view/journals/2060/107/1/article-p1.xml"
1)
https://pubmed.ncbi.nlm.nih.gov/18089729/: https://www.microbiologyresearch.org/content/journal/jgv/10.1099/vir.0.83393-0,
2)
https://medcraveonline.com/IJVV/chlorine-dioxide-clo2-as-a-non-toxic-antimicrobial-agent-for-virus-bacteria-and-yeast-candida-albicans.html, 3) 3) https://academic.oup.com/femsle/article/44/3/335/554262.
4) https://www.sciencedirect.com/science/article/abs/pii/S004313549600276X,
5)
https://www.karger.com/Article/Abstract/444503,
6) https://benthamopen.com/contents/pdf/TOANTIMJ/TOANTIMJ-2-71.pdf,
7)
https://akjournals.com/view/journals/2060/107/1/article-p1.xml"
Updated Jun 8, 2020, 7:29 AM
Fernando Castro-Chavez updated his status.
Fernando's most liked photo on Facebook of 2015
In the hopes of not being censored by expressing what I understand to be true, here is the trembling voice of one of the few bold men of America of today, Robert F. Kennedy, Jr. laying down the real plan behind the COVID-19 Pandemic: https://lbry.tv/@fdocc:b/COVID-19-Is-Gates-To-Implant-Humans:d, why in his interviews Gates associates "Digitization" with COVID-19??? Because that is the pre-planned Pandemic to instill fear in the population to blindly accept a useless vaccine loaded with the microchip to track you down!: https://www.youtube.com/watch?v=1LekHJc9Hsc, why in the last linked interview Cooper or Gupta did NOT ask anything about Gates saying that he with others had already a "blueprint" for humanity??? And why Gates associates all the times COVID-19 with "Digitization" of the human beings??? The two videos in full, the very censored one by Mikovits, because she exposes the culprits of a worst case than even COVID-19, the cover-up of the vaccines as being the originators of Autism, CFS/ME, Alzheimer, and innumerable other Chronic Diseases that did not exist before: https://lbry.tv/@BannedVideos:8/Censored-Former-AIDS-Scientist-Exposes-Dr-Faucis-Medical-Corruption:0; Kennedy says that there are some 420 new diseases that can be blamed on early vaccines and how the Big Pharma capitalizes on them by selling them drugs for life to those ailing patients!!!: https://www.youtube.com/watch?v=QLi6ZrFp6vQ
Updated Jun 6, 2020, 4:02 PM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Jun 6, 2015, 4:00 PM
today live at 6:00 PM Houston time and afterwards at: https://www.youtube.com/c/catadoresdelapalabra1 The current Mt. Ararat is NOT the proper place for Noah's ark to land, at 17K ft the air is rare in oxygen, no place horizontal enough for it to land and for animals to safely emerge and walk, no evidence of sea-shells on its slopes, indicating that Mt. Ararat originated AFTER the flood of the days of Noah!!!
The wonders of God and of His ever successful plans are palpable in the history and remains of the Ark of Noah! If He did it then with a humble heart towards Him such as it was Noah, He can en He will do it again now with the Body of Christ on earth. Even if just one man is needed to save humanity and nature (the animals originally created by God and not the monsters that were the ones not included in the ark as they had been also subjected by the vain men of those times, to the point that: "all living flesh (the biology of every kind of animal had been "tampered with" by humans, from viruses to those gigantic land mammals, and evidence of their biological knowledge can be tracked down as I have done it and published about it, within the full genetic code, the 64 triplets or codons present in the, biologically entitled since: "Book of Mutations" or "Book of Changes" of the "I Ching": https://pubmed.ncbi.nlm.nih.gov/?term=%22Castro-Chavez+F%22, evidence of the ancient knowledge of genetics within that very longevous generation of humans, corroborated by the highly calcifided, because of their long age skulls and bones of the Cromagnon, and even of their side-products the Ancient Neanderthals) had corrupted its ways", as it is starting to happen at these current times, because it will be "as in the days of Noah")... currently the times are trying times again, men play to be God by altering nature (like in a "CCP - Fauci" man-made COVID-19 virus and pandemic) and men think themselves as being a monsterous "god" by attempting to force all humans into being Digitally "Certified of Vaccination ID" ("Gates - WHO"), those two things as per my current understanding, are diabolical and as long as I still live and have a breath, I will counter that with all my strength as God and His Mighty Creation keeps on revealing HImself to me...
Updated Jun 6, 2020, 10:58 AM
https://www.youtube.com/watch?v=O7wIgFqwrhQ, https://www.nytimes.com/2016/01/10/magazine/the-lawyer-who-became-duponts-worst-nightmare.html, interpreted by Mark Ruffalo in "Dark Waters" (2019), inspired by a real situation.
Updated Jun 5, 2020, 10:42 PM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Jun 5, 2015, 10:34 AM
Dear All, A reminder of my presentation tomorrow at 6:00 PM and one of its slides, done with the help of the eagle eye of my dear bro. Joseph Grady last Saturday, showing Archaeological findings around the first city after the Flood (Mesha), built around Noah's Ark, which was its centerpiece. God bless you and thank you for all your spiritual prayers for us, for me and my wife! See you here!!! In Christ, Fernando.
The actual place of the landing of the Ark of Noah, made of "Gopher": Petrified wood, and how it slid, being pierced as a metaphor of our real Ark of Salvation that was coming: Jesus our Christ!!!
Updated Jun 5, 2020, 7:08 AM
Esperamos que esto avergüence a los despreciables censores del Facebook, al demostrar con un documental de la mismísima CNN que está vendidota a los demócratas y a los "antitrompitas" de Gates y Soros, pues en este documental se ve, ni más ni menos, que la inane REPRESIÓN propia del régimen del "Partido Comunista Chino", la cual como aquí el FB y el YT, están inmisericordemente censurando mis investigaciones acerca del origen artificial en un laboratorio del COVID-19. El video dice que procede de un VIRUS de murciélago, y la respuesta es sí, el 99.9 % sí, pero de un virus de murciélago investigado dentro del laboratorio del WIV (Wuhan Institute of Virology), más la combinación de un 0.04% de una secuencia insertada artificialmente para producir los primeros cuatro aminoácidos del sitio PRRAR de ruptura por proteasa que como dijera el lobo es "Para "derramar" mejor el ARN viral dentro de las células humanas", más la modificación artificial del 0.06% restante: L+F+QS+N+Y, para producir el RBD: Dominio de Unión al Receptor, que en este caso es el ACE2 humano, principalmente, que, de nuevo como dijera el lobo ese malvado comunista, son: "Para "unirse" mejor al receptor inicial de las células humanas". Estas dos modificaciones CLAVE en el armazón del virus de murciélago. Estos dos cambios que convierten al virus del Sars-CoV-2 en un Frankenstein viral compuesto al menos de tres diferentes procedencias genéticas NO es y NO puede ser algo natural, sino que es más bien algo ARTIFICIAL. Corono mi video al principio y al final con unas bellas tomas de Trump manteniendo en ALTO, más en ALTO que él mismo, a la Revelación de Dios para el hombre. La única que nos va a sacar de esta victoriosos!!!
Updated Jun 4, 2020, 11:25 PM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Jun 4, 2016, 10:28 PM
Otra tremenda verdad poco conocida por la cristiandad en general son los textos antiguos de Jn. 19:18, y que al juntar los cuatro Evangelios, ¡vemos sorprendidos que fueron cuatro los crucificados con Jesús! La importancia de ello es que los cuatro Evangelios son como cuatro piezas complementarias de un mural hermoso, en los que se ve el énfasis dado por cada uno: Por ejemplo en Mateo, los dos ladrones (duo lestai) que él describe, ambos blasfemaban en contra Jesús, y ambos fueron llevados a última hora, aún después de que los soldados ya se habían repartido la túnica de Jesús y habían puesto su letrero "acusatorio" en tres idiomas, mientras que antes, junto con Jesús, Lucas describe que habían llegado al Calvario dos malhechores (duo kakourgoi), de los cuales uno habló en contra de Jesús, mientras que el otro le tapó la boca a éste al decir que ellos sí merecían dicho castigo pero no Jesús, y al decirle a Jesús que se acordara de él: "cuando VINIERA en gloria en su Reino", a lo que Jesús le respondió al estilo de un Rey: En verdad te digo hoy: Estarás conmigo en el Paraíso, que por el contexto es sobre la tierra, restaurado, en los Mil Años del reinado de Jesucristo. Juan corrobora ésto al decir que había: ¡dos crucificados a cada lado de Jesús! Lo que se observa en el interlineal que he preparado para ustedes, de nuevo tomado del Codex Vaticanus del S. IV: http://www.csntm.org/manuscript/View/GA_03?OSIS=John.19.18 (más evidencia dada también por Juan y tomada de este MS UNCIAL se verá más adelante...)
As the detailed Bible research done by E. W. Bullinger demonstrates, there were four crucified with Jesus and not only two. He also had a sharp column in his Magazine "Things to Come" entitled "Signs of the Times" where he sharply denounced the wrongs of his times. We are now filled with the gift of the spirit of God, we speak in unknown tongues and we know that light dispels darkness... let us keep on using all that is given to us by God, the armor, the fruit, the service, the spirit!!!
Updated Jun 4, 2020, 7:37 AM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Jun 2, 2015, 10:49 AM
This Saturday at 6 PM [Houston time] I'll present live, findings on the actual location of Noah's Ark and its design! I fervently prayed with you last month for help to find its current location, and to understand its windows! By grace divine, I found that this Ark had two kinds of windows!!! 1) One ordered by God (Sohar, Episunagon, the open skylight! Running 1 cubit all along the roof of the ark) and 2) One designed by Noah (hallown, turida, the little window with a door to release and retrieve birds!) if you want to see this presentation, it will be available live (and afterwards), online at: https://www.youtube.com/catadoresdelapalabra1 [Remember to 'refresh' your page near the time. I thank God for His Unconditional Love and Mercy towards us!]
Hace 5 años pedí y recibí para saber la ubicación precisa del Arca de Noé. Ahora, pido a Dios lo que a mí me parece completamente imposible: La mejor compañera ^3 y volver a la móvil libertad de antes, con la contrastante y completa inmovilidad del maligno, al menos respecto a mí o nuestra posible vida restante... Ahora considero la traducción griega de esa abertura que Dios le mandó hacer a Noé: "Epi": arriba de, "Sinagoga"!!!: "Syn": Juntos; "Ago": Llegar... Viajaban unidos Noé y su esposa, y sus tres hijos: Sem, Cam y Jafet, con sus respectivas esposas. Sem, ancestro de los genuinos del Medio Oriente (los cafés), hoy hebreos bajo la dispersión (Diáspora) por todos los países y los musulmanes..., Cam, antepasado de todas las razas que no sean ni medió orientales ni caucásicas (negros y asiáticos), y Jafet, antepasado de los caucásicos (los blancos)... Cam resultó ser el malo...
Updated Jun 2, 2020, 8:01 AM
Real Science Defenders! TRUTH! Cartoonist Ben Garrison came back with another cartoon when he heard about our (Judy Mikovits and Ken Heckenlively) new book. I respect people who don't get scared by bullies!!! (Sadly, inside the monster face, is no other that FRANCIS COLLINS!!!, a really bad and hypocrite guy!!!) From the page 107 of the book that I really want you to read to be acquainted with the current corrupt science of today: http://old.autismone.org/documents/Plague%20of%20Corruption-eARC.pdf, you will be informed and enjoy the ride a lot, as we are here to make the TRUTH (in ANY avenue of life) to shine!!!
God, I want to reap what I have sown, I want to win over and over and over every single day of my life the heart of the one that sent me this message. But I also want the ones that are sowing this devastation over the planet, to reap what they are doing here with us, including those heartless censors, in the just name of Jesus, Amen.
They bring down my research and videos, thank God I am not the only one, I deeply recommend you to watch: CORBETTREPORT.COM/GATES, nailing the criminals that caused all of this out of her ambition of "total control", before they go too far... if it is still possible... Preserving the historical memories of the most bold woman of our times: Judy Mikovits, with a foreword by Robert F. Kennedy Junior. God I wish to be a man like them!!! So, help us all to get out of this one successfully!!! WE KNOW YOU WILL!!!
Updated May 23, 2020, 11:55 PM
https://waterbrookmultnomah.com/wp-content/uploads/2016/06/Sneak-Peak-CALLED-FOR-LIFE-TP-BRANTLY.pdf, saved at: https://archive.vn/cA7Db, a good read, recommended by Judy Mikovits, a bold, from Hungarian descent, hero of our times (https://books.google.com.mx/books/about/Plague.html?id=kFyCDwAAQBAJ), for whom we are fervently praying:
On the 13th of July of 2019 I was in Guangzhou, China, using a VPN because there at that time it was forbidden the open access to the Facebook and Google. On the 13th of May of 2020 Facebook blocked one of my successful postings at ResearchGate about the artificial origins of COVID-19, nothing medical related at that point, only molecular facts, as this is my dual Postdoctoral, in Molecular Biology, and of the whole "Pandemic" bringing the moral quality of humanity to one of its lowest lows in all of its history: In exactly TEN MONTHS, ladies and gentlemen, I find myself as if living already inside the Communist China, and Gates wants it to be even worst: With a chip implanted into your skin (the Digital ID2020 coupled to cryptocurrency 5G compliant) to be able to locate you at any moment that they want. I am on hiding now, and praying to GOD to be able to go back to normal, in order to visit the girl that I like the most to the far Asia with no need of vaccination in order to travel, with no need of their devilish "Passport of Immunity" which is another way to call the by Gates "Digital Certificate of Vaccination", please pray in the spirit of God.
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
May 21, 2015, 4:13 PM
Again, food for thought, for the hard-core Bible researcher, on preparation for my future study, these are thus far intriguing pieces of information related to Noah's Ark, David Allen Deal's "Noah's Ark and Naxuan" [Naxuan was the first settlement of Noah and family after they landed]. Deal debunks the wretched fantasies developed by Zecharia Sitchin about the "Anunnaki", which really means: "We of the ship of Noah"!!! http://fdocc.ucoz.com/2/the_ark_of_noah_compressed_deal.pdf
Deep studies into the Hebrew of the Bible, interestingly, prophetically, from Noah!!!:
Updated May 21, 2020, 7:26 AM
Si me eliminan de aquí del FB, sigo trabajando acá (If I ever get eliminated from here at the Facebook, I will continue working here): https://fdocc.neocities.org/
Updated May 19, 2020, 5:48 PM
When the deadly funding was cancelled...: https://breggin.com/trump-cancels-funding-of-us-china-research-making-epidemic-viruses/
Updated May 19, 2020, 2:20 PM
Take your breath away while looking at the beauties of our dear GOD!!! Dear God, thank you for still so much beauty around us within this earth!!!
Updated May 19, 2020, 2:15 PM
The inventive of the ancient man... and how many hidden treasures from the past, even those riches within the hidden treasures from the flood, are still awaiting to be taken in ownership by those who are OF GOD???, which means, "TO BE TAKEN BY US!!!"
Updated May 19, 2020, 2:13 PM
An amazingly catchy rudimentary house!!! A reminder of our houses, for wealthy and comfortable as we may thing they are, they are just a passing by situation, we have our eyes set in heaven for the impending moment when Jesus will show up to call us up to we, his brethren!!!
Updated May 19, 2020, 2:11 PM
The wells of waters!!! Wherever there is water, there is also life, wherever there is living water, there is also eternal life!!!
Updated May 19, 2020, 2:09 PM
Building temporary abodes, and hey, even this big brick house filled with goods inside, this is also like that one in the sense that it is just a TEMPORARY abode!!! Our great big dwelling place with God, that will also be temporary, as we are coming back to earth, to kick for the last time, that well-known rear of the Adversary that we keep on kicking on a daily, on an hourly basis!!! Hehee!!! Then, God is moving back to earth!!! But He is so set to his dwelling place, that He is bringing it with Him!!! The "real" paradise then will be back, the "real" basis for the Temple and for the Tabernacle designs!!!
Updated May 19, 2020, 2:08 PM
Spring wells where the Ferns grow. And this Fern is saying: "God, thank you very much for taking care of me and of all of your children spread wide open all over the Planet"!!!
Updated May 19, 2020, 2:04 PM
A three hundred years old tree, and are we worried for 1/3, for whatever it is that happens within our, most possible, within the hundred mark life-span? God says: "Come here, I have you COVERED"!!!
Updated May 19, 2020, 2:03 PM
The best landscapes, the best tours, the best of the best of times with our beloved one, are really priceless, and are indeed free!!! "Here, my sons," says God, "I give you still the whole Universe to you!!!"
Updated May 19, 2020, 2:01 PM
Orange flowers of a tree, good for shelter from the heat, good also to have a sweet smell to escape, at least for a minute, to escape out of our own sweat!!! Hehee!!!
Updated May 19, 2020, 2:00 PM
A detail of an exquisite purple flower with paintings of yellow and white!!! The beautiful details of Creation are more and more evident as we observe more and more carefully!!!
Updated May 19, 2020, 1:58 PM
We know that after we are gone, lots of people will wonder and wander, what could be better than to live for them the maps of the best of the best hideaways to escape from the soaked-red hands of "The Beast"?:
Updated May 22, 2020, 7:59 AM
Purple flowers!!! They keep on giving their discrete beauty, and they will keep on doing it, even after our departure!!! Godspeed!
Updated May 19, 2020, 1:55 PM
And from all the flowers, the detail of only ONE flower that I want to be mine!!! (God willing too, but at least mine is set)
Updated May 19, 2020, 1:54 PM
Flowers do not know about human restrictions or of evil human "schemes", they just keep on growing wherever they find a space to do it!!!
Updated May 19, 2020, 1:53 PM
The beautiful reflections of the LIGHT, the one that fills everything at its path, any darkness is melted like snow in the presence of the LIGHT!!!
Updated May 19, 2020, 1:52 PM
The road may be narrow, but the freedom is wide, "keep walking son", and also, "keep walking girl"!!!
Updated May 19, 2020, 1:50 PM
The beauty of a blue heaven with white, and the beauty of a green earth with brown, Created by God, is something that just fills will feelings and emotions a normal human being!!!
Updated May 19, 2020, 1:49 PM
The searching for freedom will not stop, nobody can do anything against the will of the many, especially when the born-again crew is still walking freely over this God-given earth that remains forever:
Updated May 19, 2020, 1:48 PM
Los comentarios en el original son bastante buenos, gracias al incansable crítico de toda patraña, Dr. @[100001535731331:2048:Raul Martín Cruz-mireles]:
Updated May 19, 2020, 12:41 PM
Evidence that countries that are doing their best, such as Taiwan, are fully ignored by the WHO who does not even recognizes it as a country!!! The WHO caters and cow tows prioritarily to China, and the WHO just wants to scare the world-out into going through an universal vaccination spree; but, we are NOT going to let them get away with that, as they follow the orders of Gates and of Fauci to push that vaccination "mandate", plus the implant of the ID2020, which is 5G compliant under the skin of humans (they already started testing these waves in the airports since their previously designed 9/11 event). This is the "DIGITIZATION": https://www.youtube.com/watch?v=1LekHJc9Hsc, which Gates wants to achieve through this COVID-19 roaring "wolf", an universal "scare", meanwhile, the countries that already controlled the virus, those are virtually ignored as they do not "match" the scare tactics and the exaggeratedly inflationary numbers posted by "Johns Hopkins" which exhibits the clear bias to exaggerate, blooming out of proportions, the "false positives" by design, but Taiwan is here saying: "Hello"!!!: https://www.youtube.com/watch?v=iiUHhHcxHVM (This is something that the girl that I like very much reminded me to consider...). Success of which I also congratulate my former colleague from Taiwan, 沈信學, Dr. Shen, which I met at the NYMC. |
Evidence that countries that are doing their best, such as Taiwan, are fully ignored by the WHO who does not even recognizes it as a country!!! The WHO caters and cow tows prioritarily to China, and the WHO just wants to scare the world-out into going through an universal vaccination spree; but, we are NOT going to let them get away with that, as they follow the orders of Gates and of Fauci to push that vaccination "mandate", plus the implant of the ID2020, which is 5G compliant under the skin of humans (they already started testing these waves in the airports since their previously designed 9/11 event). This is the "DIGITIZATION": https://www.youtube.com/watch?v=1LekHJc9Hsc, which Gates wants to achieve through this COVID-19 roaring "wolf", an universal "scare", meanwhile, the countries that already controlled the virus, those are virtually ignored as they do not "match" the scare tactics and the exaggeratedly inflationary numbers posted by "Johns Hopkins" which exhibits the clear bias to exaggerate, blooming out of proportions, the "false positives" by design, but Taiwan is here saying: "Hello"!!!: https://www.youtube.com/watch?v=iiUHhHcxHVM (This is something that the girl that I like very much reminded me to consider...). Success of which I also congratulate my former colleague from Taiwan, 沈信學, Dr. Shen, which I met at the NYMC.
El comienzo de mi lectura del libro de Job del 1:1 al 3:8, del Hebreo, Griego e Inglés, al Español!!!:
Updated May 17, 2020, 10:33 PM
Another bold Doctor denouncing the artificial manufacture in a lab of the COVID-19: https://youtu.be/Y4E90SCSqS0, remembering that this is not a "right" wing, "left" wing battle only, it is a battle for the TRUTH wherever side it may be, as ""pukative"" for me where the Satan worshipping Clintons, as the hypocrite "dubya" and his vomitive pals Cheney, Rumsfeld (ex-Gilead head, now pushing the "Remdesivir") and Kissinger, as repugnant is today Gates, Fauci, WHO and UN, please be alert and be not swinged aside by fights against brethren, is true that they want to get rid of the vulnerable people of Social Security in the USA, but it is a bigger picture truer and affecting the whole of the planet, the desires of "DIGITIZE" humanity by implanting it with the ID2020, and we will NOT allow anybody to go above and beyond our free will, not the "right" (and hopefully Trump is NOT deceived with the commanding order to vaccinate by FORCE all of the US citizens out of the false statistical exaggerations of the COVID-19 cases in the USA, if he does that: WE ALL ARE COMMITTED TO OPPOSE THAT NO MATTER WHOM!!!), not the "left" (THAT WANTS TO HAVE APPROVED ITS PROPOSAL 6666 TO ENTER INTO YOUR HOUSES TO TAKE AWAY YOUR CHILDREN INTO "CONCENTRATION CAMPS" WHERE THEY WILL VACCINATE THEM AGAINST THEIR AND YOUR, OH DEAR PARENTS, WILL!!!, OR SUPPOSEDLY TO TAKE AWAY SICK PEOPLE TO IMPRISON THEM, SUPPOSEDLY WITH COVID-19 BY A "DENOUNCE" OF UNKNOWN AGENTS (that may as well be your own neighbours or relatives!!! As the Bible prophesied: Son against his father, sister against her brother, wife against her husband, etc., etc.), BUT THAT IS JUST A PRETEXT TO VIOLATE YOU OVER AND OVER AND OVER: TO OVERSTEP ON THE RULE OF LAW, AND WE ARE NOT GOING TO ALLOW THAT TO HAPPEN: NOT IN OUR WATCH, OH DEAR BORN AGAIN ONES OF EVERY COLOR AND NATION!!!), but WE SEEK AT the CENTER of justice: JESUS THE CHRIST!!! These are perilous times and we not need to play the left-right card anymore, but to see what is right and support it: The BOLD people and doctors of CALIFORNIA are acting with more guts against this COVID-19 media DIGITIZATION "masquerade" than the "sissy" people of TEXAS, why???? We all need to ACT as GOD inspires us to DO!!! Please.
Updated May 17, 2020, 9:08 AM
Thanks to Diane again: https://youtu.be/SiafDQTlpx0
No matter what they do, we still and will have forever GOD, nobody can take that away from us!!! AND we still have His wonders of Creation, and the spiritual prayer for each other, leaving in the flushing toilet every selfishness, vanity, and hypocrisy, we do NOT need those things for the ride: Have a nice traveling oh dear saints from and through all the planet!!!
Updated May 16, 2020, 9:56 AM
The tools, whatever God will inspire to you, if the elderly we can do it, how much more the youthful you that still want freedom and to fight with all you got for it!!! So help us all GOD!!!
Updated May 16, 2020, 9:54 AM
We need no money, we need no "Cryptocurrency" sponsored by "The Beast", we just need GOD, and each other, blessed saints, and we can escape to the wilderness and live from the natural goods that God is giving us since the beginning... search, search for the hidden places to escape, for those that are coming behind us... to leave them a trail of hope!!!
Updated May 16, 2020, 9:52 AM
Having each other, having the Body of Christ, speaking non-stop in tongues, going out to the most recondit and hidden fields of our dear and good planet, to leave those vital maps for those left behind... that will believe after we are gone due to the trails that we are living here...
Updated May 16, 2020, 9:50 AM
The freedom of the children of GOD!!!, NOT bound by ANYBODY, and the least by any "THING", but ONLY by Jesus, out of our free will!!
Updated May 16, 2020, 9:49 AM
Remember: The "Falling Away" is indeed Our "Departure" from this Earth, it is the "Rapture" (the "Harpazo", that will rather start with the sound of a Trumpet): https://www.pre-trib.org/pretribfiles/pdfs/Woods-SecondThessalonians2-3_Pt1.pdf
https://www.pre-trib.org/pretribfiles/pdfs/Woods-SecondThessalonians2-3_Pt2.pdf
https://www.pre-trib.org/pretribfiles/pdfs/Woods-SecondThessalonians2-3_Pt3.pdf
https://www.pre-trib.org/pretribfiles/pdfs/Woods-SecondThessalonians2-3_Pt2.pdf
https://www.pre-trib.org/pretribfiles/pdfs/Woods-SecondThessalonians2-3_Pt3.pdf
Even in Paradise we have work to do, things to achieve, goals to fulfill, but with the ever present presence of our dear and beloved Father!!! Reminding us all to STAND as they are STANDING!!!, oh my dear brother @[766320647:2048:George Logsdon].
Updated May 15, 2020, 2:24 PM
Updated May 15, 2020, 2:21 PM
Updated May 15, 2020, 2:21 PM
Updated May 15, 2020, 2:21 PM
Updated May 15, 2020, 2:20 PM
Updated May 15, 2020, 2:20 PM
Updated May 15, 2020, 2:15 PM
Updated May 15, 2020, 2:15 PM
Updated May 15, 2020, 2:14 PM
The Landscapes of Freedom!!! We are the Owners of the Creation of God. This Current World is NOT our Home, but We are Coming Back, after We are Gone for a Season!
Updated May 15, 2020, 2:13 PM
British Doctor Vernon Coleman speaks out: How come in New York out of a sudden every other disease is also COVID-19???: https://www.youtube.com/watch?v=k2NLa3aNUw4, KUDOS to the bold men of all ages that are shedding light to this pernicious deception in the sense of its unduly exaggeration (Thanks to Diane for the great video):
Updated May 15, 2020, 9:06 AM
Fernando Castro-Chavez updated his status.
Gracias a Ana Georgina por enviarnos la traducción del excelente video de la valerosa Dra. Judy Mikovits en español, aquí se tiene una de las últimas veces que el sitio original, pero sin acceso a la película fue salvado antes de que lo hackearan las bestias del NIAID, WHO, Gates: https://web.archive.org/web/20200512220911/https://plandemicmovie.com/, al menos se conserva vivo aquí (aún cuando tiene una advertencia, no somos niños idiotas y sabemos distinguir, verdad?): https://www.facebook.com/eter.revista/videos/2627607584188909/, cómo dice allí, descárguenlo si lo desean, pues lo están borrando de todos lados:
One question of @[1410933632:2048:Jose Francisco Norambuena Michea], brought to my memory one of the old studies that I did in my past, only visible to those with eyes wide open: "Titus 2:13 looking for the blessed hope and glorious appearing of our great God and Savior, Jesus Christ" (being here the only key the little " , " as it is saying that the "blessed hope and glorious appearing of our great God and Savior" is: "Jesus Christ"), which brings me to this one and its original meaning: https://web.archive.org/web/20081229235917/http://www.geocities.com//fdocc3/in-my-name.htm
Updated May 12, 2020, 4:19 PM
La batalla entre la LUZ y las tinieblas continúa: "Dice erróneamente (y el primer nexo asociado a "posts" ya nos llama "mobs", y he de decir que continuamente se está modificando esa página ya que en la primera vez que leí eso ese nexo aún no era agregado, sino solamente el de FB. Heheee, malditos todos ellos): "Some posts on Facebook and elsewhere have spread more sinister conspiracy theories, including that he wants to implant microchips in people to track who has been tested for Covid-19, an allegation flagged as false by Facebook. A common theme of such stories is that he seeks to profit from the crisis." Aquí "to track who has been tested" es TOTALMENTE erróneo (así se manejan las tinieblas, con pequeños errores que esperan que la gente no detecte, como el blatante cambio en la entrevista que el... de Anderson Cooper y el vendido de Sanjay Gupta le hicieran hace un par de semanas, en la que trastocaron los "Falsos Positivos" de las pruebas, que eran el UPROAR de todo el mundo, a preguntarle al "experto" doctor Kill Bill acerca de los "Falsos Negativos", lo que no era motivo alguno de controversia), aquí le cambian a TESTS, lo que es VACCINES, y el asunto no es "that he seeks to profit" de ninguna manera, sino que el hecho de que él busca vacunar cínicamente a toda la población, ya haya sido "preventivamente" que era lo que él inicialmente quería, o cómo ahora, vacunar a toda la población para "apagar" a las exageraciones numéricas de los medios respecto a las víctimas causadas por este virus diseñado en un laboratorio de la gripa del 2020: "Mr. Gates questions pharmaceutical company chief executives, digging into the details of vaccine production. “Every day, it’s, OK, are we going to run out of glass vials?” he said. “You may think that’s a simple part of it, but nobody’s ever made 7 billion vaccines.”" Aquí se ve claramente que desde el principio su plan era salirse con la suya de vacunar a toda la humanidad para implantarle lo que él llama la "DIGITALIZACIÓN", cínicamente en su misma y última entrevista citada en CNN, casi al final de la misma. Y sus cochinas palabras más bien alientan más dudas ya que los primeros casos en EU tienen que ver directamente con él, en Seattle, cómo él mismo dijo, donde previamente había estado él metido en vacunar contra la "gripa" (y sabemos que los positivos dan en falso pues todo vacunado de gripa da positivo para este COVID-19), y a escasas once millas de su casa para el segundo caso. Es también notable que por ningún lado en ese artículo se ve su interés en indagar acerca del ORIGEN del virus pues eso tumbaría su circo. Recuerden que ANTES de que me diera cuenta de su plan satánico de implantar a todos yo hasta le envié un mensaje de Instagram proponiéndole la solución enzimática contra el virus, pero como eso no coincide con su preestablecido plan de implantar a la humanidad para seguirles la pista entre muchas otras violaciones a las libertades humanas, nunca me contestó, lo eliminé de mi lista por maldito. Con usar una enzima ZAP que desbarate al sitio de nucleótidos que más claramente muestra la intervención humana llamado el sitio de ruptura por furina, con eso se acaba este cuento del LOBO FEROZ COVID-19, y ahora que estoy aprendiendo de Judy Mikovits, veo que otra segunda forma alterna para darle en la madre al virus es aquella de hacer análogos peptídicos falsos de ese sitio de ruptura por furina: PRRAR (yo lo llamaría "Péptido P") y/o "Péptido R", que se pegue al RBD (Receptor Binding Domain del virus: L+F+QS+N+Y, en un sitio de 153 bases), para que se peguen a sus receptores bloqueando de esa forma la pegadura del virus mismo, es lo que el laboratorio de Judy descubrió con el "Péptido T" contra el SIDA, por eso ella recomienda que veamos la película de "Dallas Buyers Club", en donde se ve que humanos con SIDA, pone solamente un ejemplo de los muchos que hacían lo mismo, buscaban en los mercados clandestinos a ese "Péptido T" y otras alternativas NO autorizadas en EUA pero que eran mejores que lo que EUA quería lucrar con (AZT), y él buscaba en lugares como México, Japón, Israel, etc.; en fin, con las medicinas que el NIH probaba, a este tipo enfermo de SIDA por sexo no protegido le habían dado un mes de vida, con las medicinas clandestinas, alternas y ciertas, pudo sobrevivir por más tiempo que el OFICIAL: Algunas referencias: https://en.wikipedia.org/wiki/Peptide_T, el sidoso de la vida real: https://en.wikipedia.org/wiki/Ron_Woodroof, la representación muy interesante de Hollywood: http://m4ufree.tv/watch-9b7-dallas-buyers-club-2013-movie-online-free-m4ufree.html (FEMBED. y su "script": http://www.mzp-tv.co.uk/movie_scripts/Drama/Dallas-Buyers-Club.pdf), en fin, casi cada cosa que dice Gates se puede rebatir con la evidencia de otras muchas cosas que él está haciendo detrás de las cámaras y que NO las incluye en su entrevista y que muestran el lado siniestro, diabólico, de su plan, como esa patente 060606 de "cripto-currency" que si el Wall Street Journal, si fuera honesto, hubiera mencionado... o estas otras dos, que se anexan en el previo mensaje que mandé y que son irrebatibles de lo que él anda haciendo detrás de la entrevista que solamente presenta, lleno de contradicciones, un sólo lado de este maldito criminal disfrazado de "buena gente"...", me estoy refiriendo al artículo de ayer de https://www.wsj.com/articles/bill-gates-coronavirus-vaccine-covid-19-11589207803, y son...: Esta... de lo que Gates anda haciendo no la menciona el maldito WSJ tendencioso, no es para los TESTS como distorsionó el WSJ, sino que es para las VACUNAS: https://www.scientificamerican.com/article/invisible-ink-could-reveal-whether-kids-have-been-vaccinated/, y Kennedy Jr. encontró otro de los muchos artículos científicos de empresas e instituciones privadas recibiendo el dinero manchado de su fundación en donde se está trabajando en lo mismo... Esto tampoco lo menciona el... de Gates ni su... entrevistadora, que ya de antemano, preventiva o curativamente tenían el plan de marcar con el ID2020 a toda la población humana, por lo tanto, tanto su cochina y falsa "profecía" (pues el NO es de Dios), llevaba la cola de implantar a la gente a como diera lugar, y este es el sitio oficial de este plan: https://id2020.org/faq, Tampoco se menciona que básicamente Gates controla a TODO el monopolio de vacunas a nivel mundial, tanto por comunicarse con todas las farmacéuticas como con las agencias gubernamentales, y se jacta de ello en su entrevista, de EUA y de la Unión Europea, además desde luego, de que ha comprado también al tercer mundo que incluso es "más bara": https://www.gavi.org/operating-model/gavis-partnership-model/bill-melinda-gates-foundation
Es tan cínico, que en las plataformas de su compañía si habla de ese preestablecido plan de implantar a la humanidad, pero todo eso se distorsiona y se pasa de largo en la engañosa entrevista que ha sido dada, simplemente para un "damage control": https://www.windowscentral.com/microsoft-universal-digital-identification-and-you?amp
En fin, es sin fin todo aquello que se puede argumentar en contra de la hipocresía de Gates y sus siniestros planes que en todo detalle, solamente DIos conoce, pero como yo soñé que mi denuncia era clave para detener las obras de Satanás en este tiempo, pues eso seguiré haciendo, como dicen en EUA: "Shame on the Gates": https://www.biometricupdate.com/201909/id2020-and-partners-launch-program-to-provide-digital-id-with-vaccines
Es bueno que gente aún con... se para firme a denunciar a Gates, como Kennedy Jr., por el que pido que no lo vayan a matar como mataron a su papá, el candidato, a su tío, el presidente, etc.: https://childrenshealthdefense.org/news/government-corruption/gates-globalist-vaccine-agenda-a-win-win-for-pharma-and-mandatory-vaccination/
Recordando lo de la patente de la bestia hecha por Gates: https://patentscope.wipo.int/search/en/detail.jsf?docId=WO2020060606 Aún la cínica manera en la que se presenta la cooperación incondicional de Fauci con Gates es "spineada" en los medios, pero aún así se observa lo siniestro del asunto: https://www.huffpost.com/entry/fauci-warned-of-trump-pandemic-2017_n_5e8a0548c5b6e7d76c65c8a4 Aquí está Gates, básicamente comprando a las agencias médicas norteamericanas del NIH que dirige Collins, y del otro NIAID (Ni "ayuda" en nada) que dirige Fauci. El Washington Times señala lo siniestro de esta coligación entre agencias gubernamentales, Gates, y yo añadiría a la "Big Pharma": https://amp.washingtontimes.com/news/2020/apr/11/bill-gates-anthony-fauci-unelected-destroyers-free/
También the National File señala esto: https://nationalfile.com/president-trump-vs-bill-gates-on-treatment-fauci-has-a-100-million-conflict-of-interest/
Un maldito que desde el principio está gritando que desea "El Nuevo Orden Mundial" es el diabolíco de Kissinger, y él se da cuenta que COVID-19 es el perfecto pretexto para desatar aquello (pero aquí estamos nosotros para denunciarlo): http://petroleumag.com/the-coronavirus-pandemic-will-forever-alter-the-world-order"
Es tan cínico, que en las plataformas de su compañía si habla de ese preestablecido plan de implantar a la humanidad, pero todo eso se distorsiona y se pasa de largo en la engañosa entrevista que ha sido dada, simplemente para un "damage control": https://www.windowscentral.com/microsoft-universal-digital-identification-and-you?amp
En fin, es sin fin todo aquello que se puede argumentar en contra de la hipocresía de Gates y sus siniestros planes que en todo detalle, solamente DIos conoce, pero como yo soñé que mi denuncia era clave para detener las obras de Satanás en este tiempo, pues eso seguiré haciendo, como dicen en EUA: "Shame on the Gates": https://www.biometricupdate.com/201909/id2020-and-partners-launch-program-to-provide-digital-id-with-vaccines
Es bueno que gente aún con... se para firme a denunciar a Gates, como Kennedy Jr., por el que pido que no lo vayan a matar como mataron a su papá, el candidato, a su tío, el presidente, etc.: https://childrenshealthdefense.org/news/government-corruption/gates-globalist-vaccine-agenda-a-win-win-for-pharma-and-mandatory-vaccination/
Recordando lo de la patente de la bestia hecha por Gates: https://patentscope.wipo.int/search/en/detail.jsf?docId=WO2020060606 Aún la cínica manera en la que se presenta la cooperación incondicional de Fauci con Gates es "spineada" en los medios, pero aún así se observa lo siniestro del asunto: https://www.huffpost.com/entry/fauci-warned-of-trump-pandemic-2017_n_5e8a0548c5b6e7d76c65c8a4 Aquí está Gates, básicamente comprando a las agencias médicas norteamericanas del NIH que dirige Collins, y del otro NIAID (Ni "ayuda" en nada) que dirige Fauci. El Washington Times señala lo siniestro de esta coligación entre agencias gubernamentales, Gates, y yo añadiría a la "Big Pharma": https://amp.washingtontimes.com/news/2020/apr/11/bill-gates-anthony-fauci-unelected-destroyers-free/
También the National File señala esto: https://nationalfile.com/president-trump-vs-bill-gates-on-treatment-fauci-has-a-100-million-conflict-of-interest/
Un maldito que desde el principio está gritando que desea "El Nuevo Orden Mundial" es el diabolíco de Kissinger, y él se da cuenta que COVID-19 es el perfecto pretexto para desatar aquello (pero aquí estamos nosotros para denunciarlo): http://petroleumag.com/the-coronavirus-pandemic-will-forever-alter-the-world-order"
Updated May 12, 2020, 9:44 AM
I, like many that kept it relatively quiet at that time, we started discovering all of those workings of iniquity and its "Mystery" since 2001, but basically I was mocked and despised, either by hypocritical persons... yes my dear... they can be the worst..., but you just forgive and you just move on...; or the other sort of beings, that, either felt themselves to know it all, or imagined that such evil as which I was detecting since that time by such "Mystery of Iniquity" was impossible to perform (but really, didn't you perceive the stench and repugnance coming out of the mouth of that VP and of his buddies from hell?)... "to pull"... now we have the power within, as a Body of Christ, to still Speak in Tongues as much as we can, because our Lord will continue stepping on the head of the Adversary once more while we are still here, but this time, leading, instructing, revealing things to that Body of him on earth, so, here is the landscape of the whole earth at our feet, WE: OF CHRIST, ARE THE LEGITIMATE OWNERS STILL OF ALL OF HIS POWER TO DO ALL THOSE HEALINGS, ALL THOSE MIRACLES, ALL THOSE WONDERS, AND ALL THOSE SIGNALS... But, wait!, do not believe in all of those rumors of "Pandemias" and of the rumors of "Wars", those will NOT touch you!!! Now, take a deep breath on the cleanest air around you, an ask God what can you do, even if it is just to keep on praying, that is what helps more than anything... la oración del renacido puede mucho más...
Updated May 11, 2020, 7:47 PM
But in the mean time, we use the resources of..., to glorify still God as long as we still are here to do it, so, take again a deep breadth, and decide to go out to the closest natural area near to you, if you wish, then you will see that nobody can bind you, that God has given you all of this beauty of nature that NOBODY can steal from you, the Beauty of Creation that God did for you!!!:
Updated May 11, 2020, 7:33 PM
The secrets of freedom, and of finding the beauty of nature out of the cities, the hideaways, the places when we and God are still sovereign until the end, until the last moment of the last Christian touching with his sole the surface of this earth that certainly is going to be tried to the ashes, starting when we all that accepted Jesus are gone, are out of here...
Updated May 11, 2020, 7:31 PM
Updated May 11, 2020, 7:27 PM
Updated May 11, 2020, 7:27 PM
Updated May 11, 2020, 7:26 PM
Updated May 11, 2020, 7:26 PM
Updated May 11, 2020, 7:25 PM
Updated May 11, 2020, 7:25 PM
Updated May 11, 2020, 7:24 PM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
May 11, 2015, 9:15 AM
Una de esas grandes gemas que Dios me ha revelado mediante Su Palabra es el distinguir la diferencia entre: 1) el lugar santo, y 2) el lugar santísimo dentro del Cuerpo de Cristo, como Pablo dijera, esto ni lo leí, ni lo escuché de hombre alguno. Porque por gracia tú como individuo ya eres "el lugar santo" por la obra que Cristo completó por tí, en cambio, "el lugar santísimo" somos todos los creyentes renacidos juntos hasta ese glorioso día en el que Cristo nos lleve a todos juntos para estar para siempre con él !!!
Somos el Lugar Santísimo de Dios para la Naciones, somos el Lugar Santo de los Santos por donde habla Dios, somos la Ley del Amor para el mundo, somos el maná del cielo que no se pudre, la vara siempre viva y dando fruto espiritual bajo nuestra libre voluntad, somos los actuales mediadores entre Dios y los hombres: Somos el Cuerpo Vivo de Cristo sobre esta magullada tierra!!! Y qué estamos haciendo? Lo que haremos. Dios nos dirá a cada uno en lo particular, pues es Su plan de derrota al enemigo, no el nuestro. Lo único que Él nos pide es dejar de lado a la hipocresía, y tener humildad y mansedumbre para que se Le escuche: Bienaventurados los...
Updated May 11, 2020, 7:50 AM
Updated May 10, 2020, 7:49 PM
Fernando Castro-Chavez shared a memory.
Una vez más, recordando a mi progenitora, y a todo el apoyo que me ha dado para que yo pueda llegar a ser lo que aún puedo llegar a ser, con Dios, y que Dios me la bendiga!!'
Updated May 10, 2020, 9:28 AM
Es un honor para mí el poder presentarles mi investigación en español acerca del COVID-19, gracias a la petición del Dr. Raul Martín Cruz-mireles, y contando con las buenas sugerencias de mi nuevo colega Alberto Rubio Casillas, por favor, píquenle aquí (¡dénle un piquetazo!), para que lo puedan leer: https://fdocc.yolasite.com/resources/fdocc-antiCOVIDiana1.pdf, espero les sea informativo. Oro en Cristo por la LUZ derrotando a las "tiny-eblas" (Reminding that its Abstract is also in English, and intro to Appendix Ah! too). Actualizado en inglés tres meses después: https://zenodo.org/record/3988139 (For Light to Prevail!)
The Undergoing Investigations (thanks to @[100000479774539:2048:Russell Phillips] for this awesome and "hyper-censored" footage, the likes of Gates, the OMS and Fauci, NIH, thought to get away by controlling the media, and even horribly all the internet platforms with their non-invited and pouring lies "updates on COVID-19", and they tried also to hijack the official medical agencies of the US, but as said: Here we the genuine Born-Again ones are being a total "annoyance" to the hypocrites and to the current "Mystery of Iniquity", Hehee!"): |
The Undergoing Investigations (thanks to Russell Phillips for this awesome and "hyper-censored" footage, the likes of Gates, the OMS and Fauci, NIH, thought to get away by controlling the media, and even horribly all the internet platforms with their non-invited and pouring lies "updates on COVID-19", and they tried also to hijack the official medical agencies of the US, but as said: Here we the genuine Born-Again ones are being a total "annoyance" to the hypocrites and to the current "Mystery of Iniquity", Hehee!"):
"Estamos tan enfocados en nuestra búsqueda de la verdad, que se nos pasa considerar que son muy pocos los que realmente desean que la encontremos."
Valery A. Legasov (Investigador ruso a cargo de Chernobyl).
“Aquí no tenemos miedo de seguir a la verdad hasta donde ésta nos lleve, ni de tolerar al error mientras que nos quede la libertad para combatirlo.”
Thomas Jefferson (Coautor de la Constitución de los EE UU, y su Tercer Presidente).
[Epígrafes de mi estudio, citados, el primero por el valiente Robert F. Kennedy Jr., y el segundo por la valerosa Judy Mikovits; ¡aún existen héroes honestos en el liderazgo de los EE UU!, por los que oramos sin cesar, por su vida y por su protección, por su sabiduría y por su acción, pero también por la nuestra bajo la dirección de Dios, pues no queremos ser unos simples y pasivos bultos de caucho, a expensas de las guantadas de los inicuos... Hehee]
Valery A. Legasov (Investigador ruso a cargo de Chernobyl).
“Aquí no tenemos miedo de seguir a la verdad hasta donde ésta nos lleve, ni de tolerar al error mientras que nos quede la libertad para combatirlo.”
Thomas Jefferson (Coautor de la Constitución de los EE UU, y su Tercer Presidente).
[Epígrafes de mi estudio, citados, el primero por el valiente Robert F. Kennedy Jr., y el segundo por la valerosa Judy Mikovits; ¡aún existen héroes honestos en el liderazgo de los EE UU!, por los que oramos sin cesar, por su vida y por su protección, por su sabiduría y por su acción, pero también por la nuestra bajo la dirección de Dios, pues no queremos ser unos simples y pasivos bultos de caucho, a expensas de las guantadas de los inicuos... Hehee]
Update: But, honest Citizens keep on uploading this truthful video, even when the censorship of the criminals of the WHO and of Gates keep on removing it: https://www.youtube.com/watch?v=WxczJ1I4qnc (let us see how long it lasts... and others will keep uploading it elsewhere, Hehee!!!, they just removed the sound of the one I had here, so, I changed the link to one with sound!) My posting of Today: "As simple as to keep moist or humidified your nostrils is enough as a PREVENTIVE strategy against COVID-19, but only when you are in a crowded environment (something nowadays almost impossible) my advice continues to moisturize your nose orifices with your own saliva, as the enzymes within it are powerful even to destroy the HIV!!! (Basically DO NOT keep a dry nose when on crowded places nowadays during this artificially designed Pandemia by the likes of the WHO, Fauci, Gates, CCP, Big Pharma, almost all the "Health" agencies of the US, US Democrats (the leaders, not the sheeple), etc.; and of course, also keeping your mouse shut to nullify the entrance of anything through there):
Article Why Is HIV Rarely Transmitted by Oral Secretions?: Saliva Ca...
Arch Intern Med
. 1999 Feb 8;159(3):303-10. doi: 10.1001/archinte.159.3.303.
Why Is HIV Rarely Transmitted by Oral Secretions? Saliva Can Disrupt Orally Shed, Infected Leukocytes
S Baron, J Poast, M W Cloyd
Affiliation:
Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston 77555-1019, USA.
PMID: 9989543
DOI: 10.1001/archinte.159.3.303
This, we know that Big Pharma is going to ignore and deny because it is NOT convenient for them such a free and easy preventative!!!
And now, we received a very related observation sent by our dear Jean.Claude Perez indicating that a moist and humidified environment, such that of the beach, and moisturizers of the rooms, of the environment, get away with the possibility of any kind of airborne viruses to be around without being caught by vapor droplets and precipitated!!! Dryness is the vector of the virus, humidity is its demise!!!:
https://web.archive.org/web/20200503040507/https://draganprimorac.org/fighting-covid-19-with-water/
Fighting COVID-19 with water
Gordan Lauc 1, Alemka Markotic 2, Ivan Gornik 3, Dragan Primorac 4-9
1 University of Zagreb Faculty of Pharmacy and Biochemistry & Genos Glycoscience Research Laboratory, Zagreb, Croatia
2 Clinics for Infective Diseases, Dr. Fran Mihaljević, Zagreb, Croatia
3 Department of Emergency Medicine, Clinical Hospital Zagreb, Zagreb, Croatia
4 St Catharine Hospital, Zagreb, Croatia
5 Eberly College of Science, Penn State University, USA
6 University of Split School of Medicine, Split, Croatia
7 University of Osijek School of Medicine, Osijek, Croatia
8 University of Osijek Faculty of Dental Medicine and Health, Croatia
9 Medical School REGIOMED, Coburg, Germany
Conclusion: So, let this simple concept to sink into your head: GOD will permanently guide you, giving you wisdom, if you ask, on how to get rid of this Pandemia, at least for you and for your own (but this common-sense advice of keeping moist with your own saliva INSIDE your nostrils; so, for now, you need to endure its smell, sorry!, sorry also that at this time is better to let your inner nose hair to grow, God knows why he put those barriers there!!! That also may keep you humble!!! So simple!!! Hehee). But you need to be strong NOT to trust the mass media and the big pharma that are coming as the only truths!!! they will ignore or deny, as they keep on doing it usually, so as for them to wipe-out the most simple methods that are the most effective in reality!!! They have their own hidden and sinister agenda. But YOU have your transparent and open agenda: To keep yourself safe, and your own!!! God is with you! But, are you with Him?" (Surpassing the 5555 readers and counting: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031)
Article Why Is HIV Rarely Transmitted by Oral Secretions?: Saliva Ca...
Arch Intern Med
. 1999 Feb 8;159(3):303-10. doi: 10.1001/archinte.159.3.303.
Why Is HIV Rarely Transmitted by Oral Secretions? Saliva Can Disrupt Orally Shed, Infected Leukocytes
S Baron, J Poast, M W Cloyd
Affiliation:
Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston 77555-1019, USA.
PMID: 9989543
DOI: 10.1001/archinte.159.3.303
This, we know that Big Pharma is going to ignore and deny because it is NOT convenient for them such a free and easy preventative!!!
And now, we received a very related observation sent by our dear Jean.Claude Perez indicating that a moist and humidified environment, such that of the beach, and moisturizers of the rooms, of the environment, get away with the possibility of any kind of airborne viruses to be around without being caught by vapor droplets and precipitated!!! Dryness is the vector of the virus, humidity is its demise!!!:
https://web.archive.org/web/20200503040507/https://draganprimorac.org/fighting-covid-19-with-water/
Fighting COVID-19 with water
Gordan Lauc 1, Alemka Markotic 2, Ivan Gornik 3, Dragan Primorac 4-9
1 University of Zagreb Faculty of Pharmacy and Biochemistry & Genos Glycoscience Research Laboratory, Zagreb, Croatia
2 Clinics for Infective Diseases, Dr. Fran Mihaljević, Zagreb, Croatia
3 Department of Emergency Medicine, Clinical Hospital Zagreb, Zagreb, Croatia
4 St Catharine Hospital, Zagreb, Croatia
5 Eberly College of Science, Penn State University, USA
6 University of Split School of Medicine, Split, Croatia
7 University of Osijek School of Medicine, Osijek, Croatia
8 University of Osijek Faculty of Dental Medicine and Health, Croatia
9 Medical School REGIOMED, Coburg, Germany
Conclusion: So, let this simple concept to sink into your head: GOD will permanently guide you, giving you wisdom, if you ask, on how to get rid of this Pandemia, at least for you and for your own (but this common-sense advice of keeping moist with your own saliva INSIDE your nostrils; so, for now, you need to endure its smell, sorry!, sorry also that at this time is better to let your inner nose hair to grow, God knows why he put those barriers there!!! That also may keep you humble!!! So simple!!! Hehee). But you need to be strong NOT to trust the mass media and the big pharma that are coming as the only truths!!! they will ignore or deny, as they keep on doing it usually, so as for them to wipe-out the most simple methods that are the most effective in reality!!! They have their own hidden and sinister agenda. But YOU have your transparent and open agenda: To keep yourself safe, and your own!!! God is with you! But, are you with Him?" (Surpassing the 5555 readers and counting: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031)
Fernando Castro-Chavez wrote on Maria Khloe Nicole Delfin's timeline.
Here, in the other side of the world, the Seventh day of May is starting, and 7 means "Perfection" in the Bible, while 5 means "Grace": That the Perfection of the Grace of GOD in your life be manifested now and ever!
Another piece of scum involved in the design of this artificial pandemic and of the virus COVID-19 (scorpions infiltrated to harm the whole of humanity): https://www.youtube.com/watch?v=fe-cbMLJZzU; the other, we already tracked down: https://www.youtube.com/watch?v=1LekHJc9Hsc, and how Gates also deposited in his pocket the WHO, which now infiltrates your cellphones and all your apps trying to "brainwash" you with a totally false and "controlled" by them, narrative (by their own stinky mouths they will be indicted: https://www.gatesfoundation.org/Media-Center/Press-Releases/2010/01/Bill-and-Melinda-Gates-Pledge-$10-Billion-in-Call-for-Decade-of-Vaccines). They all must fall down to the ground for now! At least while we are still in here!!!
Updated May 6, 2020, 8:13 AM
Fernando Castro-Chavez shared a memory.
2 Years Ago
May 6, 2019, 7:58 PM
Aquí les dejo un avance de mi próximo estudio a presentar de Hechos; aquí me sorprende el darme cuenta hasta ahora que la Biblia menciona a cuatro Herodes directamente implicados o con Cristo o con sus discípulos: 1) "El Grande", 2) El Antipas I, 3) El Agripa I y 4) El Agripa II, además de que en total se menciona: ¡A 11 miembros de esta familia infame!, de los cuales 4 son mujeres: Berenice, Drusila, Herodías y Salomé (de la que no se da el nombre), tres de ellas se casaron con sus tíos, excepto Drusila que se casó con el corrupto de Félix (es decir que la maravillosa Escritura está siempre llena de grandes sorpresas, unas buenas y otras malas, como el linaje de esta gente que provenía del pelirrojo Edom, quien fue Esaú):
Otro de los monstruos entregados al maligno del pasado, y cómo su plan se derrumbó por completo, como ahora, aún cuando éste Herodes era un "Anticristo" desde que Jesucristo era pequeño, ahora Cristo Jesús vive para con mayor razón echarnos la mano con su ayuda desde el cielo, pues él sabe lo que está pasando por acá:
Updated May 6, 2020, 7:51 AM
The Freedom of Heart of the Children of God is NOT Going to be Taken Away by Nobody, NOT by any Person, not by any Organization, not by any Pharmaceutical Product, NOT Even by Any Insignificant and Feeble Artificial Virus Designed in a Lab, NOR by Any Engineered "Pandemia" Originated in a Brain Composite of "The Mystery of Iniquity", in Christ Jesus we are MORE THAN CONQUERORS of it All and More!!!
Updated May 5, 2020, 9:02 PM
And, just as Dr., Nobel Prize Luc Montagnier and Dr. IBM Emeritus Jean-Claude Perez observed, due to the artificial nature of this virus for COVID-19, a lot of details of its behavior are going to be found out as time goes by, and one of its details, that Dr. Perez told me yesterday, is precisely the feeble nature of this virus that in the hot areas such as Arizona is starting to "fall apart", the most recent strain from there appeared already with 27 amino acids missing, which is equivalent to 81 nucleotides missing!!! This was my report, a "little bit" more relaxed than the others: "I have tried, but this space seems to be bringing me over and over to the legends and signatures by the manufacturers of the artificial COVID-19 virus:
Here, I give you, Mrs Lflalit Latcely ...!
(A very druidic, dark and obscure-rituals kind of deleted name!, as if the manufacturers of COVID-19 were giving us a signal of their bragging about their achievement, a common thing when pompous criminals are at the door, but lets read the facts and leave the legends for a moment... until retaking them at the end...)
The recommended reading by Jean-Claude Perez is the most recent variant of COVID-19, found in Temple, AZ, a Sars-CoV-2 missing 27 amino acids!!!:
LFLALITLATCELYHYQECVRGTTVLL
Corresponding to the next 81 nucleotides:
CTTTTCTTGGCACTGATAACACTCGCTACTTGTGAGCTTTATCACTACCAAGAGTGTGTTAGAGGTACAACAGTACTTTTA
Which matches the signal peptide of the protein Orf7a and its first two beta chains.
https://jvi.asm.org/content/early/2020/04/30/JVI.00711-20
When I did my comparison, only another case with the same number of missing amino acids was found:
https://jvi.asm.org/content/84/22/11831
For the H2N2 avian influenza, and the reason for the loss was given as: "...arising after only 4 passages of qa-mall/178 in chickens, supports respiratory replication and a shift in viral tropism from intestinal to respiratory replication in the chicken host."
So, the link to the note below says that it was from a "nasal swab sample"; however, the other example of such a loss indicates a change of organ attacked by the virus.
The note also says that "The protein is very similar to the 2003 SARS-CoV immune antagonist ORF7a/X4".
So, if that is true, that just will show that the Franken-virus was engineered or optimized by its makers, in such a way as to cause as much damage as possible.
Then, one final note says: "Lim points out that only 16,000 SARS-CoV-2 genomes have been sequenced to date (available at GISAID), which is less than 0.5% of the strains circulating. There are currently more than 3.5 million confirmed COVID-19 cases worldwide."
However, I may ask if that amount has really been "confirmed" or just "assumed" to be true at the current moment. Because we all know at this point that the data presented by Johns Hopkins is deliberately inflated to make it look worst and worst every single day.
Orf7a is called the "Virus Liberator" because it cuts down an infected cell’s supply of tetherin (because when new viruses try to escape a cell, the cell can snare them with this tetherin), allowing more of the viruses to escape. Researchers have also found that the protein can trigger infected cells to commit suicide (apoptosis) — which contributes to the damage Covid-19 causes to the lungs ("killing" the cells)."
Another possibility is that, being this virus an artificial one, as Montagnier and Perez concluded, it will be providing surprises as per its instability... (such as if it were falling into pieces.... until its sudden disappearance in the same way as it arrived, or so it goes the Koonz legend...).
So, I give thanks to Jean-Claude Perez for showing me such a monsterous deletion as advertised to the media: https://medicalxpress.com/news/2020-05-scientific-team-unique-mutation-coronavirus.html
That deletion also make us think of somebody with a "flit" container, still spreading diverse varieties (diverse by necessity due to their multiple passages in vitro or in beast) of the COVID-19 within the different cities of the US to inflate the drama. So, citizens of the US, be observant, and if you see something suspicious to that effect, denounce it or organize yourself and your neighbors to stop them from doing that!!! (If that were the case, which really is not impossible if the purpose is to artificially cause the greatest damage as possible, because those that released it will not stop at anything, according to the, in order to reach their objectives!!! So, be vigilant!... hence the importance to pinpoint this as a deliberate and artificious act of that segment of humans that think of the rest of us as "cattle").
Here, I expose one of them, for you to see the covert way of speaking "great things" (as the Bible says of that little and blasphemous horn) of these people: https://www.youtube.com/watch?v=1LekHJc9Hsc
In the images, the location of the deletion and the relative position of the peculiarly diminished sequence within the current colored "circus" of the COVID-19 virus varietes, certainly being this one the most odd to date"
Here, I give you, Mrs Lflalit Latcely ...!
(A very druidic, dark and obscure-rituals kind of deleted name!, as if the manufacturers of COVID-19 were giving us a signal of their bragging about their achievement, a common thing when pompous criminals are at the door, but lets read the facts and leave the legends for a moment... until retaking them at the end...)
The recommended reading by Jean-Claude Perez is the most recent variant of COVID-19, found in Temple, AZ, a Sars-CoV-2 missing 27 amino acids!!!:
LFLALITLATCELYHYQECVRGTTVLL
Corresponding to the next 81 nucleotides:
CTTTTCTTGGCACTGATAACACTCGCTACTTGTGAGCTTTATCACTACCAAGAGTGTGTTAGAGGTACAACAGTACTTTTA
Which matches the signal peptide of the protein Orf7a and its first two beta chains.
https://jvi.asm.org/content/early/2020/04/30/JVI.00711-20
When I did my comparison, only another case with the same number of missing amino acids was found:
https://jvi.asm.org/content/84/22/11831
For the H2N2 avian influenza, and the reason for the loss was given as: "...arising after only 4 passages of qa-mall/178 in chickens, supports respiratory replication and a shift in viral tropism from intestinal to respiratory replication in the chicken host."
So, the link to the note below says that it was from a "nasal swab sample"; however, the other example of such a loss indicates a change of organ attacked by the virus.
The note also says that "The protein is very similar to the 2003 SARS-CoV immune antagonist ORF7a/X4".
So, if that is true, that just will show that the Franken-virus was engineered or optimized by its makers, in such a way as to cause as much damage as possible.
Then, one final note says: "Lim points out that only 16,000 SARS-CoV-2 genomes have been sequenced to date (available at GISAID), which is less than 0.5% of the strains circulating. There are currently more than 3.5 million confirmed COVID-19 cases worldwide."
However, I may ask if that amount has really been "confirmed" or just "assumed" to be true at the current moment. Because we all know at this point that the data presented by Johns Hopkins is deliberately inflated to make it look worst and worst every single day.
Orf7a is called the "Virus Liberator" because it cuts down an infected cell’s supply of tetherin (because when new viruses try to escape a cell, the cell can snare them with this tetherin), allowing more of the viruses to escape. Researchers have also found that the protein can trigger infected cells to commit suicide (apoptosis) — which contributes to the damage Covid-19 causes to the lungs ("killing" the cells)."
Another possibility is that, being this virus an artificial one, as Montagnier and Perez concluded, it will be providing surprises as per its instability... (such as if it were falling into pieces.... until its sudden disappearance in the same way as it arrived, or so it goes the Koonz legend...).
So, I give thanks to Jean-Claude Perez for showing me such a monsterous deletion as advertised to the media: https://medicalxpress.com/news/2020-05-scientific-team-unique-mutation-coronavirus.html
That deletion also make us think of somebody with a "flit" container, still spreading diverse varieties (diverse by necessity due to their multiple passages in vitro or in beast) of the COVID-19 within the different cities of the US to inflate the drama. So, citizens of the US, be observant, and if you see something suspicious to that effect, denounce it or organize yourself and your neighbors to stop them from doing that!!! (If that were the case, which really is not impossible if the purpose is to artificially cause the greatest damage as possible, because those that released it will not stop at anything, according to the, in order to reach their objectives!!! So, be vigilant!... hence the importance to pinpoint this as a deliberate and artificious act of that segment of humans that think of the rest of us as "cattle").
Here, I expose one of them, for you to see the covert way of speaking "great things" (as the Bible says of that little and blasphemous horn) of these people: https://www.youtube.com/watch?v=1LekHJc9Hsc
In the images, the location of the deletion and the relative position of the peculiarly diminished sequence within the current colored "circus" of the COVID-19 virus varietes, certainly being this one the most odd to date"
Updated May 5, 2020, 8:14 PM
Part of my research from yesterday (there is a TIME for everything said the CONGREGATOR, and this is my time for this...): "But, back to the articles showing the similarities between the HIV-1 and the Sars-CoV-1 and Sars-CoV-1, I found this comparison compelling as to destroy them all through a common strategy:
Old Sars1: YEQYIKWPWYVWLGF
COVID-19: YEQYIKWPWYIWLGF
HIV1 AIDS: WASLWNWFNITNWLWY
"Sequence comparison of the aromatic residue-rich regions of HIV-1 gp41 and SARS-CoV (Old Sars) and the virus of COVID-19, S2 proteins. The aromatic residues are in blue. Remarkably, the relatively rare aromatic residues comprise about half of the residues in these region"!!!
References:
Kliger, Y. & Levanon, E. Y. Cloaked similarity between HIV-1 and SARS-CoV suggests an anti-SARS strategy. BMC Microbiol. 2003, 3:20: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC222911
Zhang, X. W. & Yap, Y. L. Structural similarity between HIV-1 gp41 and SARS-CoV S2 proteins suggests an analogous membrane fusion mechanism. Theochem. 2004, 677(1):73–76: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7141560
From the three images, we read:
Upper Left: Wheel projection of the N-HR (a) and C-HR (b) of SARS-CoV S2 protein (gi|30023954). The amino acid sequence is displayed end-to-end down the axis of a schematic helix. The angle between every two consecutive amino acids is 102.9°. The helical wheel consists of seven corners, corresponding to the fit of seven amino acid residues into every two helical turns.
Upper Right: Wheel projection of the N-HR (a) and C-HR (b) of HIV-1 gp41 (gi|9629363). The amino acid sequence is displayed end-to-end down the axis of a schematic helix. The angle between every two consecutive amino acids is 102.9°. The helical wheel consists of seven corners, corresponding to the fit of seven amino acid residues into every two helical turns.
Then: Similarity between the fusion proteins of HIV-1 and SARS-CoV. The HIV-1 gp41 (a) and the equivalent S2 protein from the SARS-CoV (b) are shown. A Leucine/Isoleucine heptad repeat adjacent to the N-terminus of both proteins appears in red. The C-terminal heptad repeat is in green. Cysteine residues (purple) confining a loop structure are located between the two heptad repeats. An aromatic residues-rich motif is marked blue, and the transmembrane segment is in orange. A peptide corresponding to the C-terminal heptad repeat, which acts as potent inhibitor of HIV-1 entry into the cell, appears in yellow.
Then, searching further, I found a great book: https://web.archive.org/web/20200430042150/http://virological.org/uploads/short-url/6rBA2kTkfxLXjda60Yw2rfJASAS.pdf, whose substance for this topic is in pages 53-56, as per the image of the amino acids, that says:
"Tryptophan is normally a very rare amino acid. Many large proteins contain none at all. So this peptide region is highly unusual. We found that it combined basic amino acids with aromatic amino acids in such a way as to create a potent toxin that in the virus serves as a membrane-permeabilization region known as a viroporin.
Examination of the HIV-1 aromatic region, and the helical region of influenza PBf2 known to be toxic, again show that they also combine basic amino acids with aromatic amino acids, as also does the entry peptide for papillomaviruses.
The peptide region around the aromatic region of SARS and nCoV2019 follow this same pattern of combining basic amino acids, K or R with aromatic amino acids, especially tryptophan (W).
We suggest here that a pattern is emerging among very disparate viral agents of using this known membrane-destabilizing motif – K or R with multiple aromatic residues, especially W, to disrupt cell membranes yielding cell fusion, cell permeabilization or cell destruction.
While not directly alignable, the common character of these peptides in visually striking. We suggest that they constitute a superfamily of membrane destabilizing peptides across many families of both naked and enveloped viruses, wherever membrane perturbation is an essential mechanism to viral replication or pathogenesis."
The figure says: "Family of Basic/Aromatic Membrane Destabilizing Peptides. Six peptides known to destabilize membranes or are involved in membrane fusion are shown that share the property of combining basic amino acids K and/or R with aromatic amino acids W, F or Y. Shown are peptides from Wuhan S2, Ebola Delta, Enterovirus D68 ORF3, HIV-1 gp41, Flu H3N2 PB1f2, and Human Papillomavirus type 6 L2, as described in the text. Projections are from the PepDraw utility of the Wimley lab, Tulane School of Medicine."
WOW!!!"
Old Sars1: YEQYIKWPWYVWLGF
COVID-19: YEQYIKWPWYIWLGF
HIV1 AIDS: WASLWNWFNITNWLWY
"Sequence comparison of the aromatic residue-rich regions of HIV-1 gp41 and SARS-CoV (Old Sars) and the virus of COVID-19, S2 proteins. The aromatic residues are in blue. Remarkably, the relatively rare aromatic residues comprise about half of the residues in these region"!!!
References:
Kliger, Y. & Levanon, E. Y. Cloaked similarity between HIV-1 and SARS-CoV suggests an anti-SARS strategy. BMC Microbiol. 2003, 3:20: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC222911
Zhang, X. W. & Yap, Y. L. Structural similarity between HIV-1 gp41 and SARS-CoV S2 proteins suggests an analogous membrane fusion mechanism. Theochem. 2004, 677(1):73–76: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7141560
From the three images, we read:
Upper Left: Wheel projection of the N-HR (a) and C-HR (b) of SARS-CoV S2 protein (gi|30023954). The amino acid sequence is displayed end-to-end down the axis of a schematic helix. The angle between every two consecutive amino acids is 102.9°. The helical wheel consists of seven corners, corresponding to the fit of seven amino acid residues into every two helical turns.
Upper Right: Wheel projection of the N-HR (a) and C-HR (b) of HIV-1 gp41 (gi|9629363). The amino acid sequence is displayed end-to-end down the axis of a schematic helix. The angle between every two consecutive amino acids is 102.9°. The helical wheel consists of seven corners, corresponding to the fit of seven amino acid residues into every two helical turns.
Then: Similarity between the fusion proteins of HIV-1 and SARS-CoV. The HIV-1 gp41 (a) and the equivalent S2 protein from the SARS-CoV (b) are shown. A Leucine/Isoleucine heptad repeat adjacent to the N-terminus of both proteins appears in red. The C-terminal heptad repeat is in green. Cysteine residues (purple) confining a loop structure are located between the two heptad repeats. An aromatic residues-rich motif is marked blue, and the transmembrane segment is in orange. A peptide corresponding to the C-terminal heptad repeat, which acts as potent inhibitor of HIV-1 entry into the cell, appears in yellow.
Then, searching further, I found a great book: https://web.archive.org/web/20200430042150/http://virological.org/uploads/short-url/6rBA2kTkfxLXjda60Yw2rfJASAS.pdf, whose substance for this topic is in pages 53-56, as per the image of the amino acids, that says:
"Tryptophan is normally a very rare amino acid. Many large proteins contain none at all. So this peptide region is highly unusual. We found that it combined basic amino acids with aromatic amino acids in such a way as to create a potent toxin that in the virus serves as a membrane-permeabilization region known as a viroporin.
Examination of the HIV-1 aromatic region, and the helical region of influenza PBf2 known to be toxic, again show that they also combine basic amino acids with aromatic amino acids, as also does the entry peptide for papillomaviruses.
The peptide region around the aromatic region of SARS and nCoV2019 follow this same pattern of combining basic amino acids, K or R with aromatic amino acids, especially tryptophan (W).
We suggest here that a pattern is emerging among very disparate viral agents of using this known membrane-destabilizing motif – K or R with multiple aromatic residues, especially W, to disrupt cell membranes yielding cell fusion, cell permeabilization or cell destruction.
While not directly alignable, the common character of these peptides in visually striking. We suggest that they constitute a superfamily of membrane destabilizing peptides across many families of both naked and enveloped viruses, wherever membrane perturbation is an essential mechanism to viral replication or pathogenesis."
The figure says: "Family of Basic/Aromatic Membrane Destabilizing Peptides. Six peptides known to destabilize membranes or are involved in membrane fusion are shown that share the property of combining basic amino acids K and/or R with aromatic amino acids W, F or Y. Shown are peptides from Wuhan S2, Ebola Delta, Enterovirus D68 ORF3, HIV-1 gp41, Flu H3N2 PB1f2, and Human Papillomavirus type 6 L2, as described in the text. Projections are from the PepDraw utility of the Wimley lab, Tulane School of Medicine."
WOW!!!"
Updated May 5, 2020, 7:58 AM
Updated May 5, 2020, 7:58 AM
Updated May 5, 2020, 7:57 AM
Updated May 5, 2020, 7:57 AM
Abigail,
I have reviewed it and as a volunteer peer-reviewer, I said it must stay.
Furthermore, I am using it as my reference for my own work and it needs to stay visible as for the reader to be able to track its conclusions, otherwise: How it will be reached if it is censored by you? But, who are you to censor anything at all?
I recommend this article to stay, and to be taken seriously.
It is not irresponsible at all, in what way could it be?, other than to taint the unfounded narrative of a "natural" origin?
This is the opportune time to make this information to be known, as Yuri Deigin is teaching as well: https://medium.com/@yurideigin/lab-made-cov2-genealogy-through-the-lens-of-gain-of-function-research-f96dd7413748, as the article asks, I ask you:
What is your reason to censor the evident information that COVID-19 is an artificial strain?, because, it has:
1) A backbone of a virus from a bat,
2) An optimized RBM that looks like from a virus of a pangolin,
3) A portion of Orf1b that is closer to a different virus from a different pangolin,
4) An optimized 12-bases protease cleavage of unknown procedance, that looks more to a portion of a virus from a pig, but also to an artificial sequence to make proteins patented by "Moderna Inc", funded by Bill Gates,
5) An HIV-like optimized region at the left side of the RBM (and we all need to know that even Sars has a cloaked identity to HIV), known by Zhengli since 2008 as the determining and necessary portion for the infectivity.
6) Furthermore, Zhengli did in 2018 a study on people from Wuhan and did not found any zoonotic event at that time.
7) For a virus such as Sars-CoV-2 to have appeared out of a sudden already mature and with no history of previous traces of it in humans indicates that it was released from a Laboratory after being optimized for those three sites that I mention above in points 2, 4 and 5. And that is just the beginning of the comparisons, as many other of its proteins also seem to be optimized in a laboratory.
With all due respect and education for the freedom of the research and the tearing down of censorship,
Fernando Castro-Chavez, PhD.
P.S.
Who is advising you to censor the evidence for the obvious lab origins of COVID-19? (This regarding my review of: https://www.researchgate.net/publication/340924249_Is_considering_a_genetic-manipulation_origin_for_SARS-CoV-2_a_conspiracy_theory_that_must_be_censored)
I have reviewed it and as a volunteer peer-reviewer, I said it must stay.
Furthermore, I am using it as my reference for my own work and it needs to stay visible as for the reader to be able to track its conclusions, otherwise: How it will be reached if it is censored by you? But, who are you to censor anything at all?
I recommend this article to stay, and to be taken seriously.
It is not irresponsible at all, in what way could it be?, other than to taint the unfounded narrative of a "natural" origin?
This is the opportune time to make this information to be known, as Yuri Deigin is teaching as well: https://medium.com/@yurideigin/lab-made-cov2-genealogy-through-the-lens-of-gain-of-function-research-f96dd7413748, as the article asks, I ask you:
What is your reason to censor the evident information that COVID-19 is an artificial strain?, because, it has:
1) A backbone of a virus from a bat,
2) An optimized RBM that looks like from a virus of a pangolin,
3) A portion of Orf1b that is closer to a different virus from a different pangolin,
4) An optimized 12-bases protease cleavage of unknown procedance, that looks more to a portion of a virus from a pig, but also to an artificial sequence to make proteins patented by "Moderna Inc", funded by Bill Gates,
5) An HIV-like optimized region at the left side of the RBM (and we all need to know that even Sars has a cloaked identity to HIV), known by Zhengli since 2008 as the determining and necessary portion for the infectivity.
6) Furthermore, Zhengli did in 2018 a study on people from Wuhan and did not found any zoonotic event at that time.
7) For a virus such as Sars-CoV-2 to have appeared out of a sudden already mature and with no history of previous traces of it in humans indicates that it was released from a Laboratory after being optimized for those three sites that I mention above in points 2, 4 and 5. And that is just the beginning of the comparisons, as many other of its proteins also seem to be optimized in a laboratory.
With all due respect and education for the freedom of the research and the tearing down of censorship,
Fernando Castro-Chavez, PhD.
P.S.
Who is advising you to censor the evidence for the obvious lab origins of COVID-19? (This regarding my review of: https://www.researchgate.net/publication/340924249_Is_considering_a_genetic-manipulation_origin_for_SARS-CoV-2_a_conspiracy_theory_that_must_be_censored)
Preserving History (if it can stay without ado's... by their mouth and deed will they be made accountable):
Updated May 4, 2020, 10:14 AM
Una vez más por gracia divina, nuestro trabajo no ha sido en vano, pero proseguimos: https://www.excelsior.com.mx/global/alega-eu-tener-pruebas-de-que-covid-19-salio-de-laboratorio-chino/1379690
Updated May 3, 2020, 7:00 PM
My contribution of today for the good of humanity: DRINK WATER IN SILVER & EAT SHIITAKE, CHAGA AND MAITAKE!!!
The BEST and CHEAPEST, almost FREE strategies to defeat COVID-19 are at your hand!!! (Do NOT believe in the lies of the vaccination and of the Very Co$tly For your health and sinister "Big Pharma"):
Which water to drink is better while the COVID-19 is being released to the environment by Bill Gates???
CLEAN WATER IN CONTACT WITH SILVER!!! (Either the container, the spoon, the clean coin inside the glass or bow is made of SILVER).
https://www.momspresso.com/parenting/touches-of-motherhood/article/drinking-water-from-silver-vessel
Thanks to John Apsley for reminding us of a childhood remedy that our grandmothers used to use!!!
1.Speshock JL, Murdock RC, Braydich-Stolle LK, Schrand AM, Hussain SM. Interaction of silver nanoparticles with tacaribe virus. J Nanobiotechnol. 2010;8:19: https://pubmed.ncbi.nlm.nih.gov/20718972
2.Bekele AZ, Gokulan K, Williams KM, Khare S. Dose and Size-Dependent Antiviral Effects of Silver Nanoparticles on Feline Calicivirus, a Human Norovirus Surrogate. Foodborne Pathog Dis. 2016 May; 13(5):239-44: https://pubmed.ncbi.nlm.nih.gov/26938256/
3.Cascella M, Rajnik M, Cuomo A, et al. Features, Evaluation and Treatment Coronavirus (COVID-19) [Updated 2020 Mar 20]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2020 Jan.: https://www.statpearls.com/kb/viewarticle/52171
Available from: https://www.ncbi.nlm.nih.gov/books/NBK554776/
4.COVID-19 Symposium: Coronavirus History, Replication, and Immune Evasion. Dr. Susan Weiss. Co-Director, Center for Research on Coronavirus and Other Emerging Pathogens, Penn Medicine, April 3, 2020: https://pubmed.ncbi.nlm.nih.gov/?term=weiss+sr+and+coronavirus
5.Andrade F, et al. Nanotechnology and Pulmonary Delivery to Overcome Resistance in Infectious Diseases. Adv Drug Deliv Rev. 2013 Nov;65(13-14):1816-27. doi:10.1016/j.addr.2013.07.020:
https://pubmed.ncbi.nlm.nih.gov/23932923/
6.Banerjee V, Das KP. Interaction of silver nanoparticles with proteins: a characteristic protein concentration dependent profile of SPR signal. Colloids Surf B Biointerfaces. 2013;111:71–79. https://doi.org/10.1016/j.colsurfb.2013.04.052:
https://pubmed.ncbi.nlm.nih.gov/23792543/
7. One more trial: https://pubmed.ncbi.nlm.nih.gov/32149020
Which supplements to eat, especially while the fearmonger "Gates Foundation" keeps on saying that the worst is still yet to arrive???
EAT ANTIVIRAL STRENGTHENERS OF IMMUNITY MUSHROOMS!!! SHIITAKE, CHAGA, MAITAKE!!!
SHIITAKE:
Antiviral Activity of Virus-Like Particles From Lentinus Edodes (Shiitake).
https://pubmed.ncbi.nlm.nih.gov/222241/
Consuming Lentinula Edodes (Shiitake) Mushrooms Daily Improves Human Immunity: A Randomized Dietary Intervention in Healthy Young Adults: https://pubmed.ncbi.nlm.nih.gov/25866155/
CHAGA:
Antiviral Activity of Inonotus Obliquus Fungus Extract Towards Infection Caused by Hepatitis C Virus in Cell Cultures
https://pubmed.ncbi.nlm.nih.gov/22462058/
A Study of the Antiherpetic Activity of the Chaga Mushroom (Inonotus Obliquus) Extracts in the Vero Cells Infected With the Herpes Simplex Virus: https://pubmed.ncbi.nlm.nih.gov/25069286/
MAITAKE:
Immune-enhancing effects of Maitake (Grifola frondosa) and Shiitake (Lentinula edodes) extracts: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4202470/
The Pharmacological Potential of Mushrooms: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1193547/
Also: https://www.realmushrooms.com/7-medicinal-mushroom-benefits-for-health/, etc.
Thanks to Dr. Hiromi Shinya for giving the advice on mushrooms in the last two pages of his classic book (this version in Spanish: "La Enzima Prodigiosa"): https://docs.google.com/viewer?a=v&pid=sites&srcid=ZGVmYXVsdGRvbWFpbnx2aWdpbGFudGVzMjAxMGh1ZWx2YXxneDoyNGQwMTZmMjM3MzBlMjAy
It says:
"HONGOS SHITAKE contienen
aminoácidos específicos que
ayudan a acelerar el procesamiento
del colesterol en el hígado. El
shitake también es un arma
formidable contra el cáncer. Un
compuesto polisacárido del shitake
parece estimular las células del
sistema inmunológico para limpiar
el cuerpo de células cancerígenas y
puede ser efectivo contra el virus
de la inmunodeficiencia humana
(VIH) y la hepatitis B. Los hongos
shitake han demostrado detener el
daño celular del herpes simple I y
II."
"CHAGA es un hongo que es un
antioxidante natural y una de las
plantas medicinales más antiguas.
Se cree que la chaga combate los
virus, estimula el sistema nervioso
central, suprime el crecimiento de
los tumores y las células
cancerígenas, baja el conteo de
glóbulos blancos, baja la presión
arterial y venosa, disminuye los
niveles de azúcar, mejora el color y
la elasticidad de la piel, restaura la
apariencia juvenil y desintoxica el
hígado, los riñones y el bazo."
"MAITAKE es el nombre japonés de
los hongos comestibles. El maitake
se conoce tradicionalmente por sus
propiedades alimenticias y
medicinales. Los extractos de los
h o n g o s maitake favorecen el
sistema inmunológico y se cree que
tienen efectos antitumores."
DOING EVERYTHING AND ANYTHING TO PREVENT AND BE HEALED BY NATURAL MEANS, IN ORDER NOT TO BE VACCINATED BY THE EVIL SINISTER PLANS OF THE GATES FOUNDATION AND THE WHO (ITS SERVANT) AND NOT OT INGEST ANY OF THE PRODUCTS BEING PUSHED BY THE MEDIA AND THE BIG PHARMA!!! As posted there: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031
Extra Note: And maybe vaporizations of all of this silver water so as to reach the lungs...
The BEST and CHEAPEST, almost FREE strategies to defeat COVID-19 are at your hand!!! (Do NOT believe in the lies of the vaccination and of the Very Co$tly For your health and sinister "Big Pharma"):
Which water to drink is better while the COVID-19 is being released to the environment by Bill Gates???
CLEAN WATER IN CONTACT WITH SILVER!!! (Either the container, the spoon, the clean coin inside the glass or bow is made of SILVER).
https://www.momspresso.com/parenting/touches-of-motherhood/article/drinking-water-from-silver-vessel
Thanks to John Apsley for reminding us of a childhood remedy that our grandmothers used to use!!!
1.Speshock JL, Murdock RC, Braydich-Stolle LK, Schrand AM, Hussain SM. Interaction of silver nanoparticles with tacaribe virus. J Nanobiotechnol. 2010;8:19: https://pubmed.ncbi.nlm.nih.gov/20718972
2.Bekele AZ, Gokulan K, Williams KM, Khare S. Dose and Size-Dependent Antiviral Effects of Silver Nanoparticles on Feline Calicivirus, a Human Norovirus Surrogate. Foodborne Pathog Dis. 2016 May; 13(5):239-44: https://pubmed.ncbi.nlm.nih.gov/26938256/
3.Cascella M, Rajnik M, Cuomo A, et al. Features, Evaluation and Treatment Coronavirus (COVID-19) [Updated 2020 Mar 20]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2020 Jan.: https://www.statpearls.com/kb/viewarticle/52171
Available from: https://www.ncbi.nlm.nih.gov/books/NBK554776/
4.COVID-19 Symposium: Coronavirus History, Replication, and Immune Evasion. Dr. Susan Weiss. Co-Director, Center for Research on Coronavirus and Other Emerging Pathogens, Penn Medicine, April 3, 2020: https://pubmed.ncbi.nlm.nih.gov/?term=weiss+sr+and+coronavirus
5.Andrade F, et al. Nanotechnology and Pulmonary Delivery to Overcome Resistance in Infectious Diseases. Adv Drug Deliv Rev. 2013 Nov;65(13-14):1816-27. doi:10.1016/j.addr.2013.07.020:
https://pubmed.ncbi.nlm.nih.gov/23932923/
6.Banerjee V, Das KP. Interaction of silver nanoparticles with proteins: a characteristic protein concentration dependent profile of SPR signal. Colloids Surf B Biointerfaces. 2013;111:71–79. https://doi.org/10.1016/j.colsurfb.2013.04.052:
https://pubmed.ncbi.nlm.nih.gov/23792543/
7. One more trial: https://pubmed.ncbi.nlm.nih.gov/32149020
Which supplements to eat, especially while the fearmonger "Gates Foundation" keeps on saying that the worst is still yet to arrive???
EAT ANTIVIRAL STRENGTHENERS OF IMMUNITY MUSHROOMS!!! SHIITAKE, CHAGA, MAITAKE!!!
SHIITAKE:
Antiviral Activity of Virus-Like Particles From Lentinus Edodes (Shiitake).
https://pubmed.ncbi.nlm.nih.gov/222241/
Consuming Lentinula Edodes (Shiitake) Mushrooms Daily Improves Human Immunity: A Randomized Dietary Intervention in Healthy Young Adults: https://pubmed.ncbi.nlm.nih.gov/25866155/
CHAGA:
Antiviral Activity of Inonotus Obliquus Fungus Extract Towards Infection Caused by Hepatitis C Virus in Cell Cultures
https://pubmed.ncbi.nlm.nih.gov/22462058/
A Study of the Antiherpetic Activity of the Chaga Mushroom (Inonotus Obliquus) Extracts in the Vero Cells Infected With the Herpes Simplex Virus: https://pubmed.ncbi.nlm.nih.gov/25069286/
MAITAKE:
Immune-enhancing effects of Maitake (Grifola frondosa) and Shiitake (Lentinula edodes) extracts: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4202470/
The Pharmacological Potential of Mushrooms: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1193547/
Also: https://www.realmushrooms.com/7-medicinal-mushroom-benefits-for-health/, etc.
Thanks to Dr. Hiromi Shinya for giving the advice on mushrooms in the last two pages of his classic book (this version in Spanish: "La Enzima Prodigiosa"): https://docs.google.com/viewer?a=v&pid=sites&srcid=ZGVmYXVsdGRvbWFpbnx2aWdpbGFudGVzMjAxMGh1ZWx2YXxneDoyNGQwMTZmMjM3MzBlMjAy
It says:
"HONGOS SHITAKE contienen
aminoácidos específicos que
ayudan a acelerar el procesamiento
del colesterol en el hígado. El
shitake también es un arma
formidable contra el cáncer. Un
compuesto polisacárido del shitake
parece estimular las células del
sistema inmunológico para limpiar
el cuerpo de células cancerígenas y
puede ser efectivo contra el virus
de la inmunodeficiencia humana
(VIH) y la hepatitis B. Los hongos
shitake han demostrado detener el
daño celular del herpes simple I y
II."
"CHAGA es un hongo que es un
antioxidante natural y una de las
plantas medicinales más antiguas.
Se cree que la chaga combate los
virus, estimula el sistema nervioso
central, suprime el crecimiento de
los tumores y las células
cancerígenas, baja el conteo de
glóbulos blancos, baja la presión
arterial y venosa, disminuye los
niveles de azúcar, mejora el color y
la elasticidad de la piel, restaura la
apariencia juvenil y desintoxica el
hígado, los riñones y el bazo."
"MAITAKE es el nombre japonés de
los hongos comestibles. El maitake
se conoce tradicionalmente por sus
propiedades alimenticias y
medicinales. Los extractos de los
h o n g o s maitake favorecen el
sistema inmunológico y se cree que
tienen efectos antitumores."
DOING EVERYTHING AND ANYTHING TO PREVENT AND BE HEALED BY NATURAL MEANS, IN ORDER NOT TO BE VACCINATED BY THE EVIL SINISTER PLANS OF THE GATES FOUNDATION AND THE WHO (ITS SERVANT) AND NOT OT INGEST ANY OF THE PRODUCTS BEING PUSHED BY THE MEDIA AND THE BIG PHARMA!!! As posted there: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031
Extra Note: And maybe vaporizations of all of this silver water so as to reach the lungs...
Updated May 3, 2020, 11:07 AM
En lugares como México y otros países, están llegando estas tarjetas falsas a sus direcciones que les piden un depósito para poderlas activar, eso es falso: NO CREAN EN ESAS MENTIRAS, ROMPAN ESAS TARJETAS FRAUDULENTAS:
The most extraordinary freedom in the midst of an engineered COVID-19 Pandemic by those deep-state, dark souls such as Bill Gates and his likes, in their failed attempts for a "Coup d'etat" based on fear and deception, but they will NOT prevail, the spirit within us restraining them is our civic "VOTE" in this case!!! Every single day more researchers are denouncing the lies that we are all in the planet experiencing and defeating right now!!! (Ah, and B.T.W., also the hypocrites are being exposed!!!; as it is done by a great and bold woman from Innsbruck, Austria, is adding her great grain of sand, her drop of truth (which, as in the photo below, droplet by droplet is being transformed into a waterfall, the fall of those obscure entities that organized it all!): https://www.uibk.ac.at/microbiology/team/rossana-segreto/index.html.en, https://www.researchgate.net/publication/340924249_Is_considering_a_genetic-manipulation_origin_for_SARS-CoV-2_a_conspiracy_theory_that_must_be_censored, Go bold men and women, go with the power of the inner spirit and set your foot over the head of the serpent once again!!!
Updated May 2, 2020, 11:00 AM
Updated May 2, 2020, 10:52 AM
Updated May 2, 2020, 10:52 AM
Updated May 2, 2020, 10:52 AM
Updated May 2, 2020, 10:51 AM
Updated May 2, 2020, 10:51 AM
Updated May 2, 2020, 10:50 AM
Updated May 2, 2020, 10:50 AM
Updated May 2, 2020, 10:50 AM
Updated May 2, 2020, 10:49 AM
Updated May 2, 2020, 10:49 AM
One more of the research on the artificial nature of COVID-19: "Another very interesting aspect of this PRRAR cleavage site for either: 1) FURIN, 2) TMPRSS2 (Transmembrane protease, serine 2), or 3) TRYPSIN, is that when Chinese researchers put together 155 sequences of coronaviruses, they stood alone by themselves in their own clade the three Sars-CoV-2 (the virus of COVID-19) genomes that were compared at that time, with the closest the very suspicious RaTG13 sequence that is the only one that gets closer to the virus of COVID-19, making it to look as if it were also a modified sequence, as it had been obtained since 2013 and not released "in full" until 2020 after the first sequence of the COVID-19 virus went out.
Yuri Deigin says this about that: "...the biggest problem with the 4% difference argument (between RaTG13 and the virus of COVID-19) is that it relies on RaTG13 being exactly what WIV says it is. If we are to seriously consider the lab leak hypothesis, we must concede that it does not make sense to blindly trust the data released by the very lab suspected of the leak. If the leak did occur, as is the premise of the lab hypothesis, then the description of what RaTG13 is could be furthering the goal of covering up the leak... One thing that could help rule out tampering with RaTG13 is having independent labs sequence the 2013 Yunnan samples that She Zhengli extracted RaTG13 from. WIV must still have them if they re-sequenced RaTG13 in 2020."
But, I suspect a tampering even with the RaTG13 to make it look "closer" (and it is the only one, and a portion of it was published earlier by Zhengli: https://www.wionews.com/opinions-blogs/is-bat-coronavirus-4991-a-smoking-gun-in-chinas-covid-19-cover-up-294760) to CoV-2.
Most notably, that comparison of all those sequences falls in a third where there is not a nearby Furin cleavage site, but only by the one of those sequences!!! Another very strong evidence of human tampering by adding those 12-bases for the Furin cleavage site!!!
This the amazing Russian research: https://medium.com/@yurideigin/lab-made-cov2-genealogy-through-the-lens-of-gain-of-function-research-f96dd7413748
And the article of that labor consuming comparison: http://chinaxiv.org/user/download.htm?id=30223, which also includes a great set of products able to potentially inhibit the Furin site, some of them very easy to find!!! (I suggest a cocktail of any three of them to get rid of this COVID-19 as a preventive way!!!)": https://www.researchgate.net/post/COVID-19_CCTCGGCGGGCACGT_PRRAR_AA_Furin_cleavage_site_at_23603-23617_of_the_MN908947_Genbank_Genome_Matches_Mostly_Bacteria_COVID-19_in_BLAST
Yuri Deigin says this about that: "...the biggest problem with the 4% difference argument (between RaTG13 and the virus of COVID-19) is that it relies on RaTG13 being exactly what WIV says it is. If we are to seriously consider the lab leak hypothesis, we must concede that it does not make sense to blindly trust the data released by the very lab suspected of the leak. If the leak did occur, as is the premise of the lab hypothesis, then the description of what RaTG13 is could be furthering the goal of covering up the leak... One thing that could help rule out tampering with RaTG13 is having independent labs sequence the 2013 Yunnan samples that She Zhengli extracted RaTG13 from. WIV must still have them if they re-sequenced RaTG13 in 2020."
But, I suspect a tampering even with the RaTG13 to make it look "closer" (and it is the only one, and a portion of it was published earlier by Zhengli: https://www.wionews.com/opinions-blogs/is-bat-coronavirus-4991-a-smoking-gun-in-chinas-covid-19-cover-up-294760) to CoV-2.
Most notably, that comparison of all those sequences falls in a third where there is not a nearby Furin cleavage site, but only by the one of those sequences!!! Another very strong evidence of human tampering by adding those 12-bases for the Furin cleavage site!!!
This the amazing Russian research: https://medium.com/@yurideigin/lab-made-cov2-genealogy-through-the-lens-of-gain-of-function-research-f96dd7413748
And the article of that labor consuming comparison: http://chinaxiv.org/user/download.htm?id=30223, which also includes a great set of products able to potentially inhibit the Furin site, some of them very easy to find!!! (I suggest a cocktail of any three of them to get rid of this COVID-19 as a preventive way!!!)": https://www.researchgate.net/post/COVID-19_CCTCGGCGGGCACGT_PRRAR_AA_Furin_cleavage_site_at_23603-23617_of_the_MN908947_Genbank_Genome_Matches_Mostly_Bacteria_COVID-19_in_BLAST
My contribution of today at the ResearchGate that is going to help stop Gates and his sinister plans against the whole of humanity: "An excellent article, also from Wuhan, indicates a set of 46 substances able to potentially tacke the Furin and other proteases, so as to be able to prevent the viral multiplication (my favorites of that list are shown graphically), put here in the order in which they appear in the article, but it is not the order of efficacy (I think); I add an empty line to differentiate the tables in which those names appear: http://chinaxiv.org/user/download.htm?id=30223:
Aminopterin
Folic acid
Sulfoxone
Silybin
Diminazene
Fludarabine phosphate
L-Arginine
Hydroxystilbamidine
Methotrexate
L-dopa
Irinotecan
Cefoperazone
Folinic acid
Glycerol 3-phosphate
Valganciclovir
Fosaprepitant
Lomefloxacin
Glutathione
Famotidine
Imatinib
Chenodeoxycholic acid
(-)-Epigallocatechin gallate
Theaflavin 3,3'-di-O-gallate
Biorobin
14-deoxy-11,12-didehydroandrographiside
"(1S,2R,4aS,5R,8aS)-1-formamido-1,4a-dimethyl-6-methylene-5-((E)-2-(2-oxo-2,5-dihydrofuran- 3-yl)ethenyl) decahydronaphthalen-2-yl5-((R)-1,2-dithiolan-3-yl) pentanoate"
2β,30β-dihydroxy-3,4-seco-friedelolactone-27-lactone
Phyllaemblicin G7
Andrographolide
14-deoxy-11,12-didehydroandrographolide
"(1S,2R,4aS,5R,8aS)-1-formamido-1,4a-dimethyl-6-methylene-5-((E)-2-(2-oxo-2,5-
dihydrofuran-3-yl)ethenyl) decahydronaphthalen-2-yl2-aminoacetate"
"2-[[2-O-(6-deoxy-α-L-mannopyranosyl)-β-D-xylopyranosyl]oxy]-1,8-dihydroxy-6-methoxy-9H-xanthen-9-one"
Kouitchenside J
Stigmast-5-en-3-ol
Kouitchenside F
Suramin
Indinavir
Boceprevir
Tenofoviralafenamide
TenofovirDisoproxil
Acycloguanosine triphosphate
Telaprevir
Dolutegravir
Maraviroc
Cobicistat
Stavudine triphosphate
Just to be alternate to the absurd and obtuse recommendations of the WHO and of Bill Gates and his evil vaccination project, try it all of it that could be handy (And remember to use your own saliva to rub your inner nostrils as its powerful enzymes are destructive, not only of the HIV, but, I believe also of this COVID-19 virus made into a laboratory, a good nebulized or sprayed to be aspired by your lungs of your own saliva may be able also to take away this pest, I think, at least in its early stages... think about those treatments and alternatives). Comment on the efficacy of these ones or of other easy treatments that you have found to fix this manufactured Pandemic by the "Gates Foundation"."
Aminopterin
Folic acid
Sulfoxone
Silybin
Diminazene
Fludarabine phosphate
L-Arginine
Hydroxystilbamidine
Methotrexate
L-dopa
Irinotecan
Cefoperazone
Folinic acid
Glycerol 3-phosphate
Valganciclovir
Fosaprepitant
Lomefloxacin
Glutathione
Famotidine
Imatinib
Chenodeoxycholic acid
(-)-Epigallocatechin gallate
Theaflavin 3,3'-di-O-gallate
Biorobin
14-deoxy-11,12-didehydroandrographiside
"(1S,2R,4aS,5R,8aS)-1-formamido-1,4a-dimethyl-6-methylene-5-((E)-2-(2-oxo-2,5-dihydrofuran- 3-yl)ethenyl) decahydronaphthalen-2-yl5-((R)-1,2-dithiolan-3-yl) pentanoate"
2β,30β-dihydroxy-3,4-seco-friedelolactone-27-lactone
Phyllaemblicin G7
Andrographolide
14-deoxy-11,12-didehydroandrographolide
"(1S,2R,4aS,5R,8aS)-1-formamido-1,4a-dimethyl-6-methylene-5-((E)-2-(2-oxo-2,5-
dihydrofuran-3-yl)ethenyl) decahydronaphthalen-2-yl2-aminoacetate"
"2-[[2-O-(6-deoxy-α-L-mannopyranosyl)-β-D-xylopyranosyl]oxy]-1,8-dihydroxy-6-methoxy-9H-xanthen-9-one"
Kouitchenside J
Stigmast-5-en-3-ol
Kouitchenside F
Suramin
Indinavir
Boceprevir
Tenofoviralafenamide
TenofovirDisoproxil
Acycloguanosine triphosphate
Telaprevir
Dolutegravir
Maraviroc
Cobicistat
Stavudine triphosphate
Just to be alternate to the absurd and obtuse recommendations of the WHO and of Bill Gates and his evil vaccination project, try it all of it that could be handy (And remember to use your own saliva to rub your inner nostrils as its powerful enzymes are destructive, not only of the HIV, but, I believe also of this COVID-19 virus made into a laboratory, a good nebulized or sprayed to be aspired by your lungs of your own saliva may be able also to take away this pest, I think, at least in its early stages... think about those treatments and alternatives). Comment on the efficacy of these ones or of other easy treatments that you have found to fix this manufactured Pandemic by the "Gates Foundation"."
Las cartas que le mandé a CNN en contra de Gates y de Soros (por favor, si pueden manden la suya, hoy a las 7:00 PM Bill Gates, el asesino, va a ser de nuevo el centro de la atención de los vendidos Anderson Cooper y Sanjay Gupta; su hoja de contacto: https://cnnespanol.cnn.com/contactanos/): "CNN,
Detestamos que pongan a Bill Gates una y otra vez como "el experto" para hablar de COVID-19, es un hecho que él desea una vacunación universal para poder implantar su "Certificado Digital de Vacunación", su "Pasaporte Inmunológico". Sabemos que intentó promover a la mujer mas diabólica del planeta Marina Abramovic y que su padre fue el director de "Planned Parenthood", distribuidor de anticonceptivos y consejero del aborto. Gates señaló cínicamente que con vacunación, servicios de salud y servicios de salud reproductiva la población mundial podría reducirse un 15% para reducir la contaminación ambiental.
Todas nuestras investigaciones indican que el virus del COVID-19 ha sido diseñado por humanos y liberado oportunamente para intentar llevar a cabo los planes de Bill Gates, quien tiene una fábrica en China con más de seis mil empleados chinos.
Por favor, remuevan a ese asesino de Bill Gates y pongan en su lugar a un verdadero inmunólogo, infectólogo y epidemiólogo, en vez de a un criminal con infinidad de conflictos de intereses, a no ser que esté comprando a todos ustedes con dinero lo que es lo más probable.
CNN es una estación vendida a intereses que van en contra de la humanidad.
Con todo mi desprecio por su estación, por Anderson Cooper, hijo de la corrupta Gloria Vanderbilt, y del vendido de Sanjay Gupta, quien falsamente señaló antes en su programa que el virus del COVID-19 no cambiaba, lo cual es absolutamente falso, pero que se dice para empujar una campaña inhumana de vacunación con vacunas de RNA que se sabe son inútiles, ya que el virus de la vacuna ya no es el que anda en el ambiente a la hora de inyectarla, pues ya ha cambiado en su base o bases de nucleótido.
Pongo uno de infinidad de nexos que denuncian la artificialidad del virus de COVID-19: https://medium.com/@yurideigin/lab-made-cov2-genealogy-through-the-lens-of-gain-of-function-research-f96dd7413748, el cual tiene el armazón de virus de murciélago, el dominio del sitio de receptor de virus de pangolín, y el sitio de ruptura S1-S2 compuesto por 12-bases de procedencia aún desconocida (pero que colegas investigadores han descubierto que coincide, ya sea con un virus de cerdo u otro de ungulados domésticos, o de una secuencia patentada por "Moderna", beneficiaria de Bill Gates), lo que implicaría, si fuera "natural" que en un mismo animal, se entrecruzaran al menos tres viruses: de murciélago, de pangolín (sin dejar más rastro más que en los sitios clave), y de cerdo (sin dejar otro rastro más que en este sitio clave). Todas las tecnologías moleculares para hacer todo esto de manera sintética sin dejar rastro, incluyendo un pasaje final de laboratorio en un hurón para darle la apariencia de ser aún más natural, ya se encontraba lo suficientemente avanzado como para haber diseñado este virus en un laboratorio.
Con todo mi desprecio por una estación unilateral y vendida,
Fernando Castro-Chavez, PhD.
P.D.
http://www.elindependiente.sv/2020/03/25/bill-gates-anuncia-que-implantara-microchips-para-combatir-covid-19-y-rastrear-las-vacunas/
/////////////////////////////
CNN:
También me parece despreciable que cada media hora presenten esos videos de la multitud de hondureños amontonados en un puente. Todos ya sabemos a estas alturas que Soros les pagó y los trajo en camiones para montar un teatrillo que ustedes de la manera más baja informativamente hablando, siguen promoviendo como si hubiera sido algo real: https://www.foxnews.com/transcript/new-video-shows-migrant-caravan-is-organized-and-well-funded
Eso confirma de nuevo que ustedes parecieran ser unas prostitutas informativas pagaderas al mejor postor.
Algún día aquí o en la eternidad tendrán que pagar por las mentiras que con la ayuda de Soros en este caso y de Bill Gates en el caso anterior, ustedes promueven.
El mismo del anterior,
Fernando Castro-Chavez, PhD.
P.D.
http://nuevoaccion.com/articulos/los-frentes-de-soros-en-mexico-para-danar-a-trump/"
Detestamos que pongan a Bill Gates una y otra vez como "el experto" para hablar de COVID-19, es un hecho que él desea una vacunación universal para poder implantar su "Certificado Digital de Vacunación", su "Pasaporte Inmunológico". Sabemos que intentó promover a la mujer mas diabólica del planeta Marina Abramovic y que su padre fue el director de "Planned Parenthood", distribuidor de anticonceptivos y consejero del aborto. Gates señaló cínicamente que con vacunación, servicios de salud y servicios de salud reproductiva la población mundial podría reducirse un 15% para reducir la contaminación ambiental.
Todas nuestras investigaciones indican que el virus del COVID-19 ha sido diseñado por humanos y liberado oportunamente para intentar llevar a cabo los planes de Bill Gates, quien tiene una fábrica en China con más de seis mil empleados chinos.
Por favor, remuevan a ese asesino de Bill Gates y pongan en su lugar a un verdadero inmunólogo, infectólogo y epidemiólogo, en vez de a un criminal con infinidad de conflictos de intereses, a no ser que esté comprando a todos ustedes con dinero lo que es lo más probable.
CNN es una estación vendida a intereses que van en contra de la humanidad.
Con todo mi desprecio por su estación, por Anderson Cooper, hijo de la corrupta Gloria Vanderbilt, y del vendido de Sanjay Gupta, quien falsamente señaló antes en su programa que el virus del COVID-19 no cambiaba, lo cual es absolutamente falso, pero que se dice para empujar una campaña inhumana de vacunación con vacunas de RNA que se sabe son inútiles, ya que el virus de la vacuna ya no es el que anda en el ambiente a la hora de inyectarla, pues ya ha cambiado en su base o bases de nucleótido.
Pongo uno de infinidad de nexos que denuncian la artificialidad del virus de COVID-19: https://medium.com/@yurideigin/lab-made-cov2-genealogy-through-the-lens-of-gain-of-function-research-f96dd7413748, el cual tiene el armazón de virus de murciélago, el dominio del sitio de receptor de virus de pangolín, y el sitio de ruptura S1-S2 compuesto por 12-bases de procedencia aún desconocida (pero que colegas investigadores han descubierto que coincide, ya sea con un virus de cerdo u otro de ungulados domésticos, o de una secuencia patentada por "Moderna", beneficiaria de Bill Gates), lo que implicaría, si fuera "natural" que en un mismo animal, se entrecruzaran al menos tres viruses: de murciélago, de pangolín (sin dejar más rastro más que en los sitios clave), y de cerdo (sin dejar otro rastro más que en este sitio clave). Todas las tecnologías moleculares para hacer todo esto de manera sintética sin dejar rastro, incluyendo un pasaje final de laboratorio en un hurón para darle la apariencia de ser aún más natural, ya se encontraba lo suficientemente avanzado como para haber diseñado este virus en un laboratorio.
Con todo mi desprecio por una estación unilateral y vendida,
Fernando Castro-Chavez, PhD.
P.D.
http://www.elindependiente.sv/2020/03/25/bill-gates-anuncia-que-implantara-microchips-para-combatir-covid-19-y-rastrear-las-vacunas/
/////////////////////////////
CNN:
También me parece despreciable que cada media hora presenten esos videos de la multitud de hondureños amontonados en un puente. Todos ya sabemos a estas alturas que Soros les pagó y los trajo en camiones para montar un teatrillo que ustedes de la manera más baja informativamente hablando, siguen promoviendo como si hubiera sido algo real: https://www.foxnews.com/transcript/new-video-shows-migrant-caravan-is-organized-and-well-funded
Eso confirma de nuevo que ustedes parecieran ser unas prostitutas informativas pagaderas al mejor postor.
Algún día aquí o en la eternidad tendrán que pagar por las mentiras que con la ayuda de Soros en este caso y de Bill Gates en el caso anterior, ustedes promueven.
El mismo del anterior,
Fernando Castro-Chavez, PhD.
P.D.
http://nuevoaccion.com/articulos/los-frentes-de-soros-en-mexico-para-danar-a-trump/"
So, she drank her "Piña Colada" in our first Date at Galveston, and then, at San Antonio, in our second loger trip, we went all "crazy"..., ignoring that just & then our car was being towed!!! Just like right now with this manufactured "Pandemic" by Bill Gates is attempting to be robbing us from our freedoms and of our rights!!! |
So, she drank her "Piña Colada" in our first Date at Galveston, and then, at San Antonio, in our second loger trip, we went all "crazy"..., ignoring that just & then our car was being towed!!! Just like right now with this manufactured "Pandemic" by Bill Gates is attempting to be robbing us from our freedoms and of our rights!!!
George, Yes please, you that soar free through the horizons of Creation, pray in the spirit for us all!!! Find the best hideaways and landscapes, the born-again ones are praying in the spirit for you as well, for you to keep on blessing for us all the wonderful nature of our dear and good God who as usual, will not let us down in this one either!!! In the living Christ Jesus, Fernando.
Updated Apr 30, 2020, 8:52 AM
Another great article denouncing the lies that COVID-19 is "natural", demonstrating the ARTIFICIAL nature of it!!!: https://medium.com/@yurideigin/lab-made-cov2-genealogy-through-the-lens-of-gain-of-function-research-f96dd7413748, please, keep them coming, before it is too late for humanity, before we all born-again ones are gone for good from this good earth of all of us!!!:
Updated Apr 30, 2020, 8:17 AM
Updated Apr 29, 2020, 10:48 PM
My publication of today at Research Gate, profiles the most current paper by the Nobel Prize in Medicine (2008) for his discovery of the HIV. In this paper, with Perez, he demonstrates that the COVID-19 has general and special fragments of the HIV virus, reason why it is very pernicious, here is the excerpt with some of his words: "Luc Montagnier (Nobel Prize of Medicine, 2008 for his discovery of the HIV), has co-authored a related paper as the senior author, with Jean-Claude Perez as the main author: "COVID-19, SARS and Bats Coronaviruses Genomes Unexpected Exogenous RNA Sequences": https://www.researchgate.net/publication/340924772_COVID-19_SARS_and_Bats_Coronaviruses_Genomes_Unexpected_Exogeneous_RNA_Sequences
From their main conclusions are:
"...we predict that this 225 bases region will only mutate in order to increase its level of global integration vis-à-vis its genome."
And then, the damning point for the mostly ever lying mainstream CCP, NIH, CDC cover-up of COVID-19 having originated and engineered in a Wuhan laboratory:
"The hyper-selective and discriminating region at the start of the 225 bases region corresponding to the Kenya HIV-1 fingerprint could and should constitute a privileged target for possible tests or even therapies or vaccines."
"A small region of 225 bases distinguishes radically COVID-19 from all SARS genomes, it contains in particular among its 4 EIEs, a fragment coming from a nonfunctional 2008 KENYA HIV-1 genome which we know was used in a vaccine strategy HIV."
And their warning, to those that naïvely thing that the virus is still only "natural":
"We cannot apply the current and proven tools and methods of fighting against viruses, hitherto NATURAL, because we do not know today how a new virus whose part of the genome is SYNTHETIC in nature will evolve and evolve. This was already true for SARS, and even more so for COVID-19."
"Many Exogenous Informative Elements "EIE" HIV / SIV (about 20 EIE) are present in the genome of COVID_19 but also partly in SARS", etc...
Two key images, the first one:
Wuhan: "Figure 6 – High level of HETEROGENEITY within the 225 bases region in Wuhan market ID: LR757998.1 reference genome."
And the second one:
RaTG13: "Figure 7 – High level of COHESION in 225 bases bat RaTG13 region including the fingerprint of Kenya HIV-1 but not the 3 others HIV SIV signatures."" : https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031
From their main conclusions are:
"...we predict that this 225 bases region will only mutate in order to increase its level of global integration vis-à-vis its genome."
And then, the damning point for the mostly ever lying mainstream CCP, NIH, CDC cover-up of COVID-19 having originated and engineered in a Wuhan laboratory:
"The hyper-selective and discriminating region at the start of the 225 bases region corresponding to the Kenya HIV-1 fingerprint could and should constitute a privileged target for possible tests or even therapies or vaccines."
"A small region of 225 bases distinguishes radically COVID-19 from all SARS genomes, it contains in particular among its 4 EIEs, a fragment coming from a nonfunctional 2008 KENYA HIV-1 genome which we know was used in a vaccine strategy HIV."
And their warning, to those that naïvely thing that the virus is still only "natural":
"We cannot apply the current and proven tools and methods of fighting against viruses, hitherto NATURAL, because we do not know today how a new virus whose part of the genome is SYNTHETIC in nature will evolve and evolve. This was already true for SARS, and even more so for COVID-19."
"Many Exogenous Informative Elements "EIE" HIV / SIV (about 20 EIE) are present in the genome of COVID_19 but also partly in SARS", etc...
Two key images, the first one:
Wuhan: "Figure 6 – High level of HETEROGENEITY within the 225 bases region in Wuhan market ID: LR757998.1 reference genome."
And the second one:
RaTG13: "Figure 7 – High level of COHESION in 225 bases bat RaTG13 region including the fingerprint of Kenya HIV-1 but not the 3 others HIV SIV signatures."" : https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031
Updated Apr 29, 2020, 10:10 PM
My research of today in the demonstration that COVID-19 is a construct from a Laboratory at Wuhan is, in part, the next one: "other of the removed articles (removed both in the PDF and in the HTM online) by Baric and Zhengli-Li (as it appears there), from their criminal article in Nature Medicine of 2015, showing a lethal virus killing elderly mice, just as the new COVID-19 designed by them, is doing against humans, but their removal is the next one, discussions in full at: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031:
22. Sheahan T, Rockx B, Donaldson E, Corti D, Baric R. Pathways of cross-species transmission of synthetically reconstructed zoonotic severe acute respiratory syndrome coronavirus. Journal of virology. 2008; 82:8721–8732.10.1128/JVI.00818-08 [PubMed: 18579604]: https://jvi.asm.org/content/82/17/8721
That removal is also key, because it shows a little progress from their previous five tweaks that had been done in 2005, in which by tweaking in the laboratory the nucleotides, they finally discovered that F was a better bond than the previous L for one of the key positions of the six amino acids that integrate the final version of COVID-19, an example key figure of this is posted here with the explanation that they wrote for it: "(F) In addition to the N479 mutation, the F442 and F472 mutations further remodel the SZ16 K479N D22 RBD, further enhancing the binding efficiency to hACE2" (That ended up being, as per the reference of Andersen et al, the amino acid F486 for the COVID-19 virus. I just left also (D) for you to realize that before the deliberate tweak in the lab of this amino acid it was an L472 in that position, so obviously, by putting there a longer hydrophobic amino acid as F instead of the other shorter one, L, the binding improved. (At the center is a Spike RBD from the civet, showing its high similarity to the human).
So, little by little, by trial and error, independent of what where the best theoretical models, in the practice they were proofing and trying other amino acids for the rest of the five crucial regions, until they ended up with their final version in COVID-19: L+F+QS+N+Y, corresponding to the relational numerical positions as per the Andersen "Proximal Origin..." reference of: 455+486+493+494+501+505, showing over and over and one more time that all the needed technologies were already there, and the needed time to "work" to tweak manually the six key positions of the Receptor Binding Domain (RBD) to produce in the laboratory of Shi Zhengli-Li at Wuhan (with no need of any virus from Pangolin, but with who little hands of a small woman altering nucleotides to produce different amino acids until the best combination was obtained for the final version for COVID/19): https://www.researchgate.net/post/Fourth_Sequence_COVID-19_TTG_90_TTT_18_CAATCA_18_AAT_9_TAC_L_F_QS_N_Y_Viral_Pangolin_Insert_with_Receptor_Binding_Domain_RBD_in_a_Virus_of_Bat", and also: "Another of the removed articles by Zhengli and Baric (for their print and PDF version but not from the online HTM version page), from their 2015 assasin of elderly mice article appeared ad Nature Medicine under the roar of the research community for the dangers it posed:
25. Sims AC, et al. Release of severe acute respiratory syndrome coronavirus nuclear import block enhances host transcription in human lung cells. Journal of virology. 2013; 87:3885–3902.10.1128/JVI.02520-12 [PubMed: 23365422]: https://jvi.asm.org/content/87/7/3885
This article clearly indicates that they were not only able to modify individual nucleotides at will, to obtain the desired amino acids (as the previous two postings show), but also that they were able to remove genes from complete proteins!
This indicates the modular and antinatural difference in the relative variability of the proteins of COVID-19 when compared with the same proteins of the RaTG13 (an also mildly altered) genome, as it will be briefly seen next.
This indicates that they were able to, just by comparing the behavior of the virus with and without each protein, to determine which were the most aggressive proteins to do their composite construct for COVID-19, going those identities, from 99% for proteins such as: E, Orf10, Nsp9, and the uncoding end; then to 98% for Nsp 7, Nsp8, Nsp10, Nsp12, Nsp13, and the uncoding start, ORF6 (which is the one considered in this space); 97% for N, Orf 7, Orf 8, Nsp14; 96% Nsp1, Nsp3, Nsp4, Nsp5, Nsp6, Nsp15, Nsp16, Orf3, M; 95% Nsp2; 93% Spike (combined, but we need to separate its portions to get a better idea of its inner variability); so the fact of a jump between 99% identity in some proteins, to a drastic reduction of identity to 96%, 95% and even to 93% to the most modified by hand of the proteins, is another telling point that this COVID-19 is a completely synthetic protein made in the Wuhan lab of Zhengli. So, this shows a manipulation of individual proteins as demonstrated in the removed article by Baric.
And, because Spike for COVID-19 is a special case, if we subdivide its different portions we get the different uneven identities within the portion, showing that this gene has been the most manipulated by those little female hands that are killing humans by the millions: 92% for the portion that contains the six HIV/SIV-like portions found by Jean-Claude Perez, 93% for the longer and final part that is after the Furin Cleavage site; but the surprising ones are: 44.44% for the portion of the RBD!!! and only 20% for the portion of the Furin cleavage site!!! Indicating that these two portions have been the most modified by hand within the lab.
But, back to the point that the article under consideration is making, that of the behavior of the virus with or without the Orf6 (a "Signal Blocker", to prevent the infected cell to send out her urgent request of help (her S.O.S.) to the immune system. It also blocks some of the cell’s own virus-fighting proteins, the same ones targeted by other viruses such as polio and influenza!!!").
In the chosen image, the removal of this protein, in this case, the "bitches" doing this pervert and crooked research chose as their "human victims" the Calu3 2B4 cells, who expressed this (using microarrays for a span of 72 hs, red means upregulation while green means downregulation): Upregulation of Gene Expression, of Nucleosome Assembly, of Chromosome Organization, of the GTPase Mediated Signal Transduction, the Regulation of Cell Size and the Negative Regulation of Cell Differentiation, which means that if the human cells lacked the calamity of Orf6, they behaved more normally, Da!!! [But also the sinister meaning of that is that all of those pathways are, sorry: "fucked-up" in the presence of the criminal Orf6].
But basically, Baric removed it because it showed how deeply were these individuals mad at their heads tweaking full proteins in and out of the virus that eventually they constructed as COVID-19, this also shows the complete uselessness of all of this diabolical viral research, because if it were useful at all, the solution will be found right at the start of this COVID-19 pandemia, but the originators of it, and the "sponsors" for their gain of a full control over humanity like Bill Gates, the ones who benefit the most of it, sooner or later will be paying for what they have done!!! Here on earth, or there..., all this viral research, basically has been used for evil and not for good, as the results of the 2020 pandemic planned by Gates demonstrates. Put Bill Gates in jail and do not let him to touch you or your loved ones with his pervert ""Mark of the Beast"" G5 compliant syringe of his supposed "vaccines"!!! Your future and that of your own is on the balance right now!!!
Ah, I just need to add that this particular paper was performed by the greasy hands of Baric and 21 other researchers that right now are very quiet, and with their tails under their hind-legs instead of being themselves doing what I am doing, and demonstrating to the universe that all the tools were already there to manufacture artificially COVID-19, their collective behavior is the same as the one of the full Wuhan lab, they are playing demency and idiocy while their fellow men are dying at their sides. Can any one of those co-authors please stand up and denounce this crime to humanity that escaped from a lab???
Criminals and accomplices with their silence of Baric and Zhengli:
Amy C. Sims, Susan C. Tilton, Vineet D. Menachery, Lisa E. Gralinski, Alexandra Schäfer, Melissa M. Matzke, Bobbie-Jo M. Webb-Robertson, Jean Chang, Maria L. Luna, Casey E. Long, Anil K. Shukla, Armand R. Bankhead III, Susan E. Burkett, Gregory Zornetzer, Chien-Te Kent Tseng, Thomas O. Metz, Raymond Pickles, Shannon McWeeney, Richard D. Smith, Michael G. Katze, Katrina M. Waters, Ralph S. Baric.
And this same exercise of denouncing as accomplices any one that participated in the research conductive to the release of COVID-19 from a lab can be done for each one and for any of the related articles. Especially all that were deliberately removed by the sinister and deceiving hand of Baric (even if the removal was to comply with regulations, as kindly one researcher suggested me, in the end, the most damning papers were the ones removed by Baric)." Notes: A brother in Christ asked me to do a formal version in Spanish of the basic conclusions of all of this that basically seems to be endless... but the purpose is to nail the responsibles so as for something like this not to happen again!!! As if the base reason is left open, it may repeat again, and that is what the ones responsible to orchestrate the whole pandemic desire... Gates is already planing ulterior pandemics until all the planet falls into a passive submission, but i am saying that as long as we, born again Christians are here, that will not happen.
22. Sheahan T, Rockx B, Donaldson E, Corti D, Baric R. Pathways of cross-species transmission of synthetically reconstructed zoonotic severe acute respiratory syndrome coronavirus. Journal of virology. 2008; 82:8721–8732.10.1128/JVI.00818-08 [PubMed: 18579604]: https://jvi.asm.org/content/82/17/8721
That removal is also key, because it shows a little progress from their previous five tweaks that had been done in 2005, in which by tweaking in the laboratory the nucleotides, they finally discovered that F was a better bond than the previous L for one of the key positions of the six amino acids that integrate the final version of COVID-19, an example key figure of this is posted here with the explanation that they wrote for it: "(F) In addition to the N479 mutation, the F442 and F472 mutations further remodel the SZ16 K479N D22 RBD, further enhancing the binding efficiency to hACE2" (That ended up being, as per the reference of Andersen et al, the amino acid F486 for the COVID-19 virus. I just left also (D) for you to realize that before the deliberate tweak in the lab of this amino acid it was an L472 in that position, so obviously, by putting there a longer hydrophobic amino acid as F instead of the other shorter one, L, the binding improved. (At the center is a Spike RBD from the civet, showing its high similarity to the human).
So, little by little, by trial and error, independent of what where the best theoretical models, in the practice they were proofing and trying other amino acids for the rest of the five crucial regions, until they ended up with their final version in COVID-19: L+F+QS+N+Y, corresponding to the relational numerical positions as per the Andersen "Proximal Origin..." reference of: 455+486+493+494+501+505, showing over and over and one more time that all the needed technologies were already there, and the needed time to "work" to tweak manually the six key positions of the Receptor Binding Domain (RBD) to produce in the laboratory of Shi Zhengli-Li at Wuhan (with no need of any virus from Pangolin, but with who little hands of a small woman altering nucleotides to produce different amino acids until the best combination was obtained for the final version for COVID/19): https://www.researchgate.net/post/Fourth_Sequence_COVID-19_TTG_90_TTT_18_CAATCA_18_AAT_9_TAC_L_F_QS_N_Y_Viral_Pangolin_Insert_with_Receptor_Binding_Domain_RBD_in_a_Virus_of_Bat", and also: "Another of the removed articles by Zhengli and Baric (for their print and PDF version but not from the online HTM version page), from their 2015 assasin of elderly mice article appeared ad Nature Medicine under the roar of the research community for the dangers it posed:
25. Sims AC, et al. Release of severe acute respiratory syndrome coronavirus nuclear import block enhances host transcription in human lung cells. Journal of virology. 2013; 87:3885–3902.10.1128/JVI.02520-12 [PubMed: 23365422]: https://jvi.asm.org/content/87/7/3885
This article clearly indicates that they were not only able to modify individual nucleotides at will, to obtain the desired amino acids (as the previous two postings show), but also that they were able to remove genes from complete proteins!
This indicates the modular and antinatural difference in the relative variability of the proteins of COVID-19 when compared with the same proteins of the RaTG13 (an also mildly altered) genome, as it will be briefly seen next.
This indicates that they were able to, just by comparing the behavior of the virus with and without each protein, to determine which were the most aggressive proteins to do their composite construct for COVID-19, going those identities, from 99% for proteins such as: E, Orf10, Nsp9, and the uncoding end; then to 98% for Nsp 7, Nsp8, Nsp10, Nsp12, Nsp13, and the uncoding start, ORF6 (which is the one considered in this space); 97% for N, Orf 7, Orf 8, Nsp14; 96% Nsp1, Nsp3, Nsp4, Nsp5, Nsp6, Nsp15, Nsp16, Orf3, M; 95% Nsp2; 93% Spike (combined, but we need to separate its portions to get a better idea of its inner variability); so the fact of a jump between 99% identity in some proteins, to a drastic reduction of identity to 96%, 95% and even to 93% to the most modified by hand of the proteins, is another telling point that this COVID-19 is a completely synthetic protein made in the Wuhan lab of Zhengli. So, this shows a manipulation of individual proteins as demonstrated in the removed article by Baric.
And, because Spike for COVID-19 is a special case, if we subdivide its different portions we get the different uneven identities within the portion, showing that this gene has been the most manipulated by those little female hands that are killing humans by the millions: 92% for the portion that contains the six HIV/SIV-like portions found by Jean-Claude Perez, 93% for the longer and final part that is after the Furin Cleavage site; but the surprising ones are: 44.44% for the portion of the RBD!!! and only 20% for the portion of the Furin cleavage site!!! Indicating that these two portions have been the most modified by hand within the lab.
But, back to the point that the article under consideration is making, that of the behavior of the virus with or without the Orf6 (a "Signal Blocker", to prevent the infected cell to send out her urgent request of help (her S.O.S.) to the immune system. It also blocks some of the cell’s own virus-fighting proteins, the same ones targeted by other viruses such as polio and influenza!!!").
In the chosen image, the removal of this protein, in this case, the "bitches" doing this pervert and crooked research chose as their "human victims" the Calu3 2B4 cells, who expressed this (using microarrays for a span of 72 hs, red means upregulation while green means downregulation): Upregulation of Gene Expression, of Nucleosome Assembly, of Chromosome Organization, of the GTPase Mediated Signal Transduction, the Regulation of Cell Size and the Negative Regulation of Cell Differentiation, which means that if the human cells lacked the calamity of Orf6, they behaved more normally, Da!!! [But also the sinister meaning of that is that all of those pathways are, sorry: "fucked-up" in the presence of the criminal Orf6].
But basically, Baric removed it because it showed how deeply were these individuals mad at their heads tweaking full proteins in and out of the virus that eventually they constructed as COVID-19, this also shows the complete uselessness of all of this diabolical viral research, because if it were useful at all, the solution will be found right at the start of this COVID-19 pandemia, but the originators of it, and the "sponsors" for their gain of a full control over humanity like Bill Gates, the ones who benefit the most of it, sooner or later will be paying for what they have done!!! Here on earth, or there..., all this viral research, basically has been used for evil and not for good, as the results of the 2020 pandemic planned by Gates demonstrates. Put Bill Gates in jail and do not let him to touch you or your loved ones with his pervert ""Mark of the Beast"" G5 compliant syringe of his supposed "vaccines"!!! Your future and that of your own is on the balance right now!!!
Ah, I just need to add that this particular paper was performed by the greasy hands of Baric and 21 other researchers that right now are very quiet, and with their tails under their hind-legs instead of being themselves doing what I am doing, and demonstrating to the universe that all the tools were already there to manufacture artificially COVID-19, their collective behavior is the same as the one of the full Wuhan lab, they are playing demency and idiocy while their fellow men are dying at their sides. Can any one of those co-authors please stand up and denounce this crime to humanity that escaped from a lab???
Criminals and accomplices with their silence of Baric and Zhengli:
Amy C. Sims, Susan C. Tilton, Vineet D. Menachery, Lisa E. Gralinski, Alexandra Schäfer, Melissa M. Matzke, Bobbie-Jo M. Webb-Robertson, Jean Chang, Maria L. Luna, Casey E. Long, Anil K. Shukla, Armand R. Bankhead III, Susan E. Burkett, Gregory Zornetzer, Chien-Te Kent Tseng, Thomas O. Metz, Raymond Pickles, Shannon McWeeney, Richard D. Smith, Michael G. Katze, Katrina M. Waters, Ralph S. Baric.
And this same exercise of denouncing as accomplices any one that participated in the research conductive to the release of COVID-19 from a lab can be done for each one and for any of the related articles. Especially all that were deliberately removed by the sinister and deceiving hand of Baric (even if the removal was to comply with regulations, as kindly one researcher suggested me, in the end, the most damning papers were the ones removed by Baric)." Notes: A brother in Christ asked me to do a formal version in Spanish of the basic conclusions of all of this that basically seems to be endless... but the purpose is to nail the responsibles so as for something like this not to happen again!!! As if the base reason is left open, it may repeat again, and that is what the ones responsible to orchestrate the whole pandemic desire... Gates is already planing ulterior pandemics until all the planet falls into a passive submission, but i am saying that as long as we, born again Christians are here, that will not happen.
Today ResearchGate says that I have broken all the current personal records, but that means absolutely nothing until the real culprits of this COVID-19 pandemic are taken to the international courts of law, my postings of today are as follows at: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031: So, Baric removed six key articles about the methodologies used to design his killer virus from his maligned 2015 article of Nature Medicine with the "bat woman", killer of worldwide populations, Shi Zhengli, and inserted two new articles related with vaccination, one of them being a chapter of a textbook (possible at the suggestion of somebody influential at the WHO, as now it is precisely the WHO who presents for free this full chapter, remember that Bill Gates said, after donating like ten million dollars to the WHO that he wanted that to be the decade of vaccination, then the same year that Gates "predicts" a future pandemic is the year when this article of 2015 appears, then Gates sponsors the "Event 201" and the Netflix boring documentary of "Pandemia", just before the onset of "COVID-19", remembering that he has a Microsoft factory in China with more than 6,000 employees, so it will not be strange that "victim zero" is well and kicking under the protective shelter of Bill Gates), so the changed articles of that 2015 disgrace for humanity are as follows:
ADDED:
16. Siegrist, C.-A. in Vaccines 6th edn. (eds. Plotkin, S.A., Orenstein, W.A. & Offit, P.A.) 14–32 (W.B. Saunders, 2013) [It belongs to Chapter 2: Vaccine immunology, written by Claire-Anne Siegrist]: https://www.who.int/immunization/documents/Elsevier_Vaccine_immunology.pdf
17. Deming, D. et al. Vaccine efficacy in senescent mice challenged with recombinant SARS-CoV bearing epidemic and zoonotic spike variants. PLoS Med. 3, e525 (2006): https://pubmed.ncbi.nlm.nih.gov/17194199/
While the next six ones have been removed from the final version:
REMOVED:
22. Sheahan T, Rockx B, Donaldson E, Corti D, Baric R. Pathways of cross-species transmission of synthetically reconstructed zoonotic severe acute respiratory syndrome coronavirus. Journal of virology. 2008; 82:8721–8732.10.1128/JVI.00818-08 [PubMed: 18579604]: https://jvi.asm.org/content/82/17/8721
23. Qu XX, et al. Identification of two critical amino acid residues of the severe acute respiratory syndrome coronavirus spike protein for its variation in zoonotic tropism transition via a double substitution strategy. The Journal of biological chemistry. 2005; 280:29588–29595.10.1074/jbc.M500662200 [PubMed: 15980414]: https://www.jbc.org/content/280/33/29588.full.pdf
24. Ren W, et al. Difference in receptor usage between severe acute respiratory syndrome (SARS) coronavirus and SARS-like coronavirus of bat origin. Journal of virology. 2008; 82:1899–1907.10.1128/JVI.01085-07 [PubMed: 18077725]: https://jvi.asm.org/content/82/4/1899
25. Sims AC, et al. Release of severe acute respiratory syndrome coronavirus nuclear import block enhances host transcription in human lung cells. Journal of virology. 2013; 87:3885–3902.10.1128/JVI.02520-12 [PubMed: 23365422]: https://jvi.asm.org/content/87/7/3885
26. Fulcher ML, Gabriel S, Burns KA, Yankaskas JR, Randell SH. Well-differentiated human airway epithelial cell cultures. Methods in molecular medicine. 2005; 107:183–206. [PubMed: 15492373]: https://www.med.unc.edu/marsicolunginstitute/files/2017/12/Book-Chapter.pdf
27. Roberts A, et al. A mouse-adapted SARS-coronavirus causes disease and mortality in BALB/c mice. PLoS pathogens. 2007; 3:e5.10.1371/journal.ppat.0030005 [PubMed: 17222058]: https://journals.plos.org/plospathogens/article?id=10.1371%2Fjournal.ppat.0030005
The Pathetic Patent of Baric on how to tweak the gene for the Spike protein of Coronavirus: https://patents.google.com/patent/WO2002086068A2
In the image we see that Baric lied to the media in 2020 saying that he had "FOUND" a deadly Coronavirus in 2015, and you can still see as for today that video of the interview of Baric, when he also deceptively hinted, because of all interviewed, he was the one that knew better, saying faking himself some "idiocy", that a flu was worst than the current COVID-19. So, he told the media that he had "FOUND" a deadly Coronavirus in 2015, when we all clearly know that he not did that, but he "DESIGNED" such deadly virus with similar effects than the COVID-19 of today, to the point that the headlines of the scientific journals of those times, were raising very serious ethical concerns, as can be seen in the other attached image, so that S.O.B. of Baric did not "FOUND" but "DESIGNED" a lethal virus in the company of the Wuhan Lab with Shi Zhengli-Li, as they put her there, dobling by mistake the "Li", and some other fella from China as well. I also attach here the clip of Bill Gates, ever present sponsor of this 2020 Pandemic, who, as per the three accounts that establish his guilt also presented here, he holds the Anti-Christic patent 060606 to insert a chip under the skin of humans (I do not care what "snopes" says, as it is just a counterfeit "debunker"): https://patentscope.wipo.int/search/en/detail.jsf?docId=WO2020060606, then as Robert Kennedy Jr., nephew of JFK, demonstrates in his Instagram account, the Bill and Melinda Gates Foundation sponsored a research published in "Science", precisely regarding the implant of a chip inside the skin: https://stm.sciencemag.org/content/11/523/eaay7162?rss=1&fbclid=IwAR2CJ1hlWlM61ZsnXe3glwJynOvqJD9fgf-EX6Q8LDybCoxZ0Czs2L5PVYI, in pursuit of his so loved "Digital Certificate" of vaccination, which video proof I am also annexing here, so as for Science to have the three minimal proofs to demonstrate the criminality of Bill Gates, who is faking that he is an MD, not being himself an MD, pushing down the throats of humanity a completely useless RNA vaccine, as I demonstrate in my postings here, from the fifth to the eight: https://www.researchgate.net/post/Fifth_Sequence_COVID-19_2_variants_ATG-246-TT_CA-111-TAA_TTA_L_L-Type_70_TCA_S_S-Type_30_in_position_28144_of_MN908947_for_ORF8_NifB And also: "One of the references removed by Baric clearly indicates that there was the technology to move by hand nucleotides to replace amino acids since the 2005, without any need of a spurious "Pangolin", so Andersen was playing the "idiot" when he ignored also that the technology to tweak particular nucleotides and amino acids in a laboratory was already there for a long time ago, so the "coverupers" of this COVID-19 having been designed in a Wuhan Laboratory are being very disingenuous about the whole Pandemic of 2020 because basically, they prefer to put some money in their tables to eat the green dollars like calf, in disregard of the millions of humans dying, if we are going to give any credit to the other subordinates of Bill Gates, that are the Johns Hopkins hospitals, also participant with the same software to count the worldwide victims, at "Event 201" of October 2019; so, their inflating the numbers of today, will be their indictment rigour of tomorrow. Here the two images that are crucial from the removed article by Baric:
23. Qu XX, et al. Identification of two critical amino acid residues of the severe acute respiratory syndrome coronavirus spike protein for its variation in zoonotic tropism transition via a double substitution strategy. The Journal of biological chemistry. 2005; 280:29588–29595.10.1074/jbc.M500662200 [PubMed: 15980414]: https://www.jbc.org/content/280/33/29588.full.pdf
These images show the tireless efforts to tweak the amino acids of the RBD (Receptor Binding Domain) of the Spike protein undertaken since 2005 in the laboratories: The positions of the paper 472, 479, 480, 487, correspond to the actual key places in the COVID-19 virus, as per the Andersen charade: 486, 493, 494 and 501, giving the final working version after 15 years of a daily tweaking of nucleotides to reach the best combination (and remember that Chinese work seven days a week): F-QS-N, for that particular region... you read the rest of the nuances and let me now, but this is good enough to give us the idea of the state-of-the-art of the molecular research since 2005 to be able by hand to modify specific amino acids in a discontinuous or discrete way without of the need of inserting codons from the viruses of Pangolins, as Andersen disingenuously wanted us to believe... making harder the puzzle of the engineering of the COVID-19 virus in a Laboratory at Wuhan, harder of what it really was to make it and to release it... but sooner or later these pieces of evidence will be presented in an international court of law to indict at the responsibles behind this deliberate pandemic caused by the release, accidental or on purpose, and one day soon this also will be known, of an artificial virus "DESIGNED" rather than "FOUND" in a Laboratory at Wuhan (with the NIH money of some of the ones that will also need be held accountable at that good day of indicting them all!!!)." So, ten thousand scientists very soon are going to be looking at my research to indict the responsible people that designed and released the COVID-19, but hen, so what? Is that really going to make a difference from the current situation? Is it going to stop, at least for now, while we are still here, the madness of Bill Gates of marking the whole of humanity with "The Mark of the Beast", are the sissy scientists reading my research going to do something at all??? I prefer a serious and knowledgeable man of law to take to the courts the responsible people of this planetary deliberately "engineered" tragedy...
ADDED:
16. Siegrist, C.-A. in Vaccines 6th edn. (eds. Plotkin, S.A., Orenstein, W.A. & Offit, P.A.) 14–32 (W.B. Saunders, 2013) [It belongs to Chapter 2: Vaccine immunology, written by Claire-Anne Siegrist]: https://www.who.int/immunization/documents/Elsevier_Vaccine_immunology.pdf
17. Deming, D. et al. Vaccine efficacy in senescent mice challenged with recombinant SARS-CoV bearing epidemic and zoonotic spike variants. PLoS Med. 3, e525 (2006): https://pubmed.ncbi.nlm.nih.gov/17194199/
While the next six ones have been removed from the final version:
REMOVED:
22. Sheahan T, Rockx B, Donaldson E, Corti D, Baric R. Pathways of cross-species transmission of synthetically reconstructed zoonotic severe acute respiratory syndrome coronavirus. Journal of virology. 2008; 82:8721–8732.10.1128/JVI.00818-08 [PubMed: 18579604]: https://jvi.asm.org/content/82/17/8721
23. Qu XX, et al. Identification of two critical amino acid residues of the severe acute respiratory syndrome coronavirus spike protein for its variation in zoonotic tropism transition via a double substitution strategy. The Journal of biological chemistry. 2005; 280:29588–29595.10.1074/jbc.M500662200 [PubMed: 15980414]: https://www.jbc.org/content/280/33/29588.full.pdf
24. Ren W, et al. Difference in receptor usage between severe acute respiratory syndrome (SARS) coronavirus and SARS-like coronavirus of bat origin. Journal of virology. 2008; 82:1899–1907.10.1128/JVI.01085-07 [PubMed: 18077725]: https://jvi.asm.org/content/82/4/1899
25. Sims AC, et al. Release of severe acute respiratory syndrome coronavirus nuclear import block enhances host transcription in human lung cells. Journal of virology. 2013; 87:3885–3902.10.1128/JVI.02520-12 [PubMed: 23365422]: https://jvi.asm.org/content/87/7/3885
26. Fulcher ML, Gabriel S, Burns KA, Yankaskas JR, Randell SH. Well-differentiated human airway epithelial cell cultures. Methods in molecular medicine. 2005; 107:183–206. [PubMed: 15492373]: https://www.med.unc.edu/marsicolunginstitute/files/2017/12/Book-Chapter.pdf
27. Roberts A, et al. A mouse-adapted SARS-coronavirus causes disease and mortality in BALB/c mice. PLoS pathogens. 2007; 3:e5.10.1371/journal.ppat.0030005 [PubMed: 17222058]: https://journals.plos.org/plospathogens/article?id=10.1371%2Fjournal.ppat.0030005
The Pathetic Patent of Baric on how to tweak the gene for the Spike protein of Coronavirus: https://patents.google.com/patent/WO2002086068A2
In the image we see that Baric lied to the media in 2020 saying that he had "FOUND" a deadly Coronavirus in 2015, and you can still see as for today that video of the interview of Baric, when he also deceptively hinted, because of all interviewed, he was the one that knew better, saying faking himself some "idiocy", that a flu was worst than the current COVID-19. So, he told the media that he had "FOUND" a deadly Coronavirus in 2015, when we all clearly know that he not did that, but he "DESIGNED" such deadly virus with similar effects than the COVID-19 of today, to the point that the headlines of the scientific journals of those times, were raising very serious ethical concerns, as can be seen in the other attached image, so that S.O.B. of Baric did not "FOUND" but "DESIGNED" a lethal virus in the company of the Wuhan Lab with Shi Zhengli-Li, as they put her there, dobling by mistake the "Li", and some other fella from China as well. I also attach here the clip of Bill Gates, ever present sponsor of this 2020 Pandemic, who, as per the three accounts that establish his guilt also presented here, he holds the Anti-Christic patent 060606 to insert a chip under the skin of humans (I do not care what "snopes" says, as it is just a counterfeit "debunker"): https://patentscope.wipo.int/search/en/detail.jsf?docId=WO2020060606, then as Robert Kennedy Jr., nephew of JFK, demonstrates in his Instagram account, the Bill and Melinda Gates Foundation sponsored a research published in "Science", precisely regarding the implant of a chip inside the skin: https://stm.sciencemag.org/content/11/523/eaay7162?rss=1&fbclid=IwAR2CJ1hlWlM61ZsnXe3glwJynOvqJD9fgf-EX6Q8LDybCoxZ0Czs2L5PVYI, in pursuit of his so loved "Digital Certificate" of vaccination, which video proof I am also annexing here, so as for Science to have the three minimal proofs to demonstrate the criminality of Bill Gates, who is faking that he is an MD, not being himself an MD, pushing down the throats of humanity a completely useless RNA vaccine, as I demonstrate in my postings here, from the fifth to the eight: https://www.researchgate.net/post/Fifth_Sequence_COVID-19_2_variants_ATG-246-TT_CA-111-TAA_TTA_L_L-Type_70_TCA_S_S-Type_30_in_position_28144_of_MN908947_for_ORF8_NifB And also: "One of the references removed by Baric clearly indicates that there was the technology to move by hand nucleotides to replace amino acids since the 2005, without any need of a spurious "Pangolin", so Andersen was playing the "idiot" when he ignored also that the technology to tweak particular nucleotides and amino acids in a laboratory was already there for a long time ago, so the "coverupers" of this COVID-19 having been designed in a Wuhan Laboratory are being very disingenuous about the whole Pandemic of 2020 because basically, they prefer to put some money in their tables to eat the green dollars like calf, in disregard of the millions of humans dying, if we are going to give any credit to the other subordinates of Bill Gates, that are the Johns Hopkins hospitals, also participant with the same software to count the worldwide victims, at "Event 201" of October 2019; so, their inflating the numbers of today, will be their indictment rigour of tomorrow. Here the two images that are crucial from the removed article by Baric:
23. Qu XX, et al. Identification of two critical amino acid residues of the severe acute respiratory syndrome coronavirus spike protein for its variation in zoonotic tropism transition via a double substitution strategy. The Journal of biological chemistry. 2005; 280:29588–29595.10.1074/jbc.M500662200 [PubMed: 15980414]: https://www.jbc.org/content/280/33/29588.full.pdf
These images show the tireless efforts to tweak the amino acids of the RBD (Receptor Binding Domain) of the Spike protein undertaken since 2005 in the laboratories: The positions of the paper 472, 479, 480, 487, correspond to the actual key places in the COVID-19 virus, as per the Andersen charade: 486, 493, 494 and 501, giving the final working version after 15 years of a daily tweaking of nucleotides to reach the best combination (and remember that Chinese work seven days a week): F-QS-N, for that particular region... you read the rest of the nuances and let me now, but this is good enough to give us the idea of the state-of-the-art of the molecular research since 2005 to be able by hand to modify specific amino acids in a discontinuous or discrete way without of the need of inserting codons from the viruses of Pangolins, as Andersen disingenuously wanted us to believe... making harder the puzzle of the engineering of the COVID-19 virus in a Laboratory at Wuhan, harder of what it really was to make it and to release it... but sooner or later these pieces of evidence will be presented in an international court of law to indict at the responsibles behind this deliberate pandemic caused by the release, accidental or on purpose, and one day soon this also will be known, of an artificial virus "DESIGNED" rather than "FOUND" in a Laboratory at Wuhan (with the NIH money of some of the ones that will also need be held accountable at that good day of indicting them all!!!)." So, ten thousand scientists very soon are going to be looking at my research to indict the responsible people that designed and released the COVID-19, but hen, so what? Is that really going to make a difference from the current situation? Is it going to stop, at least for now, while we are still here, the madness of Bill Gates of marking the whole of humanity with "The Mark of the Beast", are the sissy scientists reading my research going to do something at all??? I prefer a serious and knowledgeable man of law to take to the courts the responsible people of this planetary deliberately "engineered" tragedy...
Today my research was to demonstrate with 4 real examples of COVID-19 variation why the RNA Vaccines that Bill Gates is proposing are useless: "Explaining the reason why a RNA vaccine (or a flu vaccine) are basically of no use (better let your body fight, even if it takes longer, for the full recovery, that is how my Dad recovered from dying during six months with no vaccine and with no drug at all, of the Guillain Barré syndrome; here I may add for the elderly, the use of plasma medicine): Because the virus changes quickly, and the one of the vaccine is not necessarily the same around when the person gets "injected", examples:
1)
The fragment of COVID-19 in the RNA vaccine: ...UUA GCC AGC...
This fragment produces the peptide in the patient: ....L-A-S.....
The A here is for Arginine and this is a basic amino acid exposed to the protein.
2)
However, if the actual RNA fragment of COVID-19 airborne is: ...UUA GUC AGC...
This fragment produces the peptide in the victim: ....L-V-S.....
The V here, again, is for Valine and this one is an hydrophobic amino acid that hides inside the protein.
Indicating that the immune system will not protect you from the COVID-19 present in the environment as it produced antibodies for a different epitope with the shape of a mountain instead of a shape of an inner concavity such as a pool or a lake.
So, a vaccine made yesterday for the first peptide is completely useless for the real COVID-19 having the second peptide. Furthermore, if there is an older COVID-19 latent in the patient, for its asymptomatic character of for its recovery of a previous infection, the vaccine will be worst, as it will activate previously dormant COVID-19 viruses, increasing the damage, and will produce ADE (Antibody-dependent enhancement) for the virus or viruses.
Another example is:
1)
The fragment of COVID-19 in the RNA vaccine: ... CAG GAU GUU ...
This fragment produces the peptide in the patient: ....Q-D-V.....
The D here is for Aspartic acid and is hydrophilic, so it tends to be outside of the protein.
2)
However, if the actual RNA fragment of COVID-19 in the air is: ...CAG GGU GUU...
This fragment produces the peptide in the victim: ....Q-G-V.....
The G is for Glycine and is the smallest amino acid, so it is moved to the inside by the hydrophobic V for Valine.
One more example is:
1)
The fragment of COVID-19 in the RNA vaccine: ...CCA CCU ACC...
This fragment produces the peptide in the patient: ....P-P-T.....
The P here is for Proline and is the amino acid that bends the protein externally into an angular turn.
2)
However, if the actual RNA fragment of COVID-19 airborne is: ...CCA CUU ACC...
This fragment produces the peptide in the victim: ....P-L-T.....
The L here, again, is for Leucine and is an hydrophobic amino acid that hides inside the protein.
Indicating that the immune system will not protect you from the COVID-19 present in the environment as it produced antibodies for a different epitope with the shape of an angle instead of a shape of a concavity such as a pool or a lake.
And the first example that I put there (for you to find the exact positions of these changes, go to the links below):
1)
The fragment of COVID-19 in the RNA vaccine: ...UGU UUA CCU...
This fragment produces the from the vaccine peptide: ....C-L-P.....
The L is for Leucine and is hydrophobic, so it tends to be inside of the protein.
2)
The actual RNA fragment of COVID-19 in the air: ...UGU UCA CCU...
This fragment produces the peptide: ....C-S-P.....
The S is for Serine and is phosphorilatable, so it is outside of the protein awaiting the P element.
Indicating that the immune system will not protect you from the COVID-19 present in the environment as it produced antibodies for a different epitope with the shape of a mountain instead of a shape of a valley or even as a depression, such as in a lake.
Bill Gates , who is not a doctor or a politician, is the most visible face through this Pandemics, the organizer of the Pandemic event 201, owner of also a Microsoft factory in China, and who predicted a pandemic since 2015, year of the Baric paper in Nature Medicine describing his construct of a virus as deadly as the COVID-19, especially for the population of elderly mice (as per his supplement); so, such BIll Gates, wrote: "Pandemic I: The First Modern Pandemic" (threatening humanity that this is just the first one...): "With an RNA vaccine, rather than injecting fragments of the virus, you give the body the genetic code needed to produce lots of copies of these fragments. When the immune system sees the viral fragments, it learns how to attack them. An RNA vaccine essentially turns your body into its own vaccine manufacturing unit", before he explained the flu shot that is "fragments" of the virus, but for COVID-19, they pretend to use "an RNA" vaccine, and is intention is to: "The goal is to pick the one or two best vaccine constructs and vaccinate the entire world—that’s 7 billion doses if it is a single-dose vaccine, and 14 billion if it is a two-dose vaccine." A megalomaniac at its fullest?: https://www.gatesnotes.com/Health/Behind-the-Scenes-at-the-Vaccine-Summit; big quote taken from, with a creepy title over his HTML: "Pandemic-Innovation" (there, with starting Capitals): https://web.archive.org/web/20200424173902/https://www.gatesnotes.com/Health/Pandemic-Innovation, he is always "doubletalking" when he has to do with his earnest desire of "vaccination" for the Universe! (In the illustrations, one of the Kennedy family stands against Gates, and the video is the infamous and uncut video (not the same as the one with words from the photo displayed here, taken from YouTube and TedX, who only keep the censored version with the last, the damning part, removed: https://www.youtube.com/watch?v=yikPbbAKPlI) when Gates says that people needs to have a "digital" signature that has already received the vaccine, and that precisely, through the injection of a micro-chip going to the brain of the "patient" to comply with his submission under the G5 "Crowd Control", furthermore Microsoft owns the patent 060606, so as to buy or to sell, you will not need to use money but cryptocurrency through a chip in your body): https://patentscope.wipo.int/search/en/detail.jsf?docId=WO2020060606, coincidence with the prophecies of Revelation??? PRAY!!!
Here, the article funded by Bill Gates approaching "The Mark of the Beast":Article Biocompatible near-infrared quantum dots delivered to the sk..., and the response of Robert Kennedy Jr in his Instagram account: https://www.instagram.com/p/B_DwcZKF6yf
"The Bill and Melinda #GatesFoundation invested more than $21 million to perfect a “microneedle technology” that embeds, under the skin, a vaccination record visible by infrared light that can be read by a “minimally-adopted smartphone technology.” The technology will allow health officials to scan U.S. citizens to detect their vaccination compliance.
A study funded by the Bill and Melinda #Gates Foundation and published in December 2019 by researchers from MIT, the Institute of Chemistry of the Chinese Academy of Sciences, and the Gates-funded Intellectual Ventures Laboratory in Bellevue, WA, describes how “near-infrared quantum dots” will be implanted under the skin along with a vaccine to encode information for “decentralized data storage and bio-sensing.” Gates’ technology uses a tattoo-like mechanism to inject invisible nanoparticles subcutaneously. Gates’ researchers are now testing the implant with a vaccine against the #COVID-19 virus.
The Gates-funded report boasts that the chip system will allow “house-to-house” compliance searches to be conducted by government enforcement teams with “minimal training,” and will “open up new avenues for decentralized data storage and biosensing.” The #MIT paper is titled “Biocompatible near-infrared quantum dots delivered to the skin by microneedle patches to record vaccination.” Gates began funding implantable tracking chips and ratio biotechnology in 2011 with a grant to TransDerm Inc. Gates is currently making multiple investments to develop different versions, including grants to Vaxxas Pty Ltd, Micron Biomedical Inc, Georgia Institute of Technology, and Vaxess Technologies Inc.
I urge you to contact Bill Gates on his social media. Gently explain that tagging and tracking humans may appeal to his government cronies in totalitarian China, but those activities are inconsistent with American values and traditions.
1w" (Illustrated with the summit on vaccines of October, 2019, where you can see the total uncertainty and insecurity behind the current, filled with side effects, vaccination process then the infamous video of Bill Gates talking about reducing the population by 15 % to reduce the atmospheric pollution!!! Figure that out...)
https://www.researchgate.net/post/Sixth_Sequence_COVID-19_2_variants_ATG_132_GC_TC_1104_TAG_GCC_A_L-Type_70_GTC_V_S-Type_30_position_8782_of_MN908947_for_NSP4; https://www.researchgate.net/post/Seventh_Sequence_COVID-19_2_variants_ATG-1836-GA_GT-1977-TAA_GAT_D_L-Type_GGT_G_G-Type_in_position_23403_of_MN908947_Spike; https://www.researchgate.net/post/Eight_Sequence_COVID-19_2_variants_ATG-878-CC_TT-1729-TAG_CCT_P_L-Type_CTT_L_G-Type_in_position_14408_of_MN908947_for_NSP12; https://www.researchgate.net/post/Fifth_Sequence_COVID-19_2_variants_ATG-246-TT_CA-111-TAA_TTA_L_L-Type_70_TCA_S_S-Type_30_in_position_28144_of_MN908947_for_ORF8_NifB |
Today my research was to demonstrate with 4 real examples of COVID-19 variation why the RNA Vaccines that Bill Gates is proposing are useless: "Explaining the reason why a RNA vaccine (or a flu vaccine) are basically of no use (better let your body fight, even if it takes longer, for the full recovery, that is how my Dad recovered from dying during six months with no vaccine and with no drug at all, of the Guillain Barré syndrome; here I may add for the elderly, the use of plasma medicine): Because the virus changes quickly, and the one of the vaccine is not necessarily the same around when the person gets "injected", examples:
1)
The fragment of COVID-19 in the RNA vaccine: ...UUA GCC AGC...
This fragment produces the peptide in the patient: ....L-A-S.....
The A here is for Arginine and this is a basic amino acid exposed to the protein.
2)
However, if the actual RNA fragment of COVID-19 airborne is: ...UUA GUC AGC...
This fragment produces the peptide in the victim: ....L-V-S.....
The V here, again, is for Valine and this one is an hydrophobic amino acid that hides inside the protein.
Indicating that the immune system will not protect you from the COVID-19 present in the environment as it produced antibodies for a different epitope with the shape of a mountain instead of a shape of an inner concavity such as a pool or a lake.
So, a vaccine made yesterday for the first peptide is completely useless for the real COVID-19 having the second peptide. Furthermore, if there is an older COVID-19 latent in the patient, for its asymptomatic character of for its recovery of a previous infection, the vaccine will be worst, as it will activate previously dormant COVID-19 viruses, increasing the damage, and will produce ADE (Antibody-dependent enhancement) for the virus or viruses.
Another example is:
1)
The fragment of COVID-19 in the RNA vaccine: ... CAG GAU GUU ...
This fragment produces the peptide in the patient: ....Q-D-V.....
The D here is for Aspartic acid and is hydrophilic, so it tends to be outside of the protein.
2)
However, if the actual RNA fragment of COVID-19 in the air is: ...CAG GGU GUU...
This fragment produces the peptide in the victim: ....Q-G-V.....
The G is for Glycine and is the smallest amino acid, so it is moved to the inside by the hydrophobic V for Valine.
One more example is:
1)
The fragment of COVID-19 in the RNA vaccine: ...CCA CCU ACC...
This fragment produces the peptide in the patient: ....P-P-T.....
The P here is for Proline and is the amino acid that bends the protein externally into an angular turn.
2)
However, if the actual RNA fragment of COVID-19 airborne is: ...CCA CUU ACC...
This fragment produces the peptide in the victim: ....P-L-T.....
The L here, again, is for Leucine and is an hydrophobic amino acid that hides inside the protein.
Indicating that the immune system will not protect you from the COVID-19 present in the environment as it produced antibodies for a different epitope with the shape of an angle instead of a shape of a concavity such as a pool or a lake.
And the first example that I put there (for you to find the exact positions of these changes, go to the links below):
1)
The fragment of COVID-19 in the RNA vaccine: ...UGU UUA CCU...
This fragment produces the from the vaccine peptide: ....C-L-P.....
The L is for Leucine and is hydrophobic, so it tends to be inside of the protein.
2)
The actual RNA fragment of COVID-19 in the air: ...UGU UCA CCU...
This fragment produces the peptide: ....C-S-P.....
The S is for Serine and is phosphorilatable, so it is outside of the protein awaiting the P element.
Indicating that the immune system will not protect you from the COVID-19 present in the environment as it produced antibodies for a different epitope with the shape of a mountain instead of a shape of a valley or even as a depression, such as in a lake.
Bill Gates , who is not a doctor or a politician, is the most visible face through this Pandemics, the organizer of the Pandemic event 201, owner of also a Microsoft factory in China, and who predicted a pandemic since 2015, year of the Baric paper in Nature Medicine describing his construct of a virus as deadly as the COVID-19, especially for the population of elderly mice (as per his supplement); so, such BIll Gates, wrote: "Pandemic I: The First Modern Pandemic" (threatening humanity that this is just the first one...): "With an RNA vaccine, rather than injecting fragments of the virus, you give the body the genetic code needed to produce lots of copies of these fragments. When the immune system sees the viral fragments, it learns how to attack them. An RNA vaccine essentially turns your body into its own vaccine manufacturing unit", before he explained the flu shot that is "fragments" of the virus, but for COVID-19, they pretend to use "an RNA" vaccine, and is intention is to: "The goal is to pick the one or two best vaccine constructs and vaccinate the entire world—that’s 7 billion doses if it is a single-dose vaccine, and 14 billion if it is a two-dose vaccine." A megalomaniac at its fullest?: https://www.gatesnotes.com/Health/Behind-the-Scenes-at-the-Vaccine-Summit; big quote taken from, with a creepy title over his HTML: "Pandemic-Innovation" (there, with starting Capitals): https://web.archive.org/web/20200424173902/https://www.gatesnotes.com/Health/Pandemic-Innovation, he is always "doubletalking" when he has to do with his earnest desire of "vaccination" for the Universe! (In the illustrations, one of the Kennedy family stands against Gates, and the video is the infamous and uncut video (not the same as the one with words from the photo displayed here, taken from YouTube and TedX, who only keep the censored version with the last, the damning part, removed: https://www.youtube.com/watch?v=yikPbbAKPlI) when Gates says that people needs to have a "digital" signature that has already received the vaccine, and that precisely, through the injection of a micro-chip going to the brain of the "patient" to comply with his submission under the G5 "Crowd Control", furthermore Microsoft owns the patent 060606, so as to buy or to sell, you will not need to use money but cryptocurrency through a chip in your body): https://patentscope.wipo.int/search/en/detail.jsf?docId=WO2020060606, coincidence with the prophecies of Revelation??? PRAY!!!
Here, the article funded by Bill Gates approaching "The Mark of the Beast":Article Biocompatible near-infrared quantum dots delivered to the sk..., and the response of Robert Kennedy Jr in his Instagram account: https://www.instagram.com/p/B_DwcZKF6yf
"The Bill and Melinda #GatesFoundation invested more than $21 million to perfect a “microneedle technology” that embeds, under the skin, a vaccination record visible by infrared light that can be read by a “minimally-adopted smartphone technology.” The technology will allow health officials to scan U.S. citizens to detect their vaccination compliance.
A study funded by the Bill and Melinda #Gates Foundation and published in December 2019 by researchers from MIT, the Institute of Chemistry of the Chinese Academy of Sciences, and the Gates-funded Intellectual Ventures Laboratory in Bellevue, WA, describes how “near-infrared quantum dots” will be implanted under the skin along with a vaccine to encode information for “decentralized data storage and bio-sensing.” Gates’ technology uses a tattoo-like mechanism to inject invisible nanoparticles subcutaneously. Gates’ researchers are now testing the implant with a vaccine against the #COVID-19 virus.
The Gates-funded report boasts that the chip system will allow “house-to-house” compliance searches to be conducted by government enforcement teams with “minimal training,” and will “open up new avenues for decentralized data storage and biosensing.” The #MIT paper is titled “Biocompatible near-infrared quantum dots delivered to the skin by microneedle patches to record vaccination.” Gates began funding implantable tracking chips and ratio biotechnology in 2011 with a grant to TransDerm Inc. Gates is currently making multiple investments to develop different versions, including grants to Vaxxas Pty Ltd, Micron Biomedical Inc, Georgia Institute of Technology, and Vaxess Technologies Inc.
I urge you to contact Bill Gates on his social media. Gently explain that tagging and tracking humans may appeal to his government cronies in totalitarian China, but those activities are inconsistent with American values and traditions.
1w" (Illustrated with the summit on vaccines of October, 2019, where you can see the total uncertainty and insecurity behind the current, filled with side effects, vaccination process then the infamous video of Bill Gates talking about reducing the population by 15 % to reduce the atmospheric pollution!!! Figure that out...)
https://www.researchgate.net/post/Sixth_Sequence_COVID-19_2_variants_ATG_132_GC_TC_1104_TAG_GCC_A_L-Type_70_GTC_V_S-Type_30_position_8782_of_MN908947_for_NSP4; https://www.researchgate.net/post/Seventh_Sequence_COVID-19_2_variants_ATG-1836-GA_GT-1977-TAA_GAT_D_L-Type_GGT_G_G-Type_in_position_23403_of_MN908947_Spike; https://www.researchgate.net/post/Eight_Sequence_COVID-19_2_variants_ATG-878-CC_TT-1729-TAG_CCT_P_L-Type_CTT_L_G-Type_in_position_14408_of_MN908947_for_NSP12; https://www.researchgate.net/post/Fifth_Sequence_COVID-19_2_variants_ATG-246-TT_CA-111-TAA_TTA_L_L-Type_70_TCA_S_S-Type_30_in_position_28144_of_MN908947_for_ORF8_NifB
1)
The fragment of COVID-19 in the RNA vaccine: ...UUA GCC AGC...
This fragment produces the peptide in the patient: ....L-A-S.....
The A here is for Arginine and this is a basic amino acid exposed to the protein.
2)
However, if the actual RNA fragment of COVID-19 airborne is: ...UUA GUC AGC...
This fragment produces the peptide in the victim: ....L-V-S.....
The V here, again, is for Valine and this one is an hydrophobic amino acid that hides inside the protein.
Indicating that the immune system will not protect you from the COVID-19 present in the environment as it produced antibodies for a different epitope with the shape of a mountain instead of a shape of an inner concavity such as a pool or a lake.
So, a vaccine made yesterday for the first peptide is completely useless for the real COVID-19 having the second peptide. Furthermore, if there is an older COVID-19 latent in the patient, for its asymptomatic character of for its recovery of a previous infection, the vaccine will be worst, as it will activate previously dormant COVID-19 viruses, increasing the damage, and will produce ADE (Antibody-dependent enhancement) for the virus or viruses.
Another example is:
1)
The fragment of COVID-19 in the RNA vaccine: ... CAG GAU GUU ...
This fragment produces the peptide in the patient: ....Q-D-V.....
The D here is for Aspartic acid and is hydrophilic, so it tends to be outside of the protein.
2)
However, if the actual RNA fragment of COVID-19 in the air is: ...CAG GGU GUU...
This fragment produces the peptide in the victim: ....Q-G-V.....
The G is for Glycine and is the smallest amino acid, so it is moved to the inside by the hydrophobic V for Valine.
One more example is:
1)
The fragment of COVID-19 in the RNA vaccine: ...CCA CCU ACC...
This fragment produces the peptide in the patient: ....P-P-T.....
The P here is for Proline and is the amino acid that bends the protein externally into an angular turn.
2)
However, if the actual RNA fragment of COVID-19 airborne is: ...CCA CUU ACC...
This fragment produces the peptide in the victim: ....P-L-T.....
The L here, again, is for Leucine and is an hydrophobic amino acid that hides inside the protein.
Indicating that the immune system will not protect you from the COVID-19 present in the environment as it produced antibodies for a different epitope with the shape of an angle instead of a shape of a concavity such as a pool or a lake.
And the first example that I put there (for you to find the exact positions of these changes, go to the links below):
1)
The fragment of COVID-19 in the RNA vaccine: ...UGU UUA CCU...
This fragment produces the from the vaccine peptide: ....C-L-P.....
The L is for Leucine and is hydrophobic, so it tends to be inside of the protein.
2)
The actual RNA fragment of COVID-19 in the air: ...UGU UCA CCU...
This fragment produces the peptide: ....C-S-P.....
The S is for Serine and is phosphorilatable, so it is outside of the protein awaiting the P element.
Indicating that the immune system will not protect you from the COVID-19 present in the environment as it produced antibodies for a different epitope with the shape of a mountain instead of a shape of a valley or even as a depression, such as in a lake.
Bill Gates , who is not a doctor or a politician, is the most visible face through this Pandemics, the organizer of the Pandemic event 201, owner of also a Microsoft factory in China, and who predicted a pandemic since 2015, year of the Baric paper in Nature Medicine describing his construct of a virus as deadly as the COVID-19, especially for the population of elderly mice (as per his supplement); so, such BIll Gates, wrote: "Pandemic I: The First Modern Pandemic" (threatening humanity that this is just the first one...): "With an RNA vaccine, rather than injecting fragments of the virus, you give the body the genetic code needed to produce lots of copies of these fragments. When the immune system sees the viral fragments, it learns how to attack them. An RNA vaccine essentially turns your body into its own vaccine manufacturing unit", before he explained the flu shot that is "fragments" of the virus, but for COVID-19, they pretend to use "an RNA" vaccine, and is intention is to: "The goal is to pick the one or two best vaccine constructs and vaccinate the entire world—that’s 7 billion doses if it is a single-dose vaccine, and 14 billion if it is a two-dose vaccine." A megalomaniac at its fullest?: https://www.gatesnotes.com/Health/Behind-the-Scenes-at-the-Vaccine-Summit; big quote taken from, with a creepy title over his HTML: "Pandemic-Innovation" (there, with starting Capitals): https://web.archive.org/web/20200424173902/https://www.gatesnotes.com/Health/Pandemic-Innovation, he is always "doubletalking" when he has to do with his earnest desire of "vaccination" for the Universe! (In the illustrations, one of the Kennedy family stands against Gates, and the video is the infamous and uncut video (not the same as the one with words from the photo displayed here, taken from YouTube and TedX, who only keep the censored version with the last, the damning part, removed: https://www.youtube.com/watch?v=yikPbbAKPlI) when Gates says that people needs to have a "digital" signature that has already received the vaccine, and that precisely, through the injection of a micro-chip going to the brain of the "patient" to comply with his submission under the G5 "Crowd Control", furthermore Microsoft owns the patent 060606, so as to buy or to sell, you will not need to use money but cryptocurrency through a chip in your body): https://patentscope.wipo.int/search/en/detail.jsf?docId=WO2020060606, coincidence with the prophecies of Revelation??? PRAY!!!
Here, the article funded by Bill Gates approaching "The Mark of the Beast":Article Biocompatible near-infrared quantum dots delivered to the sk..., and the response of Robert Kennedy Jr in his Instagram account: https://www.instagram.com/p/B_DwcZKF6yf
"The Bill and Melinda #GatesFoundation invested more than $21 million to perfect a “microneedle technology” that embeds, under the skin, a vaccination record visible by infrared light that can be read by a “minimally-adopted smartphone technology.” The technology will allow health officials to scan U.S. citizens to detect their vaccination compliance.
A study funded by the Bill and Melinda #Gates Foundation and published in December 2019 by researchers from MIT, the Institute of Chemistry of the Chinese Academy of Sciences, and the Gates-funded Intellectual Ventures Laboratory in Bellevue, WA, describes how “near-infrared quantum dots” will be implanted under the skin along with a vaccine to encode information for “decentralized data storage and bio-sensing.” Gates’ technology uses a tattoo-like mechanism to inject invisible nanoparticles subcutaneously. Gates’ researchers are now testing the implant with a vaccine against the #COVID-19 virus.
The Gates-funded report boasts that the chip system will allow “house-to-house” compliance searches to be conducted by government enforcement teams with “minimal training,” and will “open up new avenues for decentralized data storage and biosensing.” The #MIT paper is titled “Biocompatible near-infrared quantum dots delivered to the skin by microneedle patches to record vaccination.” Gates began funding implantable tracking chips and ratio biotechnology in 2011 with a grant to TransDerm Inc. Gates is currently making multiple investments to develop different versions, including grants to Vaxxas Pty Ltd, Micron Biomedical Inc, Georgia Institute of Technology, and Vaxess Technologies Inc.
I urge you to contact Bill Gates on his social media. Gently explain that tagging and tracking humans may appeal to his government cronies in totalitarian China, but those activities are inconsistent with American values and traditions.
1w" (Illustrated with the summit on vaccines of October, 2019, where you can see the total uncertainty and insecurity behind the current, filled with side effects, vaccination process then the infamous video of Bill Gates talking about reducing the population by 15 % to reduce the atmospheric pollution!!! Figure that out...)
https://www.researchgate.net/post/Sixth_Sequence_COVID-19_2_variants_ATG_132_GC_TC_1104_TAG_GCC_A_L-Type_70_GTC_V_S-Type_30_position_8782_of_MN908947_for_NSP4; https://www.researchgate.net/post/Seventh_Sequence_COVID-19_2_variants_ATG-1836-GA_GT-1977-TAA_GAT_D_L-Type_GGT_G_G-Type_in_position_23403_of_MN908947_Spike; https://www.researchgate.net/post/Eight_Sequence_COVID-19_2_variants_ATG-878-CC_TT-1729-TAG_CCT_P_L-Type_CTT_L_G-Type_in_position_14408_of_MN908947_for_NSP12; https://www.researchgate.net/post/Fifth_Sequence_COVID-19_2_variants_ATG-246-TT_CA-111-TAA_TTA_L_L-Type_70_TCA_S_S-Type_30_in_position_28144_of_MN908947_for_ORF8_NifB
https://www.sundayguardianlive.com/news/corona-leaked-likely-wuhan-institute-virology-experts, our efforts, just by the grace divine are paying off, God, what is the next step to stop right now the madness of the ones that want to control completely the freedoms of the individuals???
Updated Apr 26, 2020, 8:41 AM
Fernando Castro-Chavez shared a memory.
10 Years Ago
Fernando Castro-Chavez added a new photo.
Apr 26, 2011, 6:40 PM
By the mouth of babes..." These pictures by Michael Lindsey touch my heart very hard, encouraging me to always do a better job for God. Here is my fast translation including that little one, Aaron, who witnessed me for salvation 24 years ago: http://fdocc.ucoz.com/living_letters.doc
Other days, other times of massive gatherings in India, God: we the body of Christ are The Restrainer, the Mystery of Iniquity can NOT and will NOT get away with its sinister plans while we are still here. So, at this crucial moment for us, give US the pleasure to crush under our feet all of those demons and their humans controlled by them over this good earth that is still ours!!! By the healing power of Christ in US permeating all over the earth, from China to America, from India to Europe, from Australia to Iceland, from Africa to the rest of Asia and the unnamed regions of our good earth.
Updated Apr 26, 2020, 7:24 AM
My posting of today at the ResearchGate is this one (I keep on updating it as "I see" (Christ in me) more things, so I added there right now: "Update: Showing that the real deal here is what is not said or emphasized in the paper itself (here in the red rectangle), and this is that the beginning of the real infectivity, which means the proper fusion of the virion to the human cells, is located precisely at the left side of the RBD of the Spike protein (also modified by hand by Shi Zhengli: https://www.researchgate.net/post/Fourth_Sequence_COVID-19_TTG_90_TTT_18_CAATCA_18_AAT_9_TAC_L_F_QS_N_Y_Viral_Pangolin_Insert_with_Receptor_Binding_Domain_RBD_in_a_Virus_of_Bat, and that will take away the "paradox" of the viral pangolin, that at this height of this globalistic "game", seems to be just a distraction), exactly in the position that we have found the HIV-1 (call it if you feel more comfortable: HIV-1-Like, Hehee) epitope traces of the HIV Env protein: NGTKR, and some researchers say that those motifs are even longer, such as Jean-Claude Perez, acquaintance of Luc Montagnier, who told us (Luc) in 1996 that the smallest functional epitopes of the HIV-1 were at that time not yet know, but this article is from the 2008!, and at the right side (in blue, is where the Furin cleavage site, an outlier 80% GC rich of "unknown" procedance in the COVID-19, other than it being really synthetic, which will end with the "fabricated mystery", of which nobody wants to talk about, is located as such: CCTCGGCGGGCACGT = PRRAR: https://www.researchgate.net/post/COVID-19_CCTCGGCGGGCACGT_PRRAR_AA_Furin_cleavage_site_at_23603-23617_of_the_MN908947_Genbank_Genome_Matches_Mostly_Bacteria_COVID-19_in_BLAST)): "Another image that sows clearly that since 2008 ( https://jvi.asm.org/content/82/4/1899) there was the knowledge to insert a RBD (receptor Binding Domain) including its RBM (receptor Binding Motif) to allow the Spike protein of COVID-19 to tightly bind to the human ACE2, as a matter of fact, as we see in the Spike of COVID-19, in that year Shi Zhengli had already replaced with an optimal RBD from a human Sars virus, in their own words: "Both the BJ01-S and Rp3-S genes were efficiently expressed in transfected 293T cells, and the expressed S proteins were incorporated into the respective pseudoviruses as expected... the pseudovirus packaged with a CS (chimeric S ) protein, HIV/CS14-608, displayed a level of luciferase activity similar to that of HIV/BJ01-S... the coding region from aa 424 to 494 of BJ01-S was used to replace the corresponding regions of Rp3-S, resulting in a chimeric S (CS) gene... BJ01-S: a codon-optimized spike (S) protein gene of SARS-CoV BJ01 in pcDNA3.1... A 193-residue fragment (amino acids [aa] 318 to 510) in the SARS-CoV S protein was demonstrated to be the minimal receptor-binding domain (RBD) which alone was able to efficiently bind to ACE2 (references 1, 42a, 45). Furthermore, it was shown that minor changes in amino acid residues of the receptor-binding motif (RBM) of SARS-CoV S (my note: obviously those changes can improve or made worse the binding ability, not only the last, which was the written option of Shi, just because, as to deceive...)... when the RBD of SL-CoV S was replaced with that from the SARS-CoV... S, the hybrid S protein was able to use the huACE2 for cell entry". So, since 2008 and earlier at Wuhan, Shi Zhengli was tweaking the nucleotides of the key amino acids of the RBD within Spike, and then the best tweaked sequence of the moment, the BJ01-S (also written as BJ-01-S), was the one that was inserted (in every possible length to see which one was the one working the best) INTO the backbone of a bat virus, exactly as we see it in COVID-19. Now the habitual "damage control" deceivers say that "we did not have the knowledge to have done the COVID-19 in a lab" is full and sheer bullshit, an oxen dung courtesy of Osterholm, Daszak, Baric, Zhengli herself, and even, sadly for me, Francis Collins, among many others that do not even care to track the origin because of their particular interests such as the WHO and Bill Gates, who keeps on buying actions within the pharmaceutical companies; so, it seems that his foundation gives some for free, with the tail to expect profit even more than what he gives for free, with his personal, and the personal interests of his handlers... The figure is Figure 7 of the linked article, for you to dig deeper into it and keep on searching to bring the masterminds, or at least their scapegoats, down, so as to stop once and for all this planetary madness under the control of a set of a few perverts from humanity..." Ah!, their "monster" includes: TPA, signal peptide from tissue plasminogen activator; TM, transmembrane domain derived from the fusion protein of Sendai virus; bat SL-CoV S (Rp3-S) and (RBD already modified) human SARS-CoV S protein (BJ01-S). The open box indicates the location of the RBM (also already modified by the human hands in the lab, Receptor Binding Motif; remembering that such RBM is not the one that infects but the one that properly attaches the virus to the human receptor ACE2, reason why the infectivity starts only with longer sequences, the ones that allow the fusion of the virus with the cells of the human lungs).
As per my research of today: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031, COVID-19 in its first version, had been already designed by Shi Zhengli at Wuhan since 2008: "Basically, the COVID-19 in its previous version, before of the insertion, also done in the lab of Zhengli of the Furin Cleavage site: CCTCGGCGGGCACGT = PRRAR, according to one article by Zhengli that was a 2015 reference explaining the contents of the plasmids with the modified genes of the Spike protein, reference removed by Baric in the final version of their pervert 2015 Nature Medicine article, the preprint of Baric:
The "POSE THREAT" version (the manuscript of Baric at the UNC): https://web.archive.org/web/20200221233549/https://www.med.unc.edu/orfeome/files/2018/03/a-sars-like-cluster-of-circulating-bat-coronaviruses-shows-potential-for-human-emergence.pdf
Removed reference that links HIV to COVID-19
24. Ren W, et al. Difference in receptor usage between severe acute respiratory syndrome (SARS) coronavirus and SARS-like coronavirus of bat origin. Journal of virology. 2008; 82:1899–1907.10.1128/JVI.01085-07 [PubMed: 18077725]: https://jvi.asm.org/content/82/4/1899
(And, remember that this article of 2008 is before the 2018 submission of two sequences by Chinese virologists already containing supposed traces of HIV-like smaill epitopes presented above: MG772933 and MG772934, and before the 2020 submission of the RaTG13: MN996532).
1) Backbone of a Bat: Rp3-S.
2) Modified codons for the RBD (Receptor Binding Domain) of Spike: BJ01-S.
3) HIV pseudovirus with the modified gene for Spike: CS14-608.
4) Human Cells with ACE2 Receptor: HeLa, and 293T.
The twisted "SHOWS POTENTIAL" final version lacks of this crucial article by Shi Zhengli, manufacturer of the COVID-19 at the Wuhan lab, but the article as appeared at "Nature" ("Antinature" in this case of COVID-19 I may say), lacks of this reference, even when it still credits at the end the Spike protein and the plasmids to the Wuhan of Zhengli: https://www.nature.com/articles/nm.3985
You can further explore, for the impending indictment of Shi Zhengli, the link of her words HIV and SARS within her publications: https://scholar.google.com/scholar?hl=en&as_sdt=0%2C5&q=Zhengli+HIV+SARS&btnG"
The "POSE THREAT" version (the manuscript of Baric at the UNC): https://web.archive.org/web/20200221233549/https://www.med.unc.edu/orfeome/files/2018/03/a-sars-like-cluster-of-circulating-bat-coronaviruses-shows-potential-for-human-emergence.pdf
Removed reference that links HIV to COVID-19
24. Ren W, et al. Difference in receptor usage between severe acute respiratory syndrome (SARS) coronavirus and SARS-like coronavirus of bat origin. Journal of virology. 2008; 82:1899–1907.10.1128/JVI.01085-07 [PubMed: 18077725]: https://jvi.asm.org/content/82/4/1899
(And, remember that this article of 2008 is before the 2018 submission of two sequences by Chinese virologists already containing supposed traces of HIV-like smaill epitopes presented above: MG772933 and MG772934, and before the 2020 submission of the RaTG13: MN996532).
1) Backbone of a Bat: Rp3-S.
2) Modified codons for the RBD (Receptor Binding Domain) of Spike: BJ01-S.
3) HIV pseudovirus with the modified gene for Spike: CS14-608.
4) Human Cells with ACE2 Receptor: HeLa, and 293T.
The twisted "SHOWS POTENTIAL" final version lacks of this crucial article by Shi Zhengli, manufacturer of the COVID-19 at the Wuhan lab, but the article as appeared at "Nature" ("Antinature" in this case of COVID-19 I may say), lacks of this reference, even when it still credits at the end the Spike protein and the plasmids to the Wuhan of Zhengli: https://www.nature.com/articles/nm.3985
You can further explore, for the impending indictment of Shi Zhengli, the link of her words HIV and SARS within her publications: https://scholar.google.com/scholar?hl=en&as_sdt=0%2C5&q=Zhengli+HIV+SARS&btnG"
Libertad total en este planeta tierra del que podemos disfrutar gratuitamente, salir a los campos y en ellos correr, Dios nos los ha dado!
Updated Apr 23, 2020, 7:11 PM
Updated Apr 23, 2020, 7:09 PM
Planet earth and all its beauty is ours for free, thank you God for all the things that we have for free to enjoy and to explore it all in total Liberty!
Updated Apr 23, 2020, 7:09 PM
And one more researcher with boldness to realize that such COVID-19 is a fabrication of a human laboratory, he searched exclusively under "patented" sequences and he realized that more than 2319 sequences of those contain the added sequence to the virus: CCTCGGCGGGCACGT = PRRAR : Furin Cleavage necessary to penetrate the human cells. So, when the "Damage Control" liars say that it was not possibly made by humans, we have the proof that very easily it could have been made by humans, profit of finding out this: For this not to be repeated again, as everybody could be tracking the falsehood of the sequences, and to expose the ones that did it this time... The name of many of those sequences?: "MODIFIED POLYNUCLEOTIDES FOR THE PRODUCTION OF PROTEINS" Ah!, and also this one that was also significant to him because that is exactly what it seems to be doing the current pandemic virus over the immune system, which means that it inhibits the immune system of the victims: "METHODS FOR ENHANCING IMMUNE CHECKPOINT BLOCKADE THERAPY BY MODULATING THE MICROBIOME"... @ https://www.researchgate.net/post/COVID-19_CCTCGGCGGGCACGT_PRRAR_AA_Furin_cleavage_site_at_23603-23617_of_the_MN908947_Genbank_Genome_Matches_Mostly_Bacteria_COVID-19_in_BLAST, and this is one of the other multiple sequences artificially inserted in the backbone of a virus from a bat, such as the virus from pangolin ones for the Receptor Binding Domain, and the multiple short epitopes from the HIV to fuse to the cells, even to the immune cells!!! Oh Criminals!!!
Another researcher with guts, exposing the lies, demonstrating that COVID-19 very well can be and could be engineered in a laboratory: https://www.youtube.com/watch?v=zIW3TQpVJYs and (see in comment below) For the busy mind, the Abstract of his full dissertation starts at minute 19:03 to the end:
Updated Apr 23, 2020, 1:07 PM
The song that took me years to figure out the name and the original singers (which also are the composers), one of the thousands of songs that include the word "waiting" in their lyrics, now that we claim for justice from our dens... in another kind of waiting within our soul... Christ COME!!!: https://www.youtube.com/watch?v=wqCpjFMvz-k
Updated Apr 22, 2020, 9:38 PM
The criminal patent that describes how to design viruses such as the COVID-19 and other lethal viruses from the past: https://patents.google.com/patent/WO2002086068A2/ru
Updated Apr 22, 2020, 8:17 PM
Update: And as the virus is a RNA virus, it is constantly changing, so the test kits are as unreliable as any possible "vaccine" (How do yo know if you got it without the need of a "stupid" kit. You lose your sense of smell... and if the kit and the evil vaccine ever gets "mandatory", well, you speak in tongues, you ask for the protection of God, ...and (grrrr....) comply, what else can you do (unless God inspires something different)? Jesus said that "no venom will prevail against us", and our Dad God said earlier that: "no weapon will prevail against us", sooo?): From an actual kit to detect "Coronavirus 19" instructive approved by the FDA, provided by the CDC (and remember that the Centers for Disease Control and Prevention Principal Deputy Director Anne Schuchat, a Jew), regarding the unreliability of those deceptive tests: "This tests can not rule out diseases caused by other bacteria or viral pathogens". Which basically means that this year, by decree, any kind of infection is going to be attributed to Coronavirus 19 (I mean, Johns Hopkins is the one controlling the worldwide "numbers" of the supposed victims, and controversial methods are being used to inflate the numbers, and that is the same one that organized the drills of a pandemic, promoting the very same scenario that we are living right now, since August 21, 2019, together with Bill Gates and the World Economic Forum (and basically they are the sames that are controlling the "discourse" over all this situation): https://www.centerforhealthsecurity.org/event201/media, starting to enact all of this deliberately since October 15, 2019, does that ring a bell?): https://web.archive.org/web/20200418065800/https://www.fda.gov/media/134922/download, only God can inspire His own how to deal with the full pack of deception going on. An honest doctor can say: RNA viruses, such as COVID-19 and Hepatitis-C, have no possibility to have a vaccine because they are constantly changing, and the vaccine of this day is completely useless for the changed strain of the next day (even if Dr, Sangay Gupta flat-faced or laughing in CNN says that this virus "does not" change (that is a lie) and that "very soon" we will have a "vaccine" against COVID-19, we will have? No, I do not need and I do not want a vaccine against my will, just keep, just in case you have some concerns, just keep your nose rubbed with some "trapping microorganisms" substance like a vick vaporub when you are in a "multitude-environment", which does not exist for now anymore, and keep your mouth closed in the public places, or, even better eat in those moments something that makes you to produce saliva, hence, enzymes, for me a bittersweet candy or an awesome Kiamoy does that task (and put some saliva of yourself within your nostrils, if you can endure its smell, Hehee, but that is the strongest antiseptic given by GOD to us)!!! The scientific evidence that saliva kills any kind of virus with its powerful enzymes is that it destroys the HIV: https://pubmed.ncbi.nlm.nih.gov/9989543, and we know that COVID-19 has the four entry epitopes that are the same ones that HIV has).
The hidden hand under the table of the current COVID-19 pandemic: Jewish Charles Lieber, co-founder of the bio-tech firm Nanosys, which is affiliated with the "Hebrew University" in Jerusalem: https://en.wikipedia.org/wiki/Nanosys#Founders,_funding,_and_patents, Lieber is still involved in the global bioweapons smuggling ring. In late January 2020, FBI agents arrested him, chairman of Harvard’s Department of Chemistry and Chemical Biology. He was “charged with lying about his role in a Chinese talent recruitment program” and then was released from custody on January 30, but only after posting a $1 million cash bond: https://www.nbcboston.com/news/local/harvard-professor-charged-with-hiding-china-ties-due-in-court/2069587/ (Buying thus the silence of everybody with money soaked in blood) According to the Boston Globe, Lieber “lied about his links to the Wuhan Institute of Virology”: http://archive.is/QIBmE after China paid him hundreds of thousands of dollars to arrange not only for smuggling bioweapons but hiring the smugglers. According to the indictment, “Prosecutors say Lieber agreed to conduct research, publish articles and apply for patents on behalf of China’s Wuhan University of Technology in exchange for $50,000 per month and about $150,000 in living expenses. He also received $1.5 million to establish a research lab at the Chinese university... Authorities say Lieber hid his involvement in the program from Harvard and told federal investigators in 2018 that he had never been asked to participate in the program”: https://www.youtube.com/watch?v=tz1NsAQDto0, https://www.youtube.com/watch?v=zojMwv7LjT8, https://www.youtube.com/watch?v=4JxM7lauNj8, https://www.youtube.com/watch?v=pgAUwb0zpLg, https://www.youtube.com/watch?v=bcEVIyMLUiM, furthermore the "Beth Israel Deaconess Medical Center" had within its ranks another smuggler, Zaosong Zheng, accused of stealing vials of biological materials: https://boston.cbslocal.com/2020/03/07/zaosong-zheng-beth-israel-deaconess-medical-center-charged-research-smuggling-china-freed-on-bond, also freed by his handlers by a $100,000.00 bond, their third one associate being the woman Yanqing Ye, coordinately stealing biological sources from the Boston University: https://www.fbi.gov/wanted/counterintelligence/yanqing-ye, etc., etc..., talking about the handlers of the cords behind the scenes... but we know that for now, they will fail in their final goals once again as we have within The Restrainer: Christ in us through the holy spirit of God!!!
Updated Apr 21, 2020, 9:15 AM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Apr 21, 2015, 3:21 PM
This is the third audible voice of God written during the full Ministry of Jesus Christ, here God said, the very day that the Lamb of the Sacrifice was chosen (10th of Nisan or 24th of April, 28 A.D. in our Calendar), the next words: “I have glorified and will glorify again”, talking about His Name; with these words God was choosing Jesus Christ as His Lamb for that year, and forever! As we read in revelation (Rev. 5:6, etc…)
The third audible communication of God with His Beloved Son was in a way that all the people that was around him was able to hear, an even most compelling way for the willing ones to believe in him and in the tremendous sacrifice that he will be undertaking briefly after that statement of God, who assured to Him the guarantee of His promise to Glorify His Word, which in this case was His promise to His son of the impending resurrection after all the sufferings ahead, all the mental torture and the physical beatings to the point of shedding all of his blood out of his love for us, and then his death, but with the long announced since the past prophecy that NO bone of him will be ever broken!!! And today we are his body, no member of that body will be broken... Thank You God for Your Unfathomable revelation for us, and for us to hear Your voice that You will be sure to let us hear and know in its due time as you did for Your son Jesus, our savior and Confidant during these precarious days.
Updated Apr 21, 2020, 7:31 AM
Updated Apr 20, 2020, 9:29 PM
Updated Apr 20, 2020, 9:29 PM
Updated Apr 20, 2020, 9:29 PM
Updated Apr 20, 2020, 9:29 PM
Basically, behavior says a lot: If all of those virus laboratories at Wuhan, China were with no guilt, those were the first ones at the forefront of the attempt on solving the pandemic: https://www.youtube.com/watch?v=KhYpt69XTWE; but, on the other hand, if they are the guilty ones, their behaviour will be as it has been until now: silence, as when a dog has its tail under its rear legs, this great documentary is the first one attempting to put together some of the pieces, especially in regards to the researchers behind the design of COVID-19, first and foremost, Shi Zheng-Li, the co-author of Baric of that damning 2015 article with that modified Spike protein that she brought from Wuhan, China to do the experiments producing symptoms in mice exactly as the ones we see now in humans, and were she describes her success to already start infecting human cells! In the photo, Shi Zheng-Li is giving a cynical conference in China about her "Studies on Bat Coronavirus and its Cross Species Infection" (Notice her mistake on putting it's as in "it is", when it should have been only: "its", oh well, who cares about her as a responsible criminal, right? Wrong!: http://chng.it/bQjkbTcnb2).
Another bold researcher added a comment to my observations (God, thank you!!! Finally bold heros!!!): Tom Wenseleers added a reply, 1 hour ago:
"Also noticed that if you BLAST the insertion CCTCGGCGGGCACGT but restrict the taxa to viruses only then aside from SARS-CoV2 you only get hits in:
https://www.ncbi.nlm.nih.gov/nucleotide/MT114163.1?report=genbank&log%24=nucltop&blast_rank=42&RID=9VMB4MWB014 (Mycobacterium phage Settecandela), https://www.ncbi.nlm.nih.gov/nucleotide/MN729215.1?report=genbank&log%24=nuclalign&blast_rank=32&RID=9TJE3FZA014 (Atypical porcine pestivirus), and
https://www.ncbi.nlm.nih.gov/nucleotide/MN331655.1?report=genbank&log%24=nucltop&blast_rank=43&RID=9VMB4MWB014 (Parapoxvirus, Orf virus strain CL17)
Does any of this ring a bell to you?
Re. the RBD, could the AA similarity to non-bat coronaviruses, e.g. from pangolin, be the result of selection during serial passage in such animals? I saw that several papers suggest reassortment / recombination as the likely explanation of that, but was just wondering if there are alternative possibilities?" ANd my humble response: "WOW! That is interesting, I am just seeing that the Parapoxvirus brings us back to Jenner and to the discovery of vaccination before or without the need of that "Big Pharma", as it says that infects: "ungulates (like cows, sheep, goats, etc.) and cause the human occupational diseases of orf and milker's nodes". Then one from a virus in pigs and one from a phage of bacteria, and then that again brings us to the possibility of the methodological artifacts that nobody in the scientific community liked, that costed me one job and that only until I got to be independent I was able to publish, please take a critical look at it, as in this case it may be a related case with that (non-conventional molecular tools were used:) phage!: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3272245" (Bless his Soul!!!).
"Also noticed that if you BLAST the insertion CCTCGGCGGGCACGT but restrict the taxa to viruses only then aside from SARS-CoV2 you only get hits in:
https://www.ncbi.nlm.nih.gov/nucleotide/MT114163.1?report=genbank&log%24=nucltop&blast_rank=42&RID=9VMB4MWB014 (Mycobacterium phage Settecandela), https://www.ncbi.nlm.nih.gov/nucleotide/MN729215.1?report=genbank&log%24=nuclalign&blast_rank=32&RID=9TJE3FZA014 (Atypical porcine pestivirus), and
https://www.ncbi.nlm.nih.gov/nucleotide/MN331655.1?report=genbank&log%24=nucltop&blast_rank=43&RID=9VMB4MWB014 (Parapoxvirus, Orf virus strain CL17)
Does any of this ring a bell to you?
Re. the RBD, could the AA similarity to non-bat coronaviruses, e.g. from pangolin, be the result of selection during serial passage in such animals? I saw that several papers suggest reassortment / recombination as the likely explanation of that, but was just wondering if there are alternative possibilities?" ANd my humble response: "WOW! That is interesting, I am just seeing that the Parapoxvirus brings us back to Jenner and to the discovery of vaccination before or without the need of that "Big Pharma", as it says that infects: "ungulates (like cows, sheep, goats, etc.) and cause the human occupational diseases of orf and milker's nodes". Then one from a virus in pigs and one from a phage of bacteria, and then that again brings us to the possibility of the methodological artifacts that nobody in the scientific community liked, that costed me one job and that only until I got to be independent I was able to publish, please take a critical look at it, as in this case it may be a related case with that (non-conventional molecular tools were used:) phage!: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3272245" (Bless his Soul!!!).
Updated Apr 20, 2020, 1:09 PM
A clever mind (protecting identities here as per PMs) wrote to me: "Fernando,
Thanks for your discussion on Research Gate:
https://www.researchgate.net/post/Fourth_Sequence_COVID-19_TTG_90_TTT_18_CAATCA_18_AAT_9_TAC_L_F_QS_N_Y_Viral_Pangolin_Insert_with_Receptor_Binding_Domain_RBD_in_a_Virus_of_Bat,
https://www.researchgate.net/post/COVID-19_CCTCGGCGGGCACGT_PRRAR_AA_Furin_cleavage_site_at_23603-23617_of_the_MN908947_Genbank_Genome_Matches_Mostly_Bacteria_COVID-19_in_BLAST
I've been wondering why it seems no virologists are performing this type of probability analysis. Ralph Baric at UNC should be willing to explain the hypothesis on the possible lab release of a chimeric bat/pangolin betacoronavirus at WIV."
To him, and to all of you who wonder, I respond:
"It is very disappointing to me that even Francis Collins swallowed the Darwinian ideas of a natural random evolution without an intelligent agent, and once more that erroneous ideology is helping to cover-up the real culprits. So, it seems that thus far they are succeeding on deceiving a godless and gullible scientific establishment that only cares about themselves and about their bellies. Your words are very encouraging and motivational to the point of doubling our efforts. Thank You!!!"
Thanks for your discussion on Research Gate:
https://www.researchgate.net/post/Fourth_Sequence_COVID-19_TTG_90_TTT_18_CAATCA_18_AAT_9_TAC_L_F_QS_N_Y_Viral_Pangolin_Insert_with_Receptor_Binding_Domain_RBD_in_a_Virus_of_Bat,
https://www.researchgate.net/post/COVID-19_CCTCGGCGGGCACGT_PRRAR_AA_Furin_cleavage_site_at_23603-23617_of_the_MN908947_Genbank_Genome_Matches_Mostly_Bacteria_COVID-19_in_BLAST
I've been wondering why it seems no virologists are performing this type of probability analysis. Ralph Baric at UNC should be willing to explain the hypothesis on the possible lab release of a chimeric bat/pangolin betacoronavirus at WIV."
To him, and to all of you who wonder, I respond:
"It is very disappointing to me that even Francis Collins swallowed the Darwinian ideas of a natural random evolution without an intelligent agent, and once more that erroneous ideology is helping to cover-up the real culprits. So, it seems that thus far they are succeeding on deceiving a godless and gullible scientific establishment that only cares about themselves and about their bellies. Your words are very encouraging and motivational to the point of doubling our efforts. Thank You!!!"
Updated Apr 20, 2020, 8:16 AM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Apr 20, 2015, 6:54 AM
The second Audible voice of God to His son was a the Mount of Transfiguration (Mount Hermon), on the Day of Atonement (Tishri 10) of 27 A.D., the only day in the year when the High Priest entered into the Most Holy Place of the Temple! Peter, James and John were the witnesses here, when God Elected Jesus as 'The High Priest'!
The Second time that God spoke audibly to His son Jesus, with the closest three present: Peter, who was Simon, John and his brother James which was Jacob, sons of Thunder (Boanerges). Listen to Jesus, the voice of God reminded them and still reminds us: Listen TO the DIRECT revelation of the Christ Jesus to the each one of you to survive on this and in any other personal situation of the future!!!
Updated Apr 20, 2020, 7:20 AM
One more recent, again from China: https://www.scmp.com/news/china/society/article/3079443/coronavirus-could-target-immune-system-targeting-protective
Updated Apr 19, 2020, 8:31 PM
La belleza de la libertad que Dios nos ha dado en todo momento se aprecia en el flujo natural de este cuerpo de agua, que sus sonidos nos den ese sentir de reposo y de paz que solamente Dios nos puede dar:
Updated Apr 19, 2020, 12:29 PM
Updated Apr 19, 2020, 12:29 PM
Updated Apr 19, 2020, 12:28 PM
Updated Apr 19, 2020, 12:28 PM
Updated Apr 19, 2020, 12:28 PM
Key articles ignored by the Main Deceptive Media, Chinese researchers themselves are saying way far earlier the same thing that French Nobel Prize of 2008 winner Luc Montagnier (due to his discovery of the HIV), my finding until today these articles only demonstrates that the Mass Media as a matter of fact is involved to the top on hiding information already known in order for the problem of the pandemic to continue unscathed until the "fulfillment" of what it is pretended by the assassin "globalists", whomever they may be (but thank GOD we Christians are here to stop and to frustrate, which is to RESTRAIN, just as it has been prophesied, once MORE the perverse plans of the "Mystery of Iniquity"):
https://metro.co.uk/2020/02/27/coronavirus-hiv-like-mutation-helps-attack-human-cells-scientists-claim-12314129/
https://freewestmedia.com/2020/02/27/chinese-scientists-discover-hiv-like-feature-in-cornovirus-mutation/
https://www.scmp.com/news/china/society/article/3052495/coronavirus-far-more-likely-sars-bond-human-cells-scientists-say
https://www.zerohedge.com/geopolitical/did-china-steal-coronavirus-canada-and-weaponize-it
https://www.asianwarrior.com/2020/03/chinas-wuhan-coronavirus-a-black-swan.html
http://chinaxiv.org/abs/202002.00004
http://chinaxiv.org/abs/202002.00062
https://metro.co.uk/2020/02/27/coronavirus-hiv-like-mutation-helps-attack-human-cells-scientists-claim-12314129/
https://freewestmedia.com/2020/02/27/chinese-scientists-discover-hiv-like-feature-in-cornovirus-mutation/
https://www.scmp.com/news/china/society/article/3052495/coronavirus-far-more-likely-sars-bond-human-cells-scientists-say
https://www.zerohedge.com/geopolitical/did-china-steal-coronavirus-canada-and-weaponize-it
https://www.asianwarrior.com/2020/03/chinas-wuhan-coronavirus-a-black-swan.html
http://chinaxiv.org/abs/202002.00004
http://chinaxiv.org/abs/202002.00062
Updated Apr 19, 2020, 9:17 AM
Libertad, Libertad, Libertad!!!
Updated Apr 18, 2020, 11:54 AM
Updated Apr 18, 2020, 11:53 AM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Apr 18, 2015, 11:10 PM
Yes, I believe in God’s prophecies! Of all the time that Jesus and his Dad God talked during the 70-week Ministry of Jesus, as prophesied by Daniel, it is amazing that only three times it was audibly heard the actual voice of God! The first time was when he was baptized by his older cousin John; at this time, God was Anointing Jesus to be ‘The Apostle’!
Revisiting the three times that God communicated audibly to Jesus registered in Scripture: At his appointment as The Apostle in river Jordan, at his appointment as a Melchizedequian High Priest on mount Hermon at Damascus, and at his appointment as the Lamb of God at Jerusalem!!!
Updated Apr 18, 2020, 7:52 AM
Updated Apr 18, 2020, 7:43 AM
Updated Apr 18, 2020, 7:43 AM
Updated Apr 18, 2020, 7:43 AM
Updated Apr 18, 2020, 7:43 AM
Bellos recuerdos del pasado, cuando aún las masas se podían reunir, muchas gracias a la Casa del Arte CUSur, a Vicente Preciado y a sus directivas, por las bellas memorias de aquel Centenario del 2018!!!:
Updated Apr 17, 2020, 10:14 PM
And, I almost forgot, but the girl that I really like, and that is very far from me right now, reminded me of the passing of Bill Withers, who composed pieces such as the great "Lean on Me" (which is what I am really begging her to do for life!!!): https://www.youtube.com/watch?v=Io6HwRadjU4
Updated Apr 17, 2020, 8:42 PM
From my ResearchGate study into the artificial origins of the COVID-19, Dr. Andrew Paul McKenzie Pegman, 8 hours ago said: "We need to see the sequence of coronavirus directly from bats or research facilities, because pangolin may not even be involved" To whom I responded as follows: "Yes!, however, the closest one, the Bat RaTG13, had been in the power of the Chinese researchers since 2013 and was just released recently (in Jan. 23, 2020, "fished out of a bat fecal sample they collected in 2013 from a cave in Moglang in Yunnan province", said Daszak, their then collaborator) by the Wuhan Lab. So, how many other sequences are they hiding or even destroyed depicting their steps on modifying the sequences until their final version for COVID-19. Also the supposed samples (most certainly non-existent) of the market animals have been withdrawn by the Chinese government and most surely they had no idea what to do or how to "doctor" the evidence ("up to 45%, including the earliest handful, were not (from that supposed source from the market). This raises the possibility that the initial jump into people happened elsewhere."). As Science reports, even using two critical voices: "It’s not just a “curious interest” to figure out what sparked the current outbreak", Daszak says. “If we don't find the origin, it could still be a raging infection at a farm somewhere, and once this outbreak dies, there could be a continued spillover that’s really hard to stop. But the jury IS STILL OUT on what the real origins of this are.” (My emphasis). https://web.archive.org/web/20200202131556/https://www.sciencemag.org/news/2020/01/mining-coronavirus-genomes-clues-outbreak-s-origins, and then there is the virus from the Pangolin that is also as close as a match as that of the Bat "RaT" and nobody in the Mass Media cares to signal that out. “Until you consistently isolate the virus out of a single species, it’s really, really difficult to try and determine what the natural host is,” says Kristian G. Andersen, an evolutionary biologist at Scripps Research (But I ask to Mr. Andersen: What if there is not an intermediary beast??? But what if instead the "beast" that you need exposed for a long time and with a big number of individuals instead is just a small little Chinese hand that did the modifications for you??? After all, only Spike of Sars-CoV-2 seems to be so dramatically modified as to be only 44% and 20% similar to its BatG13 comparative in those two algid sequences for the infection: RBD and Furin cleavage site!!!). And we need to remember that it is precisely Andersen's article the one that has been used as the "final" proof of a "natural" origin, against all evidence and based solely in "likely" speculations by their authors, even when Daszak himself says that "the jury IS STILL OUT on what the real origins of this are"!!! Some articles and sequences of what was already known that may give some clues to your important query as per its Wuhan Lab. origin: https://www.nature.com/articles/nm.3985 and its disturbing supplementary material (two researchers were from the Wuhan lab and they were the ones that brought the lethal spike sequence to do the experiments there reported with mice, they had already discovered how to kill, as an eugenics model, either voluntary or involuntary by the authors, how to kill since 2015 the weakest mice, the elderly mice!!! (exactly as things are happening with humans!, something that for me needs to be further investigated, do not you think???), as the attached graphic shows): https://static-content.springer.com/esm/art%3A10.1038%2Fnm.3985/MediaObjects/41591_2015_BFnm3985_MOESM18_ESM.pdf , https://jvi.asm.org/content/82/9/4471,
Article Structure of SARS Coronavirus Spike Receptor-Binding Domain ...
, http://files.rcsb.org/view/2AJF.cif, https://www.jbc.org/content/279/5/3197.full, http://le.cnki.net/kmobile/Master/detail/SYJT_PHAM/1017235765.nh, http://kns.cnki.net/kcms/detail/detail.aspx?filename=JSCY201901004&dbcode=CJFQ&dbname=CJFDTEMP&v, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6135831, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6357155..."; at my posting: https://www.researchgate.net/post/Fourth_Sequence_COVID-19_TTG_90_TTT_18_CAATCA_18_AAT_9_TAC_L_F_QS_N_Y_Viral_Pangolin_Insert_with_Receptor_Binding_Domain_RBD_in_a_Virus_of_Bat
Article Structure of SARS Coronavirus Spike Receptor-Binding Domain ...
, http://files.rcsb.org/view/2AJF.cif, https://www.jbc.org/content/279/5/3197.full, http://le.cnki.net/kmobile/Master/detail/SYJT_PHAM/1017235765.nh, http://kns.cnki.net/kcms/detail/detail.aspx?filename=JSCY201901004&dbcode=CJFQ&dbname=CJFDTEMP&v, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6135831, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6357155..."; at my posting: https://www.researchgate.net/post/Fourth_Sequence_COVID-19_TTG_90_TTT_18_CAATCA_18_AAT_9_TAC_L_F_QS_N_Y_Viral_Pangolin_Insert_with_Receptor_Binding_Domain_RBD_in_a_Virus_of_Bat
Fernando Castro-Chavez wrote on a timeline.
Apr 17, 2020, 8:57 AM
Fernando Castro-Chavez shared a memory.
3 Years Ago
Apr 17, 2018, 10:44 PM
Pedro Mariscal, Jorge Souza y Fernando Castro-Chavez. Mariscal comienza con un bello epígrafe de Arreola para su “Primer destino", y dice así: “Jóvenes y maestras: sálganse del programa y den un poco de lección de humanidad” (en “La palabra educación”, de Juan José Arreola), y luego comienza diciendo: "Tu mirada se dirige a un cielo lleno de estrellas en esa madrugada… hasta tu rostro llega la brisa de la última lluvia. La luna se asoma por entre las ramas de los altos mezquitales que bordean la sorpresiva brecha…” ("Un sol que llena tus pupilas", 2017); Souza luego dice: "Lo que ocurría en la clase de Arreola... tomaba la palabra para hilar interminables textos que a todos nos dejaban boquiabiertos... Nos convertíamos, entonces, en espectadores insólitos de un mundo que se abría y se desplegaba con nuevas y múltiples formas..." ("Arreola a La Rotonda", 2014); y Fernando Castro-Chavez finalmente dice: "Arreola me enseñó que: “Lo importante de un escrito es la mariposa de la inspiración que sale del capullo del corazón, para que puedas tu decir cosas que, aunque inspiradas por tu vida y por tus lecturas, que seas capaz de decirlas de una manera original, única, imposible de imitar, que solamente tú las puedas decir de esa forma" ("Arreolanza", 2018)". Foto cortesía de Sofía Gutiérrez Arias.
Other times of literature and of no fears of being closer... :
Updated Apr 17, 2020, 7:22 AM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Apr 16, 2015, 4:02 PM
The conversation of Jesus with his disciples in the outskirts of Sychar, in Samaria, is further evidence that the first seven months of the Ministry of Jesus, when God appointment him as ‘The Apostle’, corresponded to a Sabbatical Year; that explains the freedom of the people to flock, both around John the Baptist and around Jesus!
The ever living wonders of God at His Word: The Sabbatical year that covered the first half of the Acceptable Year of the Service of our Lord Jesus as The Apostle, ending with that glorious Day of Atonement, were Jesus at Mount Hermon in Damasco was Ordered Holy Priest of the Order of Melchizedek, higher and permanent, superior to the Levitical one. The second half of the service of Jesus as the High Priest on earth was an Hebrew Leap Year!!! The Symmetries of our dear good God: As his first year of life was crowned by the signs in heaven announcing his arrival and by the law bending its knees with the double sound of trumpets, so in his last year on earth was the special Sabbatical year and the Leap Hebrew year. Oh way far more living realities of the Bible that are still awaiting for us to be discovered!!!
Updated Apr 16, 2020, 8:22 AM
Mi versión en español de la Quinta Revolución Industrial propuesta en esta Quinta Era, La Era de Gracia, por sugerencia de @[506429089:2048:Michael Jagdeo]:
Updated Apr 15, 2020, 10:36 PM
My remembrances from the past: the amazing Canadian group "Shadowfax" (introduced to me by Edna), with its "Angel's Flight" (Dedicated to the Girl that I now like, my youthful 'Angel', towards whom my 'Flight' is, like if flying to her light, that I interpret as me traveling (when this horrible traveling ban is removed) towards my "Angel's Flight", I tried to find it live but could not, so, oh well, here is it pre-recorded): https://www.youtube.com/watch?v=D6KRRwG6wVM
Updated Apr 15, 2020, 7:30 PM
"This is the First Sequence that called my attention, and its matches mostly with bacterias, and this is how it is illustrated by the authors of the article [with my red rectangle for the meaningful portion of it] posted below [by saying them in the image: "Both the polybasic cleavage site and the three adjacent predicted O-linked glycans are unique to SARS-CoV-2 and were not previously seen in lineage B betacoronaviruses", but that does "not" ring a bell in these biotech guys], without the authors providing its best BLAST current matches as I have done it here, so, shame on them! They instead, wrote that [with my notes in brackets]: "...a polybasic cleavage site (RRAR) at the junction of S1 and S2, the two subunits of the spike... This allows effective cleavage by furin and other proteases and has a role in determining viral infectivity and host range. In addition, a leading proline is also inserted at this site in SARS-CoV-2; thus, the inserted sequence is PRRA. The turn created by the proline is predicted to result in the addition of O-linked glycans to S673, T678 and S686 [my note: Shown in the image], which flank the cleavage site and are unique to SARS-CoV-2. Polybasic cleavage sites have not been observed in related ‘lineage B’ betacoronaviruses, although other human betacoronaviruses, including HKU1 (lineage A), have those sites and predicted O-linked glycans [my note here: however the cleavage site here is: RVKR and the amino acids for the glycans are not specified and are not "O-linked" as deceivingly the authors say, but it is rather "N-linked", do you think that an "expert" virologist can make that kind of mistakes just because...?], then these authors say: "Experiments with SARS-CoV have shown that insertion of a furin cleavage site at the S1–S2 junction enhances cell–cell fusion without affecting viral entry" [my note: So the artificial insertion of this kind of sites has been done regularly and it is a well known fact by that article published since 2006, and that does not ring a bell in the head of these authors, so, these researchers seem rather to be "covering-up" the artificiality of this virus], they prefer to go to the speculation of the unknown: "Given the level of genetic variation in the spike, it is LIKELY that SARS-CoV-2-like viruses with partial or full polybasic cleavage sites WILL be discovered in other species" [my emphasis]. In avian influenza viruses, rapid replication and transmission in highly dense chicken populations selects for the acquisition of polybasic cleavage sites in the hemagglutinin (HA) protein16, which serves a function similar to that of the coronavirus spike protein. Acquisition of polybasic cleavage sites in HA, by insertion or recombination, converts low-pathogenicity avian influenza viruses into highly pathogenic forms. The acquisition of polybasic cleavage sites by HA has also been observed after repeated passage in cell culture or through animals... [my note: So, all of these facts indicate that it is well known that such 12-bases are inserted in the lab, thus acquired within the lab and that does not ring a bell in the man that has founded a biotech company and at the same time receives three grants from the NIH, US government???] predicted O-linked glycans could create a ‘mucin-like domain’ that shields epitopes or key residues on the SARS-CoV-2 spike protein. Several viruses utilize mucinlike domains as glycan shields involved immunoevasion", etc., etc., etc... (attached my personal copy of their article with just some points to be questioned in red, but as a matter of fact, all the full section describing this sequence to produce the PRRAR should be put in red as well, so notice that)": Reference: "The proximal origin of SARS-CoV-2", Andersen et al.: https://www.nature.com/articles/s41591-020-0820-9 [In my initial posting, I had my red copy with my red letters of the questionable aspects of the Andersen paper but FB did not allow me to post it here], taken from my current discussion at: https://www.researchgate.net/post/COVID-19_CCTCGGCGGGCACGT_PRRAR_AA_Furin_cleavage_site_at_23603-23617_of_the_MN908947_Genbank_Genome_Matches_Mostly_Bacteria_COVID-19_in_BLAST
Updated Apr 15, 2020, 10:03 AM
Freedom, freedom, freedom!!!
Updated Apr 15, 2020, 9:14 AM
Flying with the freedom of the birds!!! And you all know that our Father feeds them!!!:
Updated Apr 14, 2020, 9:58 PM
Update of the 17th of April, key fragments of these several links down below: "The Wuhan wet market initially identified as a possible point of origin never sold bats, and the sources tell Fox News that blaming the wet market was an effort by China to deflect blame from the laboratory"; "China moved quickly to shut down travel domestically from Wuhan to the rest of China, but did not stop international flights from Wuhan"; "The new virus’s genome most closely resembles a bat coronavirus discovered in July 2013 in Yunnan province in China, information only made public by the Wuhan Institute of Virology on Jan. 23, 2020"; "Two Chinese universities recently posted online notices placing restrictions on publishing academic research on the origins of the coronavirus..."; "In late March..., the FBI detected samples of the SARS virus and flu in Chinese scientists’ luggage, presenting a “biosecurity risk” for both deliberate acts of terrorism or potential accidents during research", https://www.huffpost.com/entry/intelligenc-officials-coronavirus_n_5e961550c5b6a4470cb76137, sent by my sister. Me, as Postdoc in Mol. Biol., I can see the human hand on modifying that COVID-19. But at least these news are an encouraging start.
Updated Apr 14, 2020, 9:01 PM
Updated Apr 14, 2020, 7:58 PM
Updated Apr 14, 2020, 7:58 PM
Updated Apr 14, 2020, 7:57 PM
Updated Apr 14, 2020, 8:20 AM
Updated Apr 14, 2020, 8:19 AM
The amazing sense of freedom, the fresh and natural air filling our never healthier lungs, the flying high like the eagles with a complete disregard of some rudimentary rules of men aiming at the promotion of fears for their own gains and advantages, this is what the believing children of God are and look like, and our Good Lord keeps on repeating over and over to our ears: "Do NOT fear what they fear", "I AM with you", "I am YOUR personal healer", "I am your EVERYTHING"!!! "Do not you hear within your heart my VOICE louder than their voices?":
Updated Apr 14, 2020, 8:18 AM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Apr 14, 2015, 9:09 AM
This was the audio introduction of the original presentation from January of 1984 of the Seminar on "A Harmony of the Gospels": https://youtu.be/X1zqSfjjU8s
The precise designs of God are easy to be tracked through history and have an enduring good purpose, and a godly meaning with His blessings (contrary to the designs of men that are hardly trackable, except by contrivances in many times, that hardly have a good purpose that endures and hardly a godly meaning with the blessings of God):
Updated Apr 14, 2020, 7:55 AM
Today, I posted my Fifth Sequence Analysis at Research Gate: https://www.researchgate.net/post/Fifth_Sequence_COVID-19_2_variants_AUG-246-TT/CA-111-TAA_TTA_L_L-Type_70_TCA_S_S-Type_30_in_position_28144_of_MN908947_for_ORF8_NifB; the importance of this is that every single sequence is a lesson of the artificiality of COVID-19, for example, this single mutation (T/C) after five months of its release, understanding that it was released at least since November of 2019 but that China keep it silent, a complicit silence that helped during that whole couple of months of silence: November and December, 2019, for the silent worldwide spread that we are suffering now: https://www.youtube.com/watch?v=ZC0gww2yznI (save it before they delete it), and fo the timing: https://www.youtube.com/watch?v=pKmUxSlOoUE, and I was saying that such single mutation just demonstrates that it is practically impossible to have a perfect sequence of 12-bases mutated at the same time without the intervention of the human hand, as I show with my first sequence presented there: https://www.researchgate.net/post/COVID-19_CCTCGGCGGGCACGT_PRRAR_AA_Furin_cleavage_site_at_23603-23617_of_the_MN908947_Genbank_Genome_Matches_Mostly_Bacteria_COVID-19_in_BLAST, which still is the most read thus far, of my contributions, with 87 readers as per today, seven days after I put it. It is still a fragment from a virus from Pangolin, inserted in the backbone of a virus from bats, why? In order to disseminate it in an easier way, according to the sinister minds that designed it:
Updated Apr 12, 2020, 10:32 PM
Updated Apr 12, 2020, 10:33 AM
Updated Apr 12, 2020, 10:33 AM
Updated Apr 12, 2020, 10:33 AM
Updated Apr 12, 2020, 10:33 AM
Updated Apr 12, 2020, 8:08 AM
A blessing conversation (Only God First can heal over and over a broken heart!!! And a broken (as in Jesus, broken to death) body and a broken mind (broken to the point of a temporary oblivion)...):
The girl that I like asked me: "May I ask at what time..."
I responded: "Jesus our Lord died on a Wednesday before the sun went down and was raised by God on a Saturday evening, before the sun went down, just like the prophecy said: Three days and three nights in the grave: 24x3 : 72 hours, the medical time for the ancient world to determine somebody was completely dead."
She then put an emoji of surprise, then I quoted the documenting Scripture: ""For as Jonas was three days and three nights in the whale's belly; so shall the Son of man be three days and three nights in the heart of the earth." Matthew 12:40"
Then she responded beautifully, after putting "thumbs up": "Oh wow. Thank you for sharing it!!!! ...I'll share it to them..."
And I continued: "Yes, it is amazing to learn the oriental style. Even their "tables" for the last supper were different, at the floor they ate, very similar to many Oriental cultures including yours, like in a lotus flower sitting position"
She again did put "thumbs up" and responded: "Yes that's how our ancestors eat. There's a lot to learn..."
Then I posted, after she had already said goodbye and gone already to sleep, ahead because of the 13 hours of difference in our times: "Yes... It is an amazing detective work, such as this one that I did time ago:
"Issue on Spices
There was an intervening day between two "Sabbaths."
The Special ceremonial Sabbath (the first day of the Passover, a Special Sabbath, being that year on Thursday), and the weekly Sabbath (always on Saturday).
When Jesus was laid in the tomb late Wednesday afternoon Mary Magdalene and the other women were there (Matt. 27:61; Mark 15:47; Luke 23:55).
They then rested on the Passover Sabbath, Thursday.
And "when the (Passover) Sabbath (on Thursday) was over, Mary Magdalene, and Mary the mother of James, and Salome, bought spices, that they might come and anoint Him." (Mark 16:1).
Then, "they returned and prepared spices and perfumes," (Luke 23:56a) which they had just purchased. The guards of the Tomb were still there. "And on the (Saturday) Sabbath they rested according to the commandment." (Luke 23:56b)
Jesus arose just before sunset Saturday (he, the teacher of the truth that the Man is the owner and Lord of the Sabbath).
The women actually came to anoint the body of Jesus on early Sunday morning, since they did not know that He had already arisen (they did not knew that Nicodemus and his servants had already anointed and covered the body).
The owner of the Tomb himself did not anoint the body, because he understood and believed in the Resurrection of Jesus Christ after three days and three nights." [Note for the current times: While the loud speakers are shouting through moving vehicles, today on Saturday for the first time things such as: "Stay home... do not go out of your house... prevent the pandemic... you will be fined if you break with no necessity the quarantine... you will be put in jail if you go out of your dwelling place with no need...", I respond: Time to keep on focused on the meaningful things of life... the amazing Scriptures of God that heal our hearts, most specially when shared with the loved ones and with anybody willing to hear, like right now are you doing it by reading this... the only thing that will heal my heart is to keep on sharing the wonders of God I know, and for the beloved one to be attentive to receive from the hand of God with belief all HIs abundance that He has in store for her, and if she is willing, for us as One!]
The girl that I like asked me: "May I ask at what time..."
I responded: "Jesus our Lord died on a Wednesday before the sun went down and was raised by God on a Saturday evening, before the sun went down, just like the prophecy said: Three days and three nights in the grave: 24x3 : 72 hours, the medical time for the ancient world to determine somebody was completely dead."
She then put an emoji of surprise, then I quoted the documenting Scripture: ""For as Jonas was three days and three nights in the whale's belly; so shall the Son of man be three days and three nights in the heart of the earth." Matthew 12:40"
Then she responded beautifully, after putting "thumbs up": "Oh wow. Thank you for sharing it!!!! ...I'll share it to them..."
And I continued: "Yes, it is amazing to learn the oriental style. Even their "tables" for the last supper were different, at the floor they ate, very similar to many Oriental cultures including yours, like in a lotus flower sitting position"
She again did put "thumbs up" and responded: "Yes that's how our ancestors eat. There's a lot to learn..."
Then I posted, after she had already said goodbye and gone already to sleep, ahead because of the 13 hours of difference in our times: "Yes... It is an amazing detective work, such as this one that I did time ago:
"Issue on Spices
There was an intervening day between two "Sabbaths."
The Special ceremonial Sabbath (the first day of the Passover, a Special Sabbath, being that year on Thursday), and the weekly Sabbath (always on Saturday).
When Jesus was laid in the tomb late Wednesday afternoon Mary Magdalene and the other women were there (Matt. 27:61; Mark 15:47; Luke 23:55).
They then rested on the Passover Sabbath, Thursday.
And "when the (Passover) Sabbath (on Thursday) was over, Mary Magdalene, and Mary the mother of James, and Salome, bought spices, that they might come and anoint Him." (Mark 16:1).
Then, "they returned and prepared spices and perfumes," (Luke 23:56a) which they had just purchased. The guards of the Tomb were still there. "And on the (Saturday) Sabbath they rested according to the commandment." (Luke 23:56b)
Jesus arose just before sunset Saturday (he, the teacher of the truth that the Man is the owner and Lord of the Sabbath).
The women actually came to anoint the body of Jesus on early Sunday morning, since they did not know that He had already arisen (they did not knew that Nicodemus and his servants had already anointed and covered the body).
The owner of the Tomb himself did not anoint the body, because he understood and believed in the Resurrection of Jesus Christ after three days and three nights." [Note for the current times: While the loud speakers are shouting through moving vehicles, today on Saturday for the first time things such as: "Stay home... do not go out of your house... prevent the pandemic... you will be fined if you break with no necessity the quarantine... you will be put in jail if you go out of your dwelling place with no need...", I respond: Time to keep on focused on the meaningful things of life... the amazing Scriptures of God that heal our hearts, most specially when shared with the loved ones and with anybody willing to hear, like right now are you doing it by reading this... the only thing that will heal my heart is to keep on sharing the wonders of God I know, and for the beloved one to be attentive to receive from the hand of God with belief all HIs abundance that He has in store for her, and if she is willing, for us as One!]
Fernando Castro-Chavez shared a memory.
10 Years Ago
Fernando Castro-Chavez added a new photo.
Apr 11, 2011, 8:19 AM
Here is another striking finding, sea shell snail cones side-by-side with what seems to be petrified amber "on the surface"! Apparently more evidence of the seas covering the forests in The Flood of the days of Noah and his family's lone survival:
Amber and other fossils from the quarries near San Antonio, a lot of secrets hidden all over the world from the times of the great floods: the one that extincted dinosaurs (First Ice Age or Glaciation: Global in the ice: Gn 1:1, before humanity) and the one that extincted big mammals (Second Ice Age or Glaciation: Partial on the ice: Genesis 5:32-10:1, the one that concerns humanity):
Updated Apr 11, 2020, 7:59 AM
Updated Apr 10, 2020, 9:03 PM
Here is the editing by @[506429089:2048:Michael Jagdeo], bringing down the most significant information that is specific to the I Ching and to the COVID-19: Tackling it, to defeat it!, a Chinese virus from (manufactured in) Wuhan, China, with the I Ching found (deducted many years earlier, in the dawning of the ages) in China, putatively by Fuxi and Nuwa (which indeed are the Double Helix!!!: Male and Female, the two polarities: the + (plus) and - (minus) strands): https://www.youtube.com/watch?v=Jwa5xDPSk2o
Updated Apr 10, 2020, 6:10 PM
The Ongoing analysis of the genome of COVID-19 and the artificiality within it, the first sequence described here is: CCTCGGCGGGCACGT, that when translated is PRRAR, an amino acid cleavage furin site with most of its BLAST matches coming from bacteria; then, yesterday night I reported its digestion site TAAAATTAATTTTA that can be attacked at least by 10 different restriction enzymes, and today I reported the fragment that has a 100% match with a fragment for the Env protein of the HIV-1: AATGGTACTAAGAGG, giving it encapsulation abilities similar to that virus. Today, I am working in the segment inserted from the virus of Pangolin, that will be my fourth sequence of this virus to be reported at Research Gate, also indicative of the artificial origin of this pernicious virus, I am thankful again to @[506429089:2048:Michael Jagdeo] por suggesting me to search on it from a critical perspective, and I pray God to Reveal the cure to each person infected above and beyond the intentions of those that release it, the ones that apparently do not want to release the remedy until it has caused enough damage for them to pursue with their hidden plans, that are not hidden at all for us, as they want world domination and one worldwide monetary standard, for them to have it even easier in that, their purported control:
Updated Apr 10, 2020, 1:37 PM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Apr 10, 2015, 4:46 PM
Para la presentación que comienza en menos de 3 horas (aquí son las 4:45 PM), Claudia me recomienda que los participantes apaguen su video y silencien su sonido (desde luego, con apertura para conocerles, leer la Escritura, manifestar, etc.) pero que únicamente esté activa la recepción del audio por la mayor parte de la presentación. Las transparencias en PDF serían nuestro principal punto de estudio: http://fdocc.ucoz.com/2/01_cronos_cristos.pdf (que hoy he actualizado.) Éstos estudios en progreso se inspiran en el material que se ilustra:
The wonders of Jesus, who is alive forever, the Real healer of bodies and of souls, infusing with his spirit to every one that decides to establish a direct contact with him!!!:
Updated Apr 10, 2020, 7:20 AM
Fernando Castro-Chavez shared a memory.
Time from another times, not yet under "the big fear" to be together (well, except for an idio... (not in the photo), who wanted to take the place of GOD, one immature other who wanted to control others by other kind of "fears", and all just for a personal gain, bummer!):
Updated Apr 9, 2020, 9:49 AM
Explaining my discoveries at the Convention Center by the Riverwalk at New Orleans in the Congress organized by the American Heart Association, AHA, Dr. C. M. Ballantine was there and Dr. V. Nambi, Morrisett was on his vacation...: (Photo taken by Tracy Lynn Duncan, my ex-wife).
Updated Apr 8, 2020, 7:20 AM
Updated Apr 7, 2020, 10:47 AM
Updated Apr 7, 2020, 10:47 AM
Dedicated to The One: Far and Away but Near in my Dreams: |
Dedicated to The One: Far and Away but Near in my Dreams:
Updated Apr 6, 2020, 5:45 PM
Updated Apr 6, 2020, 11:56 AM
Updated Apr 6, 2020, 8:13 AM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Apr 6, 2015, 4:37 PM
But the greatest finding establishing a Revelation of God that we find in His Word (and that was presented last month), is that The Body of Christ is the “Holy of Holies” (a.k.a. the “Most Holy”): The full span of the duration of the ministry of Jesus Christ (70 weeks!) was revealed to Daniel by Gabriel! The same Gabriel that announced the conception of Jesus to Mary; these 70 weeks go from Jesus' Baptism to the Day of Pentecost when he poured holy spirit over his 12 apostles!
We are the shelter, the Most Holy place of humanity, born-again saints, today is the time to start showing up, today is the start of the giant Christ on earth, his body, for him to rise at the measure of the stature of the real Christ in heaven. Complacency and idiocy are over!!!
Updated Apr 6, 2020, 7:15 AM
Updated Apr 5, 2020, 5:59 PM
Updated Apr 5, 2020, 5:58 PM
Updated Apr 5, 2020, 5:58 PM
Updated Apr 5, 2020, 5:58 PM
COVID-19: CCTCGGCGGGCACGT = PRRAR = AA Furin cleavage site at 23603-23617 of the MN908947 Genbank Genome Matches Mostly Bacteria and COVID-19 in BLAST!: [This for Me as Researcher and Scientist Specialized in Artifacts in Engineered Sequences, is Evidence of it Being a Methodological Insert in the Laboratory of Wuhan in China, and I am talking about it with "the experts", do you think some of them will have real "guts", or "ass" protectors?: https://www.researchgate.net/post/COVID-19_CCTCGGCGGGCACGT_PRRAR_AA_Furin_cleavage_site_at_23603-23617_of_the_MN908947_Genbank_Genome_Matches_Only_Bacteria_and_COVID-19_in_BLAST; next, my previous work discovering and exposing the 12-bases artifact contaminating thousands of sequences in the Genbank: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3272245/; so, this case with the COVID-19 is something similar, and shows the human hand inserting another and unprecedented in nature in a normal way, until the artificiality of COVID-19, inserting by hand, I was saying, a 12-bases sequence to complete with 3-bases from the host the 15 bases that make the cleavage site when translated into its amino acids (nucleotide sequence which is furthermore completely unusual for the rest of the virus, as it is a sequence 80% rich in GC, an out-of-place bias not seen in the rest of this virus, but seen in bacteria, where it uniformly can reach even a 75%); so, in such an easy BLAST comparison, I am filling the blank deliberately left by the next biased paper that I critically read in my presentations of yesterday and of its day before: https://web.archive.org/web/20200404021306/https://fdocc.ucoz.com/red-s41591-020-0820-9.pdf, a short sequence that signatures the human hand within the COVID-19 virus. Disclaimer: And of course that I am on hiding, and of course that I will not reveal my location to strangers that I have just met here at the FB that keep on asking for my location!!! Christ protect me and all of the rest of your brethren! AMEN]:
Fernando Castro-Chavez shared a memory.
3 Years Ago
Apr 5, 2018, 4:17 PM
In English: "The important thing of a writing is the butterfly of inspiration that comes out of the cocoon of your heart, so that you can say things that, although inspired by your life and by your readings, you are able to say them in an original, unique, impossible way to imitate, something that only you can say in such way" (Juan José Arreola when talking to me).
"Bisaya Cebuano: "Ngadto sa akong asawa nga si Mary Cris: "Ang importante nga butang sa usa ka pagsulat mao ang alibangbang sa inspirasyon nga nga mogawas gikan sa cocoon sa kasingkasing, aron makasulti ka sa mga butang nga, bisan tuod dinasig sa imong kinabuhi ug pinaagi sa imong pagbasa, mahimo nimo kini isulti sa orihinal nga paagi talagsaon, imposible nga paagi sa pagsundog, nga ikaw lamang ang makasulti imong..." Arreola. Ang imong Fernando nga tinuod nga nahigugma kanimo, ang Dios ang akong saksi!"
Filipino: "Sa aking asawa, si Mary Cris:
"Ang mahalagang bagay sa pamamagitan ng pagsulat ay ang pagtaas ng inspirasyon na nagmumula sa cocoon ng puso, upang masabi mo ang mga bagay na, bagaman inspirasyon ng iyong buhay at ng iyong pagbabasa, maaari mong sabihin ang mga ito sa isang orihinal na paraan, isang natatanging at imposibleng paraan upang tularan, na tanging maaari mong sabihin ito na paraan..." (Arreola).
Ang iyong Fernando na talagang nagmamahal sa iyo, ang Diyos ang aking saksi!"
And the way I put it in my "Tasters of the Word": https://www.facebook.com/TastersOfTheWord/photos/a.1295006403855126.1073741828.1294972103858556/1871677812854646/?type=3&theater
Transparent beauty... subtle, still present... alive and flying... renewing itself generation after generation... keeping the sweets... giving it all!... just by being herself!
Updated Apr 5, 2020, 8:04 AM
Gracias a José Francisco de Coquimbo, Chile, y a Nilda de Maracaibo, Venezuela, por pedirme transmitir esto mismo en español: https://www.youtube.com/watch?v=pI5hQByiCJ4, aquí van incluso más detalles que en mi versión de ayer; ésta vez se exploró también una figura de un suplemento del previo y sintético "COVID-15", que mostraba todos los síntomas del actual en los ratones experimentales, como se ve aquí en la figura 3b, matando a todos los ratones ancianos: https://web.archive.org/web/20200401140549/https://static-content.springer.com/esm/art%3A10.1038%2Fnm.3985/MediaObjects/41591_2015_BFnm3985_MOESM18_ESM.pdf, también se exploró que dos de los investigadores del 2015 eran de Wuhan, China, y fueron los que proporcionaron las estructuras básicas para la infectividad, ya que dice en el artículo central, que, del: "Key Laboratory of Special Pathogens and Biosafety, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan, China
Xing-Yi Ge & Zhengli-Li Shi", "Z.-L.S. provided SHC014 spike sequences and plasmids" https://web.archive.org/web/20200404203233/https://www.nature.com/articles/nm.3985
Xing-Yi Ge & Zhengli-Li Shi", "Z.-L.S. provided SHC014 spike sequences and plasmids" https://web.archive.org/web/20200404203233/https://www.nature.com/articles/nm.3985
Updated Apr 4, 2020, 8:51 PM
Updated Apr 4, 2020, 10:03 AM
Updated Apr 4, 2020, 10:03 AM
Updated Apr 4, 2020, 10:03 AM
Updated Apr 4, 2020, 10:02 AM
The very first time ever that, once questioning the COVID-19, and presenting it as a real artificial genome, I got detained, delayed by the FB (just missing the last "I", :) ), has it ever happened to you??????? (Thus far in my preliminary review of its genome it is a backbone from a bat virus with a ten percent of a virus from pangolin with a one percent of those HIV/SIV meaningful sequences (RT, Pol, Env, Int), with a point one percent of unknown origin such as those key ones engineered in the labs, and all of that taken primarily from a mainstream article from last month: https://web.archive.org/web/20200404021306/https://fdocc.ucoz.com/red-s41591-020-0820-9.pdf, my questioning it all in red, Heheee!!! Almost all of it!!!, plus the independent research of a programmer at Bordeaux, jean-claude perez: https://www.facebook.com/jeanclaude.perez.58, who is also friend of another great Christian: Lambert Dolphin, to whom, both of them, I say hello and say: keep the deep waters flowing!!!: https://web.archive.org/web/20200404010144/https://fdocc.ucoz.com/Perez-COVID-19-Synthetic.pdf): And this is my further research on it: https://www.researchgate.net/post/COVID-19_CCTCGGCGGGCACGT_PRRAR_AA_Furin_cleavage_site_at_23603-23617_of_the_MN908947_Genbank_Genome_Matches_Mostly_Bacteria_COVID-19_in_BLAST (With a detailed expansion and snapshot on how it looks now, after three days of posting it and 67 persons that had already read it until now):
Updated Apr 4, 2020, 7:52 AM
Updated Apr 4, 2020, 7:52 AM
Updated Apr 4, 2020, 7:52 AM
Updated Apr 4, 2020, 7:52 AM
Updated Apr 4, 2020, 7:52 AM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Apr 4, 2015, 12:04 PM
The great discovery of our current study is the proper timing of the Sabbatical years, “the years for the Lord”, in function of the life of Jesus! From Tishri 10 of 26 A.D. to Tishri 10 of 27 A.D. was the last Sabbatical Year in the earthly life of Jesus, matching the first half of his Ministry when he was "The Apostle". Here are the slides for today's presentation: http://fdocc.ucoz.com/2/12.apostle1.pdf [The correct Sabbatical Chronology was the one rediscovered by Benedict Zuckermann, a devout Jew from Germany of the XIX Century.]
Updated Apr 4, 2020, 7:12 AM
As per the request of my dear head hunter Mike, @[506429089:2048:Michael Jagdeo], I present this appendix of my reading of three articles on the subject, what is known and what is ignored by the "Media"; research articles are three, for your critical consideration if you want to: https://web.archive.org/web/20200404002726/https://www.nature.com/articles/s41591-020-0820-9 (Ah!, and here my own version with my remarks in red, for you to do your own and better research, as it concerns your own health and of your own!: https://web.archive.org/web/20200404021306/https://fdocc.ucoz.com/red-s41591-020-0820-9.pdf), https://web.archive.org/web/20200404004127/https://www.nature.com/articles/nm.3985 & https://web.archive.org/web/20200404010144/https://fdocc.ucoz.com/Perez-COVID-19-Synthetic.pdf
Updated Apr 3, 2020, 7:17 PM
Fernando Castro-Chavez shared a memory.
3 Years Ago
Apr 3, 2018, 9:38 AM
En otra ocasión, retomando esta escena de la transformación, Arreola señaló ante un evento de puras mujeres: "“Imagínense ustedes que nos encontramos a uno de esos gusanos que se caen del árbol, se quedan en la banqueta expuestos a ser aplastados por el primer transeúnte distraído o malévolo.” “Nos enfrentamos al gusano y le decimos: ¿quieres ser mariposa? El gusano se reirá de nosotros indudablemente. Apegado con todo el cuerpo a la superficie de la tierra, la proposición de volar le ha de parecer francamente irrisoria y, sin embargo, mediante un acto de meditación profunda modifica además de su estructura celular toda la masa de su materia original y la hace ‘evolucionar’ de esa sustancia casi viscosa, líquida, hasta la perfección del tejuelo, de la astilla de color y de luz que se vuelve en el doble alero de las alas el resplandor de la mariposa” (Arreola, J. J. La implantación del espíritu. (En: Obras). D.F.: FCE, 2014:656-657)", lo que también incluyo en el libro de mi "Arreolanza".
Updated Apr 3, 2020, 7:27 AM
Updated Apr 2, 2020, 8:46 PM
And here I put an awesome Christian youthful or afresh song that my dear brother Gabriel Oliver shared with me: https://www.youtube.com/watch?v=ObMO2e2NNOg
Updated Apr 2, 2020, 1:48 PM
Fernando Castro-Chavez shared a memory.
3 Years Ago
Apr 2, 2018, 3:30 PM
Dedico el siguiente escrito a Lidia Ruiz Gomez y famila, por ser mis bienhechores junto a mis padres, de mi próximo libro "Arreolanza": "...retomando la misma escena del gusano que se transforma en mariposa, Arreola nos dice:
“Estoy de acuerdo con la crisálida que resuelve dentro del capullo la aspiración del gusano. ¡Bendita sea la metamorfosis, esa profunda meditación que nos levanta del suelo en las alas efímeras pero resplandecientes de una mariposa!”.
"Creo que la operación enigmática que resuelve un gusano en mariposa, se debe a una reflexión profunda. Esa que todos deberíamos emprender, ensimismándonos. El gusano se arrastra por el suelo, ya sea la superficie de un tallo, de una hoja, de un tronco, o simplemente digamos: el gusano se arrastra a ras de tierra. Pero he aquí que se le ocurre volar. Entonces se ensimisma y se embalsama con su propia sustancia como una momia que se sabe capaz de resurrección. Porque va a brotar de su propio ser material, pero alentado por el espíritu. Como todos nosotros. De allí la meditación profunda. La de Jonás envuelto y luego dado a luz por la ballena, esa masa de nada original que nos devuelve al Todo..."" (Arreola, J. J. Inventario. D.F.: Conaculta, 2002:22, 173)."
Makami You!!!: The tender touch of a fragile butterfly..., the softly sound, her flapping wings... her colors that defy her worm before... I miss you more than ever!!!... at least I say: "I lived"!!!... even if it was for a second... one minute hanging from eternity... just wanting more and more... to taste again your flavors... to fly on high again... to flap in dancing spaces... to sing in endless nights... for us again: the air, the lights... to be once more: the nectar and the sky!!! @[100001280559168:2048:Fernando Castro-Chavez]
Updated Apr 2, 2020, 7:41 AM
Do we continue exchanging meaningful music my astounding ideal female and me? Heck yeah!!! Just it is so much and so frequent that I forget to document it, is like just finding Sting right around the corner: https://www.youtube.com/watch?v=H-4yodHCvu0, in her last delivery, WOOW!!!:
Updated Apr 2, 2020, 6:38 AM
Updated Apr 1, 2020, 8:25 PM
Reading my version of the extraordinary research by E. W. Bülliner on the Book of Job: https://archive.org/details/bookofjob00bull/mode/2up
Dedicating with all of my blonde heart to Her in this early morning, to uplift our days, some of the hits of another beauty, but not as her peculiar beauty and what her produced directly to me and to my heart!!!, but yes, in this age, I will text her: "Text Me"!!!: https://www.youtube.com/watch?v=StKVS0eI85I
Updated Mar 31, 2020, 7:48 AM
Fernando Castro-Chavez shared a memory.
3 Years Ago
Mar 31, 2018, 10:36 AM
En este sábado de resurrección hay que recordar que lo más importante es que: ¡tenemos y tendremos por siempre a Cristo! Y aún cuando no tenga yo una compañera (y en realidad no tengo a nadie real, sino una ilusión en la que tan sólo yo estoy creyendo), ni casi nada en la vida: ¡Tengo a Cristo por siempre! (La eclosión: "¡Es la metáfora de nuestra salvación y resurrección!", decía Arreola, lo que pongo en "Arreolanza", que escribo para poder comer). Dios levantó a Jesús en un sábado al atardecer: http://cgi.org/three-days/
Remembering the sweet and tender beauty of nature, with colors that are amazing, that are the rainbow, that are the metaphor for the inspiration in crisalis that emerges to produce the most astounding revelations!:
Updated Mar 31, 2020, 7:35 AM
Uplifting sharings, for The One: https://www.youtube.com/watch?v=m4tJSn0QtME
Updated Mar 30, 2020, 12:04 PM
Updated Mar 30, 2020, 7:26 AM
Updated Mar 30, 2020, 7:16 AM
Updated Mar 30, 2020, 7:15 AM
Updated Mar 30, 2020, 7:13 AM
Updated Mar 29, 2020, 2:52 PM
Fernando Castro-Chavez shared a memory.
10 Years Ago
Fernando Castro-Chavez added a new photo.
Mar 29, 2011, 4:01 PM
We did some analysis of old Texan rocks (Pat, Ed and me) and found the imprint of tree branches and of a cone shell. Basically every rock there is telling a story related to The Flood.
Remembering the fossil imprints from the quarries of San Antonio that we use to explore with my nephews:
Updated Mar 29, 2020, 7:30 AM
Updated Mar 28, 2020, 12:09 PM
Remembering in the Good Times, in the Bad Times, and in Every Kinds of Times: https://www.youtube.com/watch?v=s24G0jOWwe8
Updated Mar 28, 2020, 10:05 AM
Fernando Castro-Chavez shared a memory.
3 Years Ago
Mar 28, 2018, 9:56 AM
"Lo que le gustaba a Arreola de Kant eran sus metáforas animales: 1) Los racionalistas son como las arañas que tejen su tela a partir de lo que llevan dentro, y quedan atrapados en sus propios razonamientos; 2) Los empiristas son como las hormigas que solamente valoran lo que pueden cargar externo a ellas, hasta quedarse bajo tierra sin poder remontarse a las alturas; 3a) El conocimiento verdadero se asemeja: tanto a la abeja, que toma el néctar de las flores (algo externo, como hormiga: experiencia), pero que luego lo procesa en su interior para producir miel (algo interno, como araña: razón), y a 3b) La paloma que para remontarse en su vuelo (razón) depende de la resistencia del aire (experiencia), y si no la tuviera, caería de inmediato por encontrarse al vacío (y Kant afirmaba que eso le sucedió a Platón; notas para "Arreolanza", 2da. Ed.)." Su Fernand.
The metaphors that we can learn of the Creation of God and of men that observe it with attention, honoring thus the Creator by appreciating and by admiring His Work:
Updated Mar 28, 2020, 8:21 AM
Updated Mar 27, 2020, 8:40 AM
Updated Mar 26, 2020, 7:36 PM
Updated Mar 26, 2020, 7:35 PM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Mar 26, 2015, 9:05 AM
Based on the research started by Ernest L. Martin (1995), we can correct the maps related to the Temple that appear in the last half of an awesome pair of research manuscripts (1984) recently rediscovered: http://tinyurl.com/jcapohp [which I’ll review in my next W&S presentation!] Also, a statement in p. 70: “The Temple area (over 35 acres) was surrounded by a retaining wall built of immense stones, the largest as long as 46 feet, portions of which remain to this day” (B.A.R. May/June 1981) is now obsolete because we know that those walls, which include the “Wailing Wall”, actually correspond to the Roman ‘Fort Antonia’! But most importantly, because our Lord Jesus said that there will be left nothing, not even one stone over other stone (not only of the inner Temple and its outer walls, but of the complete Jewish city!!!
The actual geographical location of the Temple of Jerusalem and of the Roman Fort Antonia, to which the "Wailing Wall" belongs:
Updated Mar 26, 2020, 7:53 AM
Updated Mar 25, 2020, 7:47 AM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Mar 24, 2015, 2:58 PM
Once we realize that in the Temple of Jerusalem all the entrances to the Most Holy Place, to the Holy Place, to the Court of Israel and to the Court of the Gentiles were all looking at the East, we are able to see that Jesus Christ was crucified outside of the city, in front of all of those doors, near the Altar for the Heifer (the Miphkad).
The location of the place where Jesus offered his life for you and I, out of the city, just in front of the entrance to the Temple of Jerusalem, at the distance... in the same place of the sacrifice of the red heifer, whose ashes did wonders by the order of God, from hearings to prophecies....! (Another amazing discovery by Ernest L. Martin).
Updated Mar 24, 2020, 7:13 AM
Updated Mar 23, 2020, 7:52 AM
Updated Mar 23, 2020, 7:52 AM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Mar 23, 2016, 7:01 PM
Amados colegas Cristo y Dios, En agradecimiento a mis santos amados de habla hispana que están orando por mí y velando por mi bien, aquí les he leído algo tremendo de lo que tuvo que pasar Casiodoro de Reina, para pder ver impresa su traducción de la Biblia al español, y verla llegando a almas hambrientas, semejantes a ese oso que puso en la portada; por lo que su primera edición de 1569 fue conocida como "La Biblia del Oso": https://youtu.be/a0BrqrPRp8k ¡Orando por la santa comunión de los santos! En Ustedes, Fernando.
La Biblia del Oso de Casiodoro, la primera en español de amplia difusión desde entonces en la lengua de Castilla:
Updated Mar 23, 2020, 7:29 AM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Mar 22, 2015, 8:21 AM
Key for chronology is the work of Josephus, saying that the Temple was renovated by Herod starting in the 15th year of his reign, which matches with the year 19 B.C., important to date the Sacred chronology of John the Apostle. Again 'The Gihon Spring' is a reminder that the Temple was evocative of Eden (as in its 2nd river)!
Real location of the Temple of Jerusalem:
Updated Mar 22, 2020, 7:44 AM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Mar 20, 2015, 9:18 AM
Further evidence that the Temple of Jerusalem was located 600 ft. South of the southern wall of ‘Fort Antonia’ (inside which Fort the Dome of the Rock is located, being the “Wailing Wall” in the Western wall of such Fort), is that a constant flow of water was needed to keep it all clean after the daily animal sacrifices! The 'Gihon Spring' provided continuous water for the actual place of the real Temple!
From my Bible studies when I dedicated myself to do so, and then to share it live. Now, I am living the miracle, living the sermon rather than studying or talking about it, but the geography, the zoology, the poetry, the history, the spirituality of the Bible and so much more as originally revealed, is 100% accurate and amazing, it is alive and ever willing to surprise us with its greatness!!!:
Updated Mar 20, 2020, 7:36 AM
Now that we want to run towards each other, but banned from flying to her place, I remember this big hit in Mexico, a blast from my childhood: https://www.youtube.com/watch?v=Up4WjdabA2c
LAST TRAIN TO LONDON
Electric Light Orchestra
Produced by Jeff Lynne
Album: Discovery (1979)
[Verse 1]
It was 9:29
9:29, back street, big city
The sun was going down
There was music all around
It felt so right
[Verse 2]
It was one of those nights
One of those nights
when you feel the world stop turning
You were standing there
There was music in the air
I should've been away
But I knew I had to stay
[Chorus]
Last train to London, just heading out
Last train to London, just leaving town
But I really want tonight to last forever
I really wanna be with you
Let the music play on down the line tonight
[Verse 3]
It was one of those nights
One of those nights
when you feel a fire is burning
Everybody was there
Everybody to share
It was so right
[Verse 4]
There you were on your own
Looking like you were the only one around
I had to be with you
Nothing else that I could do
I should've been away
But I knew I had to stay
[Chorus]
Last train to London, just heading out
Last train to London, just leaving town
But I really want tonight to last forever
I really wanna be with you
Let the music play on down the line tonight
[Verse 5]
Underneath a starry sky
Time was still,
but hours must really have rushed by
I didn't realize
But love was in your eyes
I really should've gone
But love went on and on
[Chorus]
Last train to London, just heading out
Last train to London, just leaving town
But I really want tonight to last forever
I really wanna be with you
Let the music play on down the line tonight
[Outro]
But I really want tonight to last forever
I really wanna be with you
Let the music play on down the line tonight
LAST TRAIN TO LONDON
Electric Light Orchestra
Produced by Jeff Lynne
Album: Discovery (1979)
[Verse 1]
It was 9:29
9:29, back street, big city
The sun was going down
There was music all around
It felt so right
[Verse 2]
It was one of those nights
One of those nights
when you feel the world stop turning
You were standing there
There was music in the air
I should've been away
But I knew I had to stay
[Chorus]
Last train to London, just heading out
Last train to London, just leaving town
But I really want tonight to last forever
I really wanna be with you
Let the music play on down the line tonight
[Verse 3]
It was one of those nights
One of those nights
when you feel a fire is burning
Everybody was there
Everybody to share
It was so right
[Verse 4]
There you were on your own
Looking like you were the only one around
I had to be with you
Nothing else that I could do
I should've been away
But I knew I had to stay
[Chorus]
Last train to London, just heading out
Last train to London, just leaving town
But I really want tonight to last forever
I really wanna be with you
Let the music play on down the line tonight
[Verse 5]
Underneath a starry sky
Time was still,
but hours must really have rushed by
I didn't realize
But love was in your eyes
I really should've gone
But love went on and on
[Chorus]
Last train to London, just heading out
Last train to London, just leaving town
But I really want tonight to last forever
I really wanna be with you
Let the music play on down the line tonight
[Outro]
But I really want tonight to last forever
I really wanna be with you
Let the music play on down the line tonight
Updated Mar 19, 2020, 9:26 AM
Updated Mar 18, 2020, 12:17 PM
Updated Mar 18, 2020, 12:16 PM
Updated Mar 18, 2020, 12:16 PM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Mar 18, 2015, 8:36 PM
Jesus Christ prophesied that not even stone upon stone will be left of the Temple in Jerusalem. The Romans executed to the letter such prophecy. The actual Temple was located 1000 ft south of the current Dome of the Rock as Dr. Ernest L Martin discovered.
The amazing vitality of the Bible is that, it is always new and renewed, always showing us things that we have no idea that are eve there, such as this one indicating that the famous "Wailing Wall" of the Jews, is nothing close to the Temple of Jerusalem but to the Fortress Antonia, where those Roman soldiers that beat down the crap out of the whole city of Jerusalem, including its Temple, as it was rightfully prophesied by Jesus, were stationed. If it were part of the Temple, the words of Jesus have had no value at all, which is what many aim to instill unconsciously into others, but because the words of Jesus are real and they really happened as he said, the real Temple was torn down to the ground with no "wall" at all left to wail into... (Thanks to the guts of Ernest L. Martin we know all of this, the same Ernest that originally brought the understanding for those with eyes to see, that Jesus Christ was born on September the 11th of the year 3 B.C., also adjusting the mistaken chronology of the so-called "experts"):
Updated Mar 18, 2020, 11:26 AM
She just sent to me this Bible study by Joel Osteen, telling to the desperate of me: "Watch, Listen, and Reflect": https://www.youtube.com/watch?v=NoMLLtYELKk, and I say: "Amen"!!!:
Updated Mar 16, 2020, 11:36 AM
So, starting today, on this Monday 16th of March, at four months of my meeting of her, a Monday like today on November the 18th, I will be featuring our amazing trip to San Antonio, TX, and the nearby towns on the road that we found, this was one of our shortest trips, but one that was filled with the most details of them all, so its visual narrative will run during two months, starting in Luling, TX, and its delicious BBQ that we ate looking at the amazing natural beauty under the mist, of the surrounding old Hacienda-Restaurant at Gruene, TX! Unforgettable moments were those, such as all the others from our trips to N.Y., N. O., Galveston, etc. I pray for her day and night, now that we are far away, for us to soon be soon together again as per the divine will of God, and only His, our good Father that always answers our prayers: |
So, starting today, on this Monday 16th of March, at four months of my meeting of her, a Monday like today on November the 18th, I will be featuring our amazing trip to San Antonio, TX, and the nearby towns on the road that we found, this was one of our shortest trips, but one that was filled with the most details of them all, so its visual narrative will run during two months, starting in Luling, TX, and its delicious BBQ that we ate looking at the amazing natural beauty under the mist, of the surrounding old Hacienda-Restaurant at Gruene, TX! Unforgettable moments were those, such as all the others from our trips to N.Y., N. O., Galveston, etc. I pray for her day and night, now that we are far away, for us to soon be soon together again as per the divine will of God, and only His, our good Father that always answers our prayers:
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Mar 16, 2015, 9:36 PM
Cherubims with long wings were represented at the top of the Ark of the Covenant; unfortunately, Israel started to worship them and in the time of Jeremiah and Ezekiel, the Ark was removed from the Temple, becoming unnecessary; the Temple of Zerubbabel - Hasmonean - Herod that Jesus knew had no Ark, neither will have one his future millennial Temple! Jesus Christ was not concerned about that missing Ark!
Long winged angels decorate the Ark of the Covenant, a golden plated wooden device, not only to communicate audibly with God from the Mercy Seat (the center space of the cover of the Ark, just as if the tips of those wings were the signal receivers), but also contained three things: 10 Commandments on those rock slabs, the manna on that golden cup and the living branch of almond that from being dry and death got green again with leaves, flowers and fruits when being held by Aaron as the sign of him being the chosen one to be the Levitical Holy Priest, and winged angels were all over the Tabernacle and the Temple at Jerusalem, and the Ark was to be spread with the blood of a one year male lamb once a year in the day of Atonement, the only day the Holy Priest was allowed to enter into the Holy of Holies place!!! In this age of Grace we are the Holy of Holies, with the Spiritual Law of Love ingrained within us, we just need to listen to it by our free will, but it is already there!!!, with the spiritual gift of heaven within us to live forever, and with that, sorry to the deliberate ignoring deniers and to the high-minded about themselves vain glorious leaders, but with that I was saying, with the unique privilege to be the direct contact for the rest of the humanity with God, as if each of us were a Holy Priest for Christ on earth!!! to Love as God so Loved the World!!!, with direct contact to God and with all the angels at our service!!!
Updated Mar 16, 2020, 7:23 AM
Updated Mar 15, 2020, 11:50 PM
Updated Mar 15, 2020, 9:18 PM
Updated Mar 15, 2020, 9:18 PM
Updated Mar 15, 2020, 9:18 PM
"I am scared of not being with you", M. M. Reading Dolly and Corinthians, "You Are My Angel", M. M.: https://www.youtube.com/watch?v=QENj0UOb4Hk, and "Only Hope"!!!: https://www.youtube.com/watch?v=obBUZEKuAgM
The great song that I heard for the first time in the dear house of Will alnd Syl: https://www.youtube.com/watch?v=JtMUIwOE2ss
Updated Mar 14, 2020, 9:53 PM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Mar 12, 2015, 1:13 PM
The Tabernacle and the Temple were designed by God according to the Pattern, or Model, of His Heavenly City, the New and Holy Jerusalem; even Eden was designed according to the same Celestial Pattern. More on this at: http://askelm.com/temple/t040301.htm
"The Temple of Solomon and the Tabernacle of Moses are exactly the same pattern and replicas of the City of God in heaven and of its model: Paradise on earth with Adam and Eve at the very beginning!!!! OMG, God is superbly wise and awesome!!!!" Statement to the one I Love, witnessing about the Wise Wisdom Wisdomly done by GOD, our real DAD!!!:
Updated Mar 12, 2020, 6:40 AM
Updated Mar 11, 2020, 3:59 PM
Updated Mar 11, 2020, 2:25 PM
Updated Mar 11, 2020, 9:15 AM
The reality of my Love for her: Science, Insomnia and Art!!! And a path to her heart with the assistance of God under a long and rainy night, after The Surreal Press Lounge with its blue lit pool outdoors and a classic Joe's Pizza where DiCaprio sat, and His protection, and a brand new day of a walk through Wall Street!!! Then to the good green Wicked at Broadway, ending twice lost at the Ubers in Brooklyn, stuck with the Lovehoney rock band in our ears while dancing closely to these beats that are telling the truth about how we feel... What I can understand that the female singer says is: "Tell them how you make me feel for you, boy... I can't let you go" |
The reality of my Love for her: Science, Insomnia and Art!!! And a path to her heart with the assistance of God under a long and rainy night, after The Surreal Press Lounge with its blue lit pool outdoors and a classic Joe's Pizza where DiCaprio sat, and His protection, and a brand new day of a walk through Wall Street!!! Then to the good green Wicked at Broadway, ending twice lost at the Ubers in Brooklyn, stuck with the Lovehoney rock band in our ears while dancing closely to these beats that are telling the truth about how we feel... What I can understand that the female singer says is: "Tell them how you make me feel for you, boy... I can't let you go"
An Ocean Apart
Julie Delpy (actress, composer and singer)
"Now we are together
Sitting outside in the sunshine
But soon we'll be apart
And soon it'll be night at noon
Now things are fine
The clouds are far away up in the sky
But soon I'll be on a plane
And soon you'll feel the cold rain
You promised to stay in touch when we're apart
You promised before I left that you'll always love me
Time goes by and people cry and everything goes too fast
Now we have each other
Enjoying each moment with one another
But soon I'll be miles away
And soon the phone will be our only way
Now I'm in your arms
Feeling pure love and warm
But soon I'll be alone
And soon your voice will change of tone
You promised we'll never break up over the telephone
You said our love was stronger than an ocean apart
Time goes by and people lie and everything goes too fast
Let's not fool ourselves in vain
This far away trip will give us pain
We'll have to be so strong
To keep our love from going wrong
Distance will make us cold
Even put our love on hold
But soon we'll meet again
And soon it'll be bright at noon again
You promised not to loose faith in our love when I'm away
You promised so much to me but now you've left me
We go by and then we lie and all this time we wasted
Time goes by and people lie and everything goes too fast
Time went by and then we died and everything went too fast
Everything went too fast (Repeat Two More Times).
https://www.youtube.com/watch?v=F-oBFW2_D0k
Julie Delpy (actress, composer and singer)
"Now we are together
Sitting outside in the sunshine
But soon we'll be apart
And soon it'll be night at noon
Now things are fine
The clouds are far away up in the sky
But soon I'll be on a plane
And soon you'll feel the cold rain
You promised to stay in touch when we're apart
You promised before I left that you'll always love me
Time goes by and people cry and everything goes too fast
Now we have each other
Enjoying each moment with one another
But soon I'll be miles away
And soon the phone will be our only way
Now I'm in your arms
Feeling pure love and warm
But soon I'll be alone
And soon your voice will change of tone
You promised we'll never break up over the telephone
You said our love was stronger than an ocean apart
Time goes by and people lie and everything goes too fast
Let's not fool ourselves in vain
This far away trip will give us pain
We'll have to be so strong
To keep our love from going wrong
Distance will make us cold
Even put our love on hold
But soon we'll meet again
And soon it'll be bright at noon again
You promised not to loose faith in our love when I'm away
You promised so much to me but now you've left me
We go by and then we lie and all this time we wasted
Time goes by and people lie and everything goes too fast
Time went by and then we died and everything went too fast
Everything went too fast (Repeat Two More Times).
https://www.youtube.com/watch?v=F-oBFW2_D0k
Updated Mar 10, 2020, 1:41 PM
"Daydream delusion"
By David Jewell (at "Before Sunrise", 1995)
Limousine eyelash
Oh, baby, with your pretty face
Drop a tear in my wine glass
Look at those big eyes
See what you mean to me
Sweetcakes and milkshakes
I am a delusion angel
I'm a fantasy parade
I want you to know what I think
Don't want you to guess anymore
You have no idea where I came from
We have no idea where we're going
Lodged in life
Like branches in the river
Flowing downstream
Caught in the current
I carry you
You'll carry me
That's how it could be
Don't you know me?
Don't you know me by now?"
https://www.youtube.com/watch?v=GXmqCyKhZtw, https://web.archive.org/web/20190708215556/http://davidjewellpoet.com/
By David Jewell (at "Before Sunrise", 1995)
Limousine eyelash
Oh, baby, with your pretty face
Drop a tear in my wine glass
Look at those big eyes
See what you mean to me
Sweetcakes and milkshakes
I am a delusion angel
I'm a fantasy parade
I want you to know what I think
Don't want you to guess anymore
You have no idea where I came from
We have no idea where we're going
Lodged in life
Like branches in the river
Flowing downstream
Caught in the current
I carry you
You'll carry me
That's how it could be
Don't you know me?
Don't you know me by now?"
https://www.youtube.com/watch?v=GXmqCyKhZtw, https://web.archive.org/web/20190708215556/http://davidjewellpoet.com/
Updated Mar 9, 2020, 12:59 PM
The Oops and Downs between a man and woman, finding that there is something by the grace of God, even when we thought that there was just a Notting on our Hill!
From Ireland, with P.S. I Love U!!!: https://www.youtube.com/watch?v=SNs0vKDvs0g
Updated Mar 7, 2020, 8:16 PM
Few moments of real fun a happiness are worth a lifetime... but what better than to aim at their endurance a little more? From One Day to some years together, with the intention of a little more of the other every single day, with never ever taking for granted that unique presence that can be near to you, at least maybe for the rest of your lifetime, God willing...
Updated Mar 7, 2020, 1:51 AM
Updated Mar 6, 2020, 4:56 PM
Updated Mar 6, 2020, 3:23 PM
Updated Mar 6, 2020, 8:23 AM
"It’s those that are there when you hit rock bottom that truly matter. And it’s on these foundations that you build on again. It’s on this love that you build on again. There’s something about having your heart cracked open that just leaves you completely… real. Real and open. Broken open. When you’re open, life begins to flow 'through' you...." Noelle Aquila. (Thanks to the girl that I like with all my soul for showing me these encouraging links to keep on going even through those roughest times of life... the very few that keep in touch without giving their backs when you are down, are the real ones that care for you, not all those that just say from their lips out without any love whatsoever: "Lord, Lord...", if others ask me to apologize, I respond by saying that rather, even when I already apologized as much as they wanted me to do it just for my sin of admiring them and of attempting to communicate with them, I must say now that a brief window of opportunity, however insignificant or undesirable that it was, temporarily opened upon them, but out of a sudden that kairos of grace has been closed! To fully focus myself now on shining the light of my whole existence into only The One, who happens to be the same that I have ever liked from the start, but I was unaware of her existence until now!). And of course, I want to illustrate this one, with a song I sent to the One I Love: https://www.youtube.com/watch?v=5UUGt2p_hwY, with my full Love!!!
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Mar 4, 2015, 10:23 PM
The Bible mentions that the Book of God (Ps. 139:16) had all the instructions to form the human body; that ‘Book’ is ‘the Human Genome’!!! Its foundation is the Genetic Code, the dictionary that translates codons into amino acids!
The perfection of God and His Creation is astounding!!! Wonderfully made as to inspire a permanent source of awe!!!
Updated Mar 4, 2020, 7:19 AM
Dedicated to the one I Love, today my only, and globally my best female ever as per the lively, honest, open and constant communication about everything, with the intense longing to be together very soon again: "Run", by our own dear Texan George Strait, with Miranda Lambert, from The 54th ACM Awards: https://www.youtube.com/watch?v=-xDq5IWozqk
"Run"
By George Strait
If there's a plane or a bus leaving Dallas
I hope you're on it
If there's a train moving fast down the tracks
I hope you caught it
Cause I swear out there ain't where you ought to be
So catch a ride, catch a cab
Don't you know I miss you bad
But don't you walk to me
Baby run, cut a path across the blue skies
Straight in a straight line
You can't get here fast enough
Find a truck and fire it up
Lean on the gas and off the clutch
Leave Dallas in the dust
I need you in a rush
So baby run
If you ain't got a suit case
Get a box or an old brown paper sack
And pack it light or pack it heavy
Take a truck, take a Chevy
Baby just come back
There's a shortcut to the highway out of town
Why don't you take it
Don't let that speed limit slow you down
Go on and break it
Baby run, cut a path across the blue skies
Straight in a straight line
You can't get here fast enough
Find a truck and fire it up
Lean on the gas and off the clutch
Leave Dallas in the dust
I need you in a rush
So baby run
Baby run
Oh baby run
Baby run
"Run"
By George Strait
If there's a plane or a bus leaving Dallas
I hope you're on it
If there's a train moving fast down the tracks
I hope you caught it
Cause I swear out there ain't where you ought to be
So catch a ride, catch a cab
Don't you know I miss you bad
But don't you walk to me
Baby run, cut a path across the blue skies
Straight in a straight line
You can't get here fast enough
Find a truck and fire it up
Lean on the gas and off the clutch
Leave Dallas in the dust
I need you in a rush
So baby run
If you ain't got a suit case
Get a box or an old brown paper sack
And pack it light or pack it heavy
Take a truck, take a Chevy
Baby just come back
There's a shortcut to the highway out of town
Why don't you take it
Don't let that speed limit slow you down
Go on and break it
Baby run, cut a path across the blue skies
Straight in a straight line
You can't get here fast enough
Find a truck and fire it up
Lean on the gas and off the clutch
Leave Dallas in the dust
I need you in a rush
So baby run
Baby run
Oh baby run
Baby run
Updated Mar 3, 2020, 9:03 AM
Updated Mar 3, 2020, 8:43 AM
Updated Mar 3, 2020, 8:43 AM
Updated Mar 2, 2020, 11:09 PM
To the awesome friends and relatives who ask which is the tremendous song from the segments of my current History, it is the one the girl I like and I heard for the first time in at least a couple of those nightly dancing bars of the Bourbon Street, awesomely unique times were those, and we both pray for more of them in the future, please God!!!, here his rendering at the "Austin City Limits", a place I wished to take her, but..., well, maybe next time!!!: https://www.youtube.com/watch?v=IBLruNfUqUs, Lyrics:
Tennessee Whiskey
Chris Stapleton
Album "Traveller"
[Verse 1]
Used to spend my nights out in a barroom
Liquor was the only love I'd known
But you rescued me from reachin' for the bottom
And brought me back from bein' too far gone
[Chorus]
You're as smooth as Tennessee whiskey
You're as sweet as strawberry wine
You're as warm as a glass of brandy
And honey, I stay stoned on your love all the time
[Verse 2]
I've looked for love in all the same old places
Found the bottom of a bottle's always dry
But when you poured out your heart, I didn't waste it
'Cause there's nothin' like your love to get me high
[Chorus]
And you're as smooth as Tennessee whiskey
You're as sweet as strawberry wine
You're as warm as a glass of brandy
And honey, I stay stoned on your love all the time
[Guitar Solo]
[Chorus]
You're as smooth as Tennessee whiskey
You're as sweet as strawberry wine
You're as warm as a glass of brandy
And honey, I stay stoned on your love all the time
[Outro]
You're as smooth as Tennessee whiskey
Tennessee whiskey, Tennessee whiskey
You're as smooth as Tennessee whiskey
Tennessee whiskey, Tennessee whiskey
Tennessee Whiskey
Chris Stapleton
Album "Traveller"
[Verse 1]
Used to spend my nights out in a barroom
Liquor was the only love I'd known
But you rescued me from reachin' for the bottom
And brought me back from bein' too far gone
[Chorus]
You're as smooth as Tennessee whiskey
You're as sweet as strawberry wine
You're as warm as a glass of brandy
And honey, I stay stoned on your love all the time
[Verse 2]
I've looked for love in all the same old places
Found the bottom of a bottle's always dry
But when you poured out your heart, I didn't waste it
'Cause there's nothin' like your love to get me high
[Chorus]
And you're as smooth as Tennessee whiskey
You're as sweet as strawberry wine
You're as warm as a glass of brandy
And honey, I stay stoned on your love all the time
[Guitar Solo]
[Chorus]
You're as smooth as Tennessee whiskey
You're as sweet as strawberry wine
You're as warm as a glass of brandy
And honey, I stay stoned on your love all the time
[Outro]
You're as smooth as Tennessee whiskey
Tennessee whiskey, Tennessee whiskey
You're as smooth as Tennessee whiskey
Tennessee whiskey, Tennessee whiskey
Updated Feb 28, 2020, 7:55 PM
From her preferences: "You Only Live Once!": She made me the happiest man on earth while with her... Here at Galveston, TX, closing the full circle from beginning to end at the same place, committed myself to fulfill any request that she allowed me to fulfill, crustless Gaido's Pecan Pie at the start and at the end of our times in the USA then at "Season's Harvest", Cypress, TX, on the 14th that we spent together from start to finish, which should also speak for itself, then at Louisiana and its endless swamps... the beginning of our far away traveling, then at Luling where we enjoyed their classic BBQ or at least part of it, sausage at seven, whatever tender meat at eight, ribs at nine, God we missed them!!! Then from there to Gruene, TX, to be the total and sole users of the amazing restaurant in the middle or within nature itself! Then time will be needed to put also something from N.Y... as she said, but in my case rendering the first line as, Hehee!: "God, You gleam and glow...": https://www.youtube.com/watch?v=VGa-j8KFMEc, is that better? Needed to sever any indication of her presence as per her request, but she lives in my heart, what can I do but cry?
Dear parents of her, I just wanted to go there and ask for her hand in person (and will, God willing!), as she had mentioned that on the first day and yesterday... I am a believer who every single day renews his strength in the Lord. ...Thank you for being the parents of such an awesome lady!!! With my best regards for her and for you, the free spirit of myself. Is. 40:29 "He gives strength to the weary / and increases the power of the weak. / 30 Even youths grow tired and weary, / and young men stumble and fall; / 31 but those who hope in the Lord / will renew their strength. / They will soar on wings like eagles; / they will run and not grow weary, / they will walk and not be faint."
Coronavirus Disease 19 (COVID-19) research: https://www.thelancet.com/coronavirus (but once I realized that the "official" medicine was mostly sold to the Devil, I undertook my own and ongoing research: https://www.researchgate.net/post/Third_Sequence_COVID-19_AATGGTACTAAGAGG_HIV-1_isolate_1966324H9_from_Netherlands_envelope_glycoprotein_env_gene_sequence_ID_GU4555031, of which one publication has been peer-reviewed and published: https://zenodo.org/record/3988139#.Xz_ogchKi00), and a free training and certificate: https://alison.com/course/coronavirus-what-you-need-to-know, its impact in the Stock Exchange at the Wall Street of New York: https://www.businessinsider.com/stock-market-crash-coronavirus-could-cause-major-selloff-raoul-pal-2020-2, and the efforts of the USA to minimize its effects in its Citizens: https://nypost.com/2020/02/26/trump-outlines-us-response-to-coronavirus-threat-calls-risk-very-low/; update for the 20th of March, 2020, the use of hydroxychloroquine and azithromycin to reduce the effects of this virus: https://web.archive.org/web/20200320000008/https://www.mediterranee-infection.com/wp-content/uploads/2020/03/Hydroxychloroquine_final_DOI_IJAA.pdf
This is the card that expresses my genuine heart towards her, obtained for the both of us at that nice little store nearby to, basically to our last dessert at that excellent and saturated "Common Bond" place at Montrose: "It's You And Me To The End":
Fernando Castro-Chavez added an item to the featured collection: Highlight.
Feb 26, 2020, 3:05 PM
Fernando Castro-Chavez created the featured collection: Highlight.
Feb 26, 2020, 3:05 PM
Fernando Castro-Chavez shared a memory.
Fragmento inicial del primer y gran recorrido teatroturístico de "La feria" de Arreola en Zapotlán el Grande, iniciando en la "Casa Taller Literario Juan José Arreola", ayer (25 de feb., 2018): |
3 Years Ago
Feb 26, 2018, 3:54 PM
Fragmento inicial del primer y gran recorrido teatroturístico de "La feria" de Arreola en Zapotlán el Grande, iniciando en la "Casa Taller Literario Juan José Arreola", ayer (25 de feb., 2018):
Touring through the Universe still alone.., praying to keep on doing it, but accompanied by the One, the One best of the best of all women ever sent to me by GOD:
Updated Feb 26, 2020, 10:12 AM
This video is because the woman that I like very much just dedicated this song to us as a treasured metaphor of our traveling together during the past three months, especially to the great outsides from Houston: https://www.youtube.com/watch?v=h04CH9YZcpI
Updated Feb 24, 2020, 11:31 PM
Fernando Castro-Chavez updated his status.
Writers, writers, bless the soul of the writers :
This is the Fernando of today at the early morning, saying goodbye to the past and putting his eyes into the present, asking God for the best of the best as his female companion (but I keep on asking God stubbornly for the one I like), receiving for God a compassionate woman, that he is still awaiting for, a female willing to really care for him, with feelings and love, just as he cares, feels and loves for the one that God will send to him. And my Instagram with memories long gone: https://www.instagram.com/fdocc2/.
Updated Feb 24, 2020, 2:15 AM
Updated Feb 22, 2020, 8:20 PM
You tagged 沈信學 and Deisy J. Camargo
Remembering some of the best moments of October 2019 in the company of my great colleague and neighbor from Taiwan, while in Valhalla, at the NYMC, in N.Y. 沈信學 (two amazing trips there!), and then in our one trip to Philadelphia, where we had the privilege to meet, from Colombia Deisy J. Camargo and her friend, as well as when we met in the second floor of the McDonalds near Fifth Avenue at N.Y., the French Marina Gordo and her male friend from the Bronx, then after Dr. Shen, the lady that I like arrived, just a month later, and from then since, my head is spinning around her..., now away from my reach...:
The transforming service that I experienced with the girl that I really want, at the Lakewood Church, before her departure:
Windows of Grace, Feb. 16, 2020, 11:00 AM
"There are some moments when God gives us special grace to do something new. It's a temporary window of opportunity that can take you to places you couldn't go on your own. Don't put off what you know God is asking you to do. This is your moment. As you step out in faith, you're going to see His favor like never before!": https://www.lakewoodchurch.com/watch-online/2020/February/2020-02-16-1100-joelosteen (His sermon starts at 1:10:32, his powerful prayer is at 25:53)
Windows of Grace, Feb. 16, 2020, 11:00 AM
"There are some moments when God gives us special grace to do something new. It's a temporary window of opportunity that can take you to places you couldn't go on your own. Don't put off what you know God is asking you to do. This is your moment. As you step out in faith, you're going to see His favor like never before!": https://www.lakewoodchurch.com/watch-online/2020/February/2020-02-16-1100-joelosteen (His sermon starts at 1:10:32, his powerful prayer is at 25:53)
Updated Feb 19, 2020, 8:32 PM
Starting to read today the "Part Two: Legacy" of "Outliers" by GladWell, the "Part One: Opportunity" and the "Introduction: The Roseto Mystery" were read yesterday.
The book that she gave me before her departure (one day earlier we went to listen Joel Osteen who talked about the windows of opportunity of God, that for the Israelites were 11 days to enter the Promised Land but they did not believe and it took them 40 years to do so; but in the case of Felix, he apparently just refused to believe; then he shared two examples, the two week only window of opportunity of DeVon Franklin, producer, to have his own company (Franklin Entertainment) under the sponsorship of Sony Pictures, and the one day only window of opportunity for Joel himself to Preach for the first time the very same Sunday that his father passed away, after putting away during 17 years even the idea that he was able to do it!!! In my case, God gave me a window of opportunity to treat basically full time a Princess, that today when she left, miraculously God allowed me to figure out the three number combination that had been forgotten, to open her carry-on luggage, but that were needed to balance the weight of her luggage, thus saving her to pay extra weight charges!!! Thank You Dear Heavenly Father for allowing us to live a life of daily miracles!!! And for the big windows that You and only You are opening for the future!!!)
A piece of that perpetual reminder of the good times and the bad times that we together lived at New York, location of the video: |
A piece of that perpetual reminder of the good times and the bad times that we together lived at New York, location of the video:
Fernando Castro-Chavez shared a memory.
2 Years Ago
Feb 16, 2019, 8:38 AM
Juan Luis Guerra, el pez dominicano, nuestro cristiano hermano, se añade al evento por el que estamos orando (y más se van agregando a cada día que pasa): https://web.archive.org/web/20190216142559/https://www.elheraldo.co/mundo/el-22-de-febrero-sera-el-concierto-por-la-libertad-de-venezuela-en-cucuta-597907 Para que salga en paz, pues Dios quiere que se arrepienta el pecador y no que muera, a no ser que el pecador mismo no lo desee y prefiera morir en su mentira (refiriéndonos aquí, a la vida eterna, pues la otra: de cualquier forma tal vez ya esté perdida), ya que como antes se veía: https://web.archive.org/web/20190203010750/https://www.infobae.com/opinion/2019/01/10/la-ilegitimidad-de-maduro/ No se trata, como dicen algunos (incluyendo al farsante mismo)..., de un deseo imperialista por echarlo fuera, sino de un deseo de todos los seres de bien del planeta para que se salga aquello que está podrido y para que quede lo bueno (si no, pregúntenles a los mismos ciudadanos de aquel país de entre aquellos millones que lo han abandonado y que son nuestros hermanos en Cristo, incluyendo a aquellas que se han prostituido para poder sobrevivir en el extranjero 🙁). ¡Ah! Y para que a continuación caiga también "el liderazgo", largo tiempo corrupto, de aquel país malsano que lo está ayudando, y a quien ese cerdo sobrealimentado (me refiero al "nicolaitano" de moros, aquel que le muestra al mundo su total inmadurez con cada palabra, con cada berrinche, y con cada dancilla que él hace) está ayudando también ¡a pura costa de su propio pueblo!
Updated Feb 16, 2020, 7:26 AM
Updated Feb 16, 2020, 12:10 AM
Updated Feb 9, 2020, 12:31 AM
“I heard that as a gospel song ...I don’t know that the writer ever meant it to be that, but that’s what it is”. Johnny Cash. Lyrics based on the autobiography "Elvis And Me", by Priscilla Presley". "It's about how Elvis Presley was her man and her mentor", said Depeche Mode: https://www.youtube.com/watch?v=i2GEOcEcRtY, J. Cash version: https://www.youtube.com/watch?v=lw3U0nQwNco
"Personal Jesus"
By Depeche Mode
Reach out and touch faith
Your own personal Jesus
Someone to hear your prayers
Someone who cares
Your own personal Jesus
Someone to hear your prayers
Someone who's there
Feeling unknown
And you're all alone
Flesh and bone
By the telephone
Lift up the receiver
I'll make you a believer
Take second best
Put me to the test
Things on your chest
You need to confess
I will deliver
You know I'm a forgiver
Reach out and touch faith
Reach out and touch faith
Your own personal Jesus
Someone to hear your prayers
Someone who cares
Your own personal Jesus
Someone to hear your prayers
Someone who's there
Feeling unknown
And you're all alone
Flesh and bone
By the telephone
Lift up the receiver
I'll make you a believer
I will deliver
You know I'm a forgiver
Reach out and touch faith
Your own personal Jesus
Reach out and touch faith
"Personal Jesus"
By Depeche Mode
Reach out and touch faith
Your own personal Jesus
Someone to hear your prayers
Someone who cares
Your own personal Jesus
Someone to hear your prayers
Someone who's there
Feeling unknown
And you're all alone
Flesh and bone
By the telephone
Lift up the receiver
I'll make you a believer
Take second best
Put me to the test
Things on your chest
You need to confess
I will deliver
You know I'm a forgiver
Reach out and touch faith
Reach out and touch faith
Your own personal Jesus
Someone to hear your prayers
Someone who cares
Your own personal Jesus
Someone to hear your prayers
Someone who's there
Feeling unknown
And you're all alone
Flesh and bone
By the telephone
Lift up the receiver
I'll make you a believer
I will deliver
You know I'm a forgiver
Reach out and touch faith
Your own personal Jesus
Reach out and touch faith
Updated Feb 8, 2020, 8:30 AM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Feb 8, 2016, 10:19 AM
Santos, Nuestra amada hermana en Cristo, Claudia Juárez Garbalena nos comparte lo siguiente: https://www.youtube.com/watch?v=U5DEfLeUx9w (Coherederos de la Gracia de la Vida) Otras lecturas de Claudia: https://www.youtube.com/channel/UCCbLi9UnKI1lZUEiVOGvFqA Cuyas recientes entradas incluyen:
Cinco palabras para vivir a través de ellas: "La batalla es del Señor".
Un hombre en quien está el espíritu de Dios.
La finalidad del Evangelio.
Jesucristo: La Palabra de Dios Encarnada.
¿Ves esta mujer? (Lucas 7:44).
Liberación de sus prisiones.
Sobre el Libro de Cantares.
Sobre el Salmo 23.
Un Reposo para el Pueblo de Dios.
Cristo en ti, la Tierra Prometida (1 y 2).
Los Beneficios de Dios. Breve estudio de Salmos 103, etc…
Gracias Claudia por tu labor incondicional de AMOR! En Cristo, Fernando.
Updated Feb 8, 2020, 7:24 AM
Fernando Castro-Chavez shared a memory.
7 Years Ago
Fernando Castro-Chavez updated his status.
Feb 7, 2014, 10:25 PM
Para nuestras exploraciones e investigaciones de "La Palabra (de Dios) y la Ciencia", uno de los gráficos que ayudarán a entender la Palabra escrita en los cielos (lo que NO ES astrología) es (del libro de Bullinger): http://www.biblebelievers.org.au/images/planisph.jpg Jesús es representado en el Hércules que le está aplastando la cabeza al dragón cerca del centro, Jesús es el que aplasta al escorpión, sujetando a la serpiente para evitar que alcanze a la Corona (Borealis), Jesús es el León (Leo) que aplasta la cabeza de la serpiente, Jesús es el cordero (Aries) que aplasta la cabeza del monstruo marino, Jesús es el Orión que aplasta la cabeza de una fiera, Jesús es el jinete del caballo que viene a vencer al mal...
Updated Feb 7, 2020, 10:10 AM
Dedicated to the One I Love: From Sinatra to Oasis, from Crooners to Rockers, from P.J. Clarke’s at NY to England, in this February's romantic month, cold as per to be the cozy times; as per for my case, still in black and white, but starting to show a little guitar color, even if those are still changing all the time!!! ;), so, these two are dedicated to the One I Want, to the One I Need: https://www.youtube.com/watch?v=xhi59CAx7wk and https://www.youtube.com/watch?v=6hzrDeceEKc
Updated Feb 6, 2020, 10:05 AM
Buscándole, buscándole, me encontré con una foto aún más antigua!!! También del colegio Salesiano de Don Bosco, extinto y llamado Anáhuac Cordilleras... con vestigios alimenticios de mi actual princesa asiática (de las ciudades de N.O. y S.A.; el veredicto fue que la primera, una clásica, fue mucho más sabrosa que la segunda... en aquel Restaurante rotante...), pero sin ponerla a ella, a petición personal de ella: discreción, discreción es lo que ella me pide (pero sí, todo lo que he vivido y todo lo que me resta por vivir, como que toma su sentido cabal en ella), y bueno, la melodía que quisiera agregar aquí es otra de las clásicas de estos días que nos hemos encontrado, ésta procedente de TN pero escuchada en múltiples ocasiones en nuestra estancia en N.O. (al punto que le dije: Hey!, ese es nuestro tema!!!): https://www.youtube.com/watch?v=IBLruNfUqUs, here are the lyrics of that "astoundically" methaphorical country song:
Tennessee Whiskey
Chris Stapleton
I used to spend my nights out in a barroom
Liquor was the only love I've known
But you rescued me from reachin' for the bottom
And brought me back from being too far gone
You're as smooth as Tennessee whiskey
You're as sweet as strawberry wine
You're as warm as a glass of brandy
And honey, I stay stoned on your love all the time
I've looked for love in all the same old places
Found the bottom of a bottle always dry
But when you poured out your heart I didn't waste it
'Cause there's nothing like your love to get me high
You're as smooth as Tennessee whiskey
You're as sweet as strawberry wine
You're as warm as a glass of brandy
And honey, I stay stoned on your love all the time (Repeat)
You're as smooth as Tennessee whiskey
Tennessee whiskey
Tennessee whiskey (Repeat)
Tennessee Whiskey
Chris Stapleton
I used to spend my nights out in a barroom
Liquor was the only love I've known
But you rescued me from reachin' for the bottom
And brought me back from being too far gone
You're as smooth as Tennessee whiskey
You're as sweet as strawberry wine
You're as warm as a glass of brandy
And honey, I stay stoned on your love all the time
I've looked for love in all the same old places
Found the bottom of a bottle always dry
But when you poured out your heart I didn't waste it
'Cause there's nothing like your love to get me high
You're as smooth as Tennessee whiskey
You're as sweet as strawberry wine
You're as warm as a glass of brandy
And honey, I stay stoned on your love all the time (Repeat)
You're as smooth as Tennessee whiskey
Tennessee whiskey
Tennessee whiskey (Repeat)
Recuerdos, recuerdos: Aquí es cuando yo estaba en Sexto de Primaria del Colegio Anáhuac Cordilleras (gracias a Jorge Taboada Gámez, con su "Mickey Mouse", por la información), Colegio Salesiano de Don Bosco, ¿quién seré yo? En ese entonces la niña de apariencia asiática que me derretía es la que aparece a la derecha de la foto segunda...; la primera novia formal que tuve, en Cuernavaca, tenía ese bello estilo oriental; and, the song that I just dedicated to my new oriental fascination is this one (And I pray on my knees that God may grant me her heart!!!, just by His infinite grace!!!): https://www.youtube.com/watch?v=iqL1BLzn3qc, "Good Times"
Edie Brickell & New Bohemians (Featuring Barry White!!!)
You don't even have to try
It comes easy for you
The way you move is so appealing
It could make me cry
Go out driving with my friends
In Bobby's big old beat up car
I'm with a lot of people then
I wonder where you are
Good times, bad times, give me some of that... (Repeat two more times)
I don't want to say goodbye
Don't want to walk you to the door
I spend a little time with you
I want a little more
Good times, bad times, give me some of that...
(Then we hear the sultry voice of Barry White himself saying the next words!!!:)
"And baby really, I don't have to
I don't have to go anywhere right now
You want some more, you want some more of this
Anywhere where you want baby, just
Just say it, just say it"
Good times, bad times, gimme some of that...
Now I want those good, good, good times
And got those bad, bad, bad times
I want those good, good, good, good times
Gimme some of that!!!
Edie Brickell & New Bohemians (Featuring Barry White!!!)
You don't even have to try
It comes easy for you
The way you move is so appealing
It could make me cry
Go out driving with my friends
In Bobby's big old beat up car
I'm with a lot of people then
I wonder where you are
Good times, bad times, give me some of that... (Repeat two more times)
I don't want to say goodbye
Don't want to walk you to the door
I spend a little time with you
I want a little more
Good times, bad times, give me some of that...
(Then we hear the sultry voice of Barry White himself saying the next words!!!:)
"And baby really, I don't have to
I don't have to go anywhere right now
You want some more, you want some more of this
Anywhere where you want baby, just
Just say it, just say it"
Good times, bad times, gimme some of that...
Now I want those good, good, good times
And got those bad, bad, bad times
I want those good, good, good, good times
Gimme some of that!!!
Agape, Philia, Eros & Storge!!!: https://www.adweek.com/brand-marketing/new-york-lifes-first-super-bowl-spot-in-30-years-is-all-about-love-through-action, by N.Y... (The best original commercial at the Super Bowl LIV, where the Chiefs of Kansas won 31 to 20 over the 49ers of San Francisco):
Updated Feb 2, 2020, 9:12 PM
The Chinatown of Houston as it looks today in its most popular corner (I was crying inside while taking all of these photos as she was basically about to be taken from me to be used and abused, by her free will, by a pervert man during the four saddest days of my whole life thus far... God, I wish the worst for him, and for the one or ones that took that treasured promise made and broken by herself... but God exhorts us to forgive, that He is The Judge!):
Fernando Castro-Chavez shared a memory.
4 Years Ago
Feb 1, 2017, 8:12 PM
Saint, When you search for the second sentence on the Internet, that of: "The Bible is not man's word about God, but God's word about man", you see that such phrase is almost unanimously attributed to the wrong Barth (meaning to John Barth, the American writer, and not to Karl Barth, the Swiss theologian, as it should be). One of the very few that got it right, the scanned material at Google Books!: http://tinyurl.com/karlbarth2 and http://tinyurl.com/karlbarth1 , and of course, its original source: Time, 20, Dec., 1968. So, beware! In Christ, Fernando.
Updated Feb 1, 2020, 7:53 AM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Jan 28, 2016, 11:31 AM
Es importante cuanto antes activar los Cinco Dones de Ministerio para el sano crecimiento del Cuerpo de Cristo, para evitar cosas como que los Judas, Ananías y Safiras de hoy controlen las finanzas que legalmente le corresponden a TODO el Cuerpo de Cristo, y para evitar que lobos rapaces intenten diezmar los corazones de los santos, o que personas se auto-engañen en "visiones" y "profecías" que no aprovechan. Por ejemplo, aquí presento un mensaje que le escribí a un creyente, pero si hubiera un equipo de profetas dentro del Cuerpo, en grupo se diría aún con mayor precisión y amor, ¡como plata refinada siete veces!: “Con humildad recomiendo que tú mismo te presentes con toda humildad y mansedumbre ante los demás. Cualquier luz verdadera que pudiéramos recibir es de lo alto, y ésta nos edifica y nos llena de gozo, y no de confusión. Dios Mismo es el Único que Revela Sus Secretos Divinos a los humildes, y esto está en plural, no solamente a uno sólo, ya que uno sólo pudiera fallar, sino en plural, y nos dice: ¡A Sus Santos Apóstoles y Profetas! ¡No es bueno jactarse de nada! Solamente Dios es quien nos exalta, no nosotros a nosotros mismos, eso cae de peso. En México decimos que: "Cae primero un hablador que un cojo". ¡Hemos aprendido que no importa quien cante, lo importante es que la canción se cante! Esto es como un ejercicio de humildad. Espero que no me tomes a mal lo que te digo, pero en mi espíritu confío en que es por tu bien el decirte que necesitas presentarte con una humildad genuina, y no con altivez para que tus palabras sean recibidas por los santos. Si me equivoco, por favor házmelo saber. En Cristo, Fernando.”
Updated Jan 28, 2020, 11:18 AM
Updated Jan 28, 2020, 11:18 AM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Jan 27, 2016, 3:42 PM
Otros versículos mal entendidos (1 Cor. 12:29-30) han evitado la plena manifestación de los Cinco Dones de Ministerio para el grupo Cristiano, y ¡aún han evitado la plena manifestación del Don de espíritu santo para el individuo Cristiano! La respuesta es afirmativa para las últimas 4 preguntas que Pablo hace, ¡y también lo es para sus primeras 3 preguntas! El griego usa exactamente la misma forma en ambos casos. Una traducción más precisa es: "¿No son todos apóstoles?, ¿no son todos profetas?, ¿no son todos maestros?, ¿no pueden todos hacer obras de milagros?, ¿no tienen todos dones de sanaciones?, ¿no pueden todos hablar en lenguas?, ¿no pueden todos interpretar?" El caso que Pablo establece es que a pesar de que todos pueden hacerlo todo, que la forma de hacerlo ha de ser en orden, y, luego nos dice que: ¡en AMOR! ¿Acaso los santos siguen en espera erróneamente de que Cristo mismo descienda y les apunte con su dedo que es lo que ya son? ¡No, no es así como funciona! Jesús ya nos lo dio TODO a partir de Pentecostés: ¡TODA la plenitud de TODA potencia espiritual!, lo que incluye a ¡TODOS los Dones de Ministerio dentro de cada creyente! Lo curioso es que aunque el interlineal en inglés está correcto y el interlineal en español está erróneo, ni en grupos Cristianos de habla inglesa o hispana se ha desatado deliberadamente el uso los Cinco Dones de Ministerio por parte del Cuerpo de Cristo, los santos en grupo son los responsables de su activación, ¡Jesús ya se los ha dado a cada uno! De nuevo culpo a los líderes por no motivar a los santos de sus grupos a "anhelar manifestar ardientemente todo asunto espiritual", ¡que precisamente es la frase que sigue y con la que comienza el capítulo 14! ¡Ya es tiempo de que esto cambie con su creyente corazón de servicio, por favor, oh santos! ¡Yo no me quiero morir sin haber gozado de todo esto por culpa de los malsanos líderes! ¡Por favor!!! Interlineal Español: http://tinyurl.com/nt-interlin-lacueva e Inglés: http://biblehub.com/interlinear/1_corinthians/12.htm
Another evident error in translation of the conditional negative "me", which when translated properly indicates that each born-again believer has the full potential at will to exert any of the five gifts of service, even when in practice is more comfortable with one or two of them, but if the need is present, spiritually is already enabled to act in any of those five sensical spiritual endowments:
Updated Jan 27, 2020, 8:15 AM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Jan 26, 2016, 6:48 PM
La foto de abajo es evidencia adicional de que una mala traducción limita la plenitud de la verdad escrita, en este caso, es la palabra griega "tous", que se ha mal traducido como "algunos" y "otros" en relación con los Dones de Ministerio, pero que la gran mayoría de las 740 veces que aparece se traduce como "LOS", lo que indicaría que todo creyente renacido, según sea necesario, puede ejercer, si tiene en su corazón el servir y no el ser servido, los Cinco Dones de Ministerio que son los Cinco Sentidos del Cuerpo de Cristo! Ninguno de nosotros al nacer carece de ellos, verdad? Y acaso es posible el pensar que Dios ha hecho menos por nosotros, el Cuerpo de Su amado hijo sobre la tierra hoy? Imaginen que absurdo sería pensar que Dios es capaz de rechazarte y de decirte: “Lo siento mucho, tú no puedes usar los Dones de Ministerio, no sirves para ninguno de ellos”! Pues por más raro que parezca, esto es lo que un liderazgo envanecido y egoísta ha estado asumiendo hasta hoy! Malos pastores de las ovejas del Cristo, su tiempo se ha agotado, es tiempo de que el Cuerpo mismo de los creyentes se apodere de los Dones que les pertenecen, sin importar la opinión de líderes vanos!!! [Herramientas en inglés lo demuestran: http://biblehub.com/interlinear/ephesians/4.htm]
"Tous" is not "Some", as it has been wrongfully translated, but "THE", because by such translation of "Some", it has been limited the plentiful blessing of those freely available, since Pentecost, gifts of service to the Body of Christ for the perfecting of the saints, given by Jesus under the authorization of God, check them out, because you already have them all within!!!:
Updated Jan 26, 2020, 9:05 AM
Updated Jan 26, 2020, 6:11 AM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Jan 25, 2016, 8:38 AM
Y Santos muy Amados, ¡Si llevan muchos años bajo un grupo cristiano carente del crecimiento directo que Cristo da, y aquí en los Estados Unidos, ¡aún la mayoría de los líderes, después de más de 30 años de servir, aún se extrañan mucho de que pueden consultar directamente con Cristo, lo que se refleja en grupos sin espíritu que ni crecen, o peor aún, que desaparecen!; por lo que, aún cuando la enseñanza de la Biblia sea correcta allí, los que enseñan, se den cuenta o no, están siendo usados por las astutas estratagemas del Adversario, por sus propias mentes y sus debilidades de vanidad, evitando siempre llegar al centro de nuestra era de gracia: ¡Que cada creyente puede comunicarse directamente con Cristo, la cabeza, de forma tal que cumpla con su función en el Cuerpo de Cristo al usar los Cinco Dones de Ministerio, y el resto de los Dones de Servicio, según Cristo mismo lo guíe, para un verdadero crecimiento conforme a Cristo, y no conforme a líderes plagados de debilidades carnales, y yo me incluyo!
Updated Jan 25, 2020, 9:48 AM
"The best thing that we can do right now is pray, ...pray in the name of Jesus Christ and just ask God to help us all, ...and just believe, ...that's it!", Gabriel Oliver, Christian Brother, Boss, Home-mate at the area of the explosions: https://www.youtube.com/watch?v=4NxHjeidxZ0
Updated Jan 24, 2020, 10:24 AM
"Houston, we can use your prayers right now", Mark Brady, Artist, Coworker, Housemate at Rockcrest in Spring Branch Houston: https://www.youtube.com/watch?v=7VjFTni_Ch8
Updated Jan 24, 2020, 10:10 AM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Jan 20, 2016, 11:21 AM
Santos Amados, Hoy llegó mi amigo FB # 3000: "Biblia Santa Valera"!!! A éste y a todos ustedes, santos de todos los colores y sabores, comento con toda humildad y mansedumbre que hoy investigo acerca de la consciente y deliberada activación de los 5 Dones del Ministerio de la Reconciliación por parte de los miembros de cada grupo del Cuerpo de Cristo! Herramientas que uso para capturar lo que dice la Escritura acerca de cada Don de Servicio: http://www.lcoggt.org/Wescott-Hort-Robinson-GreekNT.pdf , https://elmundobiblicodigital.files.wordpress.com/2015/03/252784253-nuevo-testamento-interlineal-griego-espanol-de-francisco-lacueva-barcelona-editorial-clie-1984-version-completa-y-optimizada-pdf.pdf , http://biblehub.com/interlinear/ephesians/4.htm Y, extra, los interlineales del A.T.: https://elmundobiblicodigital.files.wordpress.com/2014/02/a-t-interlineal-hebreo-espac3b1ol-vol-i.pdf , https://elmundobiblicodigital.files.wordpress.com/2014/02/a-t-interlineal-hebreo-espanol-vol-ii-pdf.pdf , https://elmundobiblicodigital.files.wordpress.com/2014/02/a-t-interlineal-hebreo-espanol-vol-iii-pdf.pdf , https://elmundobiblicodigital.files.wordpress.com/2014/02/a-t-interlineal-hebreo-espanol-vol-iv-pdf.pdf Amándoles mucho en Cristo con un Amor Incondicional, Fernando Castro-Chavez!
The Scripture says that the five gifts of service were already given to the Body of Christ on earth, to the Saints, since the day of Pentecost!!! The same day that the gift of holy spirit directly from God has been fully available to anyone willing to stretch the hand and grab it!!! The same with these spiritual five senses to the Church!!! We ought to activate them and to use them out of our free will, in the same way that we freely use the nine evidences of the new birth inside (tongues, interpretation, faith, miracles, healings, prophecy, science, knowledge, discernings), and display its fruit, also by our free will (love, joy, peace, forbearance, kindness, goodness, faithfulness, gentleness and self-control)!!!
Updated Jan 23, 2020, 8:42 PM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Jan 21, 2016, 7:57 AM
Y, Santos muy Amados de toda denominación que aceptan a Jesucristo como su Señor y Salvador Viviente, es decir: Como ¡su único Líder Verdadero!, el descubrir que a nosotros nos toca activar, como grupos del Cuerpo de Cristo, los Cinco Dones del Ministerio de la Reconciliación ¡es algo que proviene directamente de lo Alto, y que ha estado frente a nosotros disponible desde el día de Pentecostés! La arrogancia y vanidad de líderes humanos que anhelan ser el centro y hacerlo todo a "su manera" lo tenía "atorado" hasta hoy, pero gracias al depender directo de Dios en Cristo, ustedes activarán bajo Su guía el poder más enorme que el Universo ha conocido hasta ahora, bajo el consejo de ¡Cristo Jesús, nuestra cabeza única! Fernando. P.D. N.T. Interlineal: http://tinyurl.com/nt-interlin-lacueva
Updated Jan 21, 2020, 10:23 AM
Updated Jan 19, 2020, 5:39 PM
Fernando Castro-Chavez shared a memory.
4 Years Ago
Jan 18, 2017, 3:13 PM
Dear All, These days, the nearby volcano ("The Colima"), is spitting more volcanic dust than usual. In my hand I have the collected "ash" from a small plate left outdoors overnight. If you go closer to the volcano, you find the porous light rocks shown below (the negative effect on the lower right image shows the visual similarity of the material). The rights sides are a close up of the left images. In Christ, Fernando.
From those days when the Volcano of Fire Colima was spitting highly stringent "ashes" which were like powders of black sand, at Zapotlán el Grande, Jalisco, MX:
Updated Jan 18, 2020, 8:13 AM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Jan 16, 2015, 7:44 AM
Then, when asked by my wife Tracy to illustrate the difference between the time for the living and the pause in time for those that are asleep, I remembered my old tape recorder. The time for a dead person is in pause, awaiting his awakening by Jesus! The person will still remember her last thoughts, and think of it as an instant!
Remembering the great fact of the relativity of time according to the Bible between those that are alive and those that have already died with the perspective of the resurrection: The time is detained at the very moment of death and it will be resumed at the moment of the resurrection!!! It will be like the next instant for the one who died, even if many centuries had passed!!!
Updated Jan 16, 2020, 6:00 PM
Fernando Castro-Chavez shared a memory.
4 Years Ago
Jan 14, 2017, 3:38 PM
Together with my parents and sister, I prepared Sauerkraut, an excellent source of goodies for the intestine, and, with exercise, also an aid to help reducing the stomach built on the past vacations...
When I prepare that delicious and healthy Sauerkraut, it looks a little something like this: Mmmmmmah!!!:
Updated Jan 14, 2020, 7:50 AM
Bardem to Roberts: "Run away from me..., you are running away of all the great possibilities of your own life". Earlier: https://www.youtube.com/watch?v=19IGKkE4eGQ, and more earlier: https://www.youtube.com/watch?v=xMjDc8MJotU
Fernando Castro-Chavez shared a memory.
My "Art and Science" expo at the Baylor College of Medicine, from the Laser Microscopy, how the calcium in all its odd shapes in which it is built by your vascular smooth muscle cells at my developed 3-D model with magnetic levitation of Atherosclerosis, mimicking the carotid, gets excited at all the spectrum of the wavelengths producing the most diverse colors!!! (I took my art when I went to visit the studio of Peter Marx at New York in the company of my ex-wife Tracy Duncan and Margaret West and her son Jerry, with his wife and daughter, but I was shy to show it to him... let me find that photo to put it below... OMG with that my dream of proliferating...):
Updated Jan 13, 2020, 10:57 AM
You tagged Cesar Cosio
The funny way in which sometimes "Your History" matches your icon, here my musical friend Cesar Cosio II (Cesar Cosio) is dancing non stop, ...while I am in my crazy cloud as usual, just floating in there... Heheee!!!:
Updated Jan 13, 2020, 10:47 AM
What my eyes see here in Cypress, TX, the current land of the woman that I like, and my abode for now:
Then, a very amazing Bible study is that in which we learn that Judas Iscariot practiced the "harakiri", committing suicide in the same day that Jesus Ascended to Heaven. not before!!! Key Scriptures are in the first chapter of Acts 1:16-20: "...he burst asunder in the midst...", Acts 1:2, where we read that Jesus gave "the day in which he was taken up... commandments unto the Apostles whom he had chosen". Including Judas!!! This makes perfect sense, because if Judas was already suicided earlier, then; who better than Jesus during his 40 days of walking on earth resurrected, to name his successor??? But then, Judas was still alive during those 40 days!!!! So, when the Gospel says that Judas went out and hanged himself, we need to realize that it does not say that such happened immediately, and a better translation for "hanging" is something like "extremely grieved". And 43 days later he committed suicide using something perforating, with the Hebrew, not the Gentile understanding of suicide, which was exactly the way that Saul and his arm-bearer killed themselves!!! WOW!
Place: Cypress, Texas (29.9689, -95.6969)
Address: Cypress, TX 77429, 77433
It is always good to remember the sound teaching of the Bible, in the good times and in the trying times, here remembering the perfect design of the four Gospels, from the best book regarding the sacrifice of our Lord for us: "Jesus Christ Our Passover": Matthew, presenting Jesus as the King, with the royal genealogy of Mary (from Solomon the King, son of David). Mark, with Jesus as the Slave, the Servant for us, lacking of genealogy as the salves do. Luke, where Jesus is portrayed in full as the Son of Man (You the Man, Jesus!!!), with the genealogy of his adoptive father Joseph (from Nathan, not a king, son of David). John, showing Jesus as the Son of God (coming directly from God as his simplest genealogy). At the right side of the photo, a fossil tip of the horn of a young rhinoceros from the days of Noah in America, found at the bottom of a dried creek in San Antonio when I was exploring with the company of my nephews, to whom I gave dinosaur toys to assemble such as the one portrayed in the photo near the fossil... The location is in Cypress, TX, where I patiently wait for the girl that I like, to decide if it will be me or not...
Fernando Castro-Chavez shared a memory.
5 Years Ago
Jan 12, 2016, 10:57 AM
Estudiando las Escrituas: Dones de ministerio: Profetas! https://www.youtube.com/watch?v=0pvhM-tKTpo Mi oración en espíritu y entendimiento es que cada coordinador de grupo de creyentes Cristianos estimule el desarrollo de los, ya dados por Cristo, Dones de ministerio para tener un grupo saludable y creciendo con el crecimiento que da Dios: Vista: Apóstoles; Oído: Profetas; Tacto: Evangelistas; Olfato: Pastores; Gusto: Maestros.
The amazing spiritual five senses of the current, still here on earth, body of Christ, still very imperfect we, as we are still humans and members of that body with Jesus as our head, until we could start learning to take in our own hands these five gifts of service already given to us by God, then we will be closer to the perfect man in the measure of the current stature of Christ:
Updated Jan 12, 2020, 12:40 PM
Updated Jan 11, 2020, 9:26 AM
Fernando Castro-Chavez shared a memory.
3 Years Ago
Jan 9, 2018, 2:49 PM
More pictures of my vacation (that now is gone, buaah!!!), I am now single, with no wife or girlfriend yet, but wanting one very, very, very much (with divine help, I wish to serve her on my knees), but for now, I am alone and fine, living only with "the Lord" (and back to 2 Cor. 1 to 6 from the Greek: The Ambassadors for the Lord that we always are! Married or single happy or sad, even well-behaving or a little bit miss-behaving, it does not matter, we are still his Ambassadors!!!...), here the first one shows me with my new friend Jasith, a young hard working and playing neighbor there (God, I wish he were my own son!), then with my nephews (God I wish, I wish...)
With my very good little friends and nephews from Puerto Vallarta, still dreaming until the last day of my days with a beautiful, unique, family of my own, with a slant eyed primrose recipient of all of my love... and the future little ones according to her timing, as I respect her freedom and her free-will decisions with my own life!!!:
Updated Jan 9, 2020, 7:27 PM
This is the best corner ever with the woman that I love with all of my heart!!! (our dear table was the one in the very corner, in the angle of it all!!!), enjoying of God's creation, of her prayer to bless the food and our lives!!!, of a clever conversation about the constructive or edifying way in which Einstein presented originally his classic formula: m = E/c^2, the great compression of energy, by pressing down in all its spherical points with the squared speed of light to obtain matter as per in Gen. 1:1!!!!, and also the best and healthy and natural meal possible, with drinks such as Hibiscus tea and "The Grinch" juice plus an awesome dessert of a big hot cookie with all inside!!!, very recommended: https://www.facebook.com/SeasonsHarvestCafe
Inspired by the girl that I like for a lifetime with me (like those birds that expand their wings and start singing for the one), and thanks to my favorite Headhunter, I presented this topic: https://youtu.be/itC73P-653A, and its slides: https://fdocc.yolasite.com/resources/fdocc-5thIndRev.pdf; so, glory for ever and ever to God!!! (Putting it all in the hands of God!!!)
Updated Jan 6, 2020, 8:33 PM
Fernando Castro-Chavez shared a quote.
Healthy, fresh, just a delight to the palate, and a visual piece of art!!! It Tastes better with the best company by your side, and you can try more flavors by sharing!!! Fernando Castro-Chavez.
Our fourth time here! Finally Mrs Susan convinced us to download the app to get points and rewards!!!
Updated Jan 6, 2020, 12:38 PM
Fernando Castro-Chavez shared a memory.
You tagged Marianne Warner Mitchell and Robert Trilogy Mitchell
I am going to celebrate right now at Houk's what it was of the life of one of my dear sisters in Christ, now asleep awaiting the return of Christ, and who also was student with me of "The Word and Science" by the side of Margaret West (also gone two years ago), and I am going to celebrate her life with her three awesome sons, here in the photo, and the rest of her spiritual family!!! See you there saints from Houston!!!:
Abercrombie, "Ciudado Con el Perro", Godiva and Disney... (At the Willowbrook Mall, Houston):
Fernando Castro-Chavez updated his status.
Fernando's most commented photo on Facebook of 2017
With my friend and writer from Zapotlán el Grande, where my parents live, Virginia Arreola:
Fernando Castro-Chavez shared a memory.
3 Years Ago
Alexandra Preciado added a new photo.
Con mis Papás y Sobrinas en Puerto Vallarta, de vacaciones hace dos años, bellos momentos en familia!:
Updated Jan 3, 2020, 7:32 AM
A poetically visual evocation of the most important event for me in this 2019 that is ending and that 2020 that is starting, an event that is still ongoing and getting more interesting as the seconds are passing-by: My Sunset Into Your Fountain: "The beautiful end of another day! The sunset displaying all of its intriguing colors! Two trees are standing close to two fountains of waters and of lights; in the mean time, one heart is looking at this amazing display of the divine majesty of God, while fervently praying for the woman that he likes the most under this blessed earth and in this awesome time that both of them have had the great privilege and miracle of living!!!" Fernando Castro-Chavez.
Another amazing Scientific Program from "60 minutes", at CBS, featuring the Director of the NIH and former Director of the successful Genome Project, Dr. Francis Collins: https://www.cbsnews.com/news/could-gene-therapy-cure-sickle-cell-anemia-60-minutes-2019-12-29/
Updated Dec 31, 2019, 10:41 AM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Dec 31, 2014, 8:13 PM
This is one of the slides of "Exploring Our Hope", which I´ll be presenting this Saturday. With the help of my sister-in-law, Marjorie, we reached the dimensions of the New Jerusalem descending from the Heavens as the whole State of Washington. Compared to it, the Kingdom of Jesus during the thousand years will be as big or as small as Times Square, in NY.
The blessed future City of God on earth! God is coming to stay in this unique planet forever! God is moving back to planet earth for good! (But all in its due time):
Updated Dec 31, 2019, 7:42 AM
Updated Dec 29, 2019, 6:51 AM
Updated Dec 28, 2019, 9:53 PM
Three amazing songs in this morning of nostalgia, dedicated to the one that I really love!!!: https://www.youtube.com/watch?v=jMFJYoFjhNo
"Why Can't I Have You?",
by Cars:
Ah dreamy lips, set in motion, flashing
Ah breathless hush, poundin' soft, lasting
Oh glossy mouth, a taste untamed, moving
Carousel, up and down
Just like you
Oh baby
Just one more time to touch you
Just one more time to tell you
You're on my mind
Baby, why can't I have you?
You're breakin' my heart in two
You know what I'm goin' through
Oh baby, why can't I have you?
Oh candy smile, all the while, glinting
Your eyes like mica, a lethal pout, hinting
(Felt the pressure)
Ooh and I felt the pressure, tight and warm, softly striking
(Ooh tripped and stumbled)
Ooh I tripped and stumbled
I cling forever
I go all night
Oh baby
Just one more time to touch you
Just one more time to tell you
I'm not so blind
Baby, why can't I have you?
Always breakin' my heart in two
You know what I'm goin' through
Uh oh baby, why can't I have you?
(Baby) oh baby (why can't I have you?) why can't I have you?
You know what I'm goin' through
(You're breakin' my heart in two)
You're breakin' my heart, breakin' my heart
(You know what I'm gonna do)
(You're breakin' my heart) breakin' my heart
(Baby) oh baby (why can't I have you?) I need you
(You know what I'm goin' through)
You're breakin' my heart (you're breakin' my heart in two)
Oh baby, I need you so much, I need you, touch
(You know what I'm gonna do)
(You're breakin' my heart)
(Baby) oh baby (why can't I have you?)
(You know what I'm goin' through)
(fade)
"Why Can't I Have You?",
by Cars:
Ah dreamy lips, set in motion, flashing
Ah breathless hush, poundin' soft, lasting
Oh glossy mouth, a taste untamed, moving
Carousel, up and down
Just like you
Oh baby
Just one more time to touch you
Just one more time to tell you
You're on my mind
Baby, why can't I have you?
You're breakin' my heart in two
You know what I'm goin' through
Oh baby, why can't I have you?
Oh candy smile, all the while, glinting
Your eyes like mica, a lethal pout, hinting
(Felt the pressure)
Ooh and I felt the pressure, tight and warm, softly striking
(Ooh tripped and stumbled)
Ooh I tripped and stumbled
I cling forever
I go all night
Oh baby
Just one more time to touch you
Just one more time to tell you
I'm not so blind
Baby, why can't I have you?
Always breakin' my heart in two
You know what I'm goin' through
Uh oh baby, why can't I have you?
(Baby) oh baby (why can't I have you?) why can't I have you?
You know what I'm goin' through
(You're breakin' my heart in two)
You're breakin' my heart, breakin' my heart
(You know what I'm gonna do)
(You're breakin' my heart) breakin' my heart
(Baby) oh baby (why can't I have you?) I need you
(You know what I'm goin' through)
You're breakin' my heart (you're breakin' my heart in two)
Oh baby, I need you so much, I need you, touch
(You know what I'm gonna do)
(You're breakin' my heart)
(Baby) oh baby (why can't I have you?)
(You know what I'm goin' through)
(fade)
Updated Dec 28, 2019, 7:45 AM
Updated Dec 27, 2019, 9:30 PM
Fernando Castro-Chavez shared a memory.
3 Years Ago
Dec 24, 2017, 7:40 PM
Nosotros aquí hoy 24 de diciembre, en casa y desde el jardín de Zapotlán el Grande, Jal., MX, estoy con mi mamá María Cris y con mi papá Manuel; y aquí mi estudio de hoy: https://youtu.be/evzUTKAbhug acerca del dar el Fruto para Dios y para salvación (es decir, para nuestras recompensas eternas al nosotros andar en ese amor ¡como Cristo nos pide!), ya que la salvación espiritual para vida eterna ya la tenemos gracias a la ofrenda en amor perfecto de nuestro Salvador y Señor Jesucristo, ¡alabado seas mi Señor por nosotros ahora y siempre! También estudio lo que es "el Remanente" de Israel y cómo llevamos por dentro el poder más grande del universo, el de espíritu santo, el mismo que levantó a Cristo de entre los muertos, ¡con el que es posible vencer a toda tentación y pecado por grande que a nosotros nos parezca!
Recuerdos del estar en casa con mis amados padres, ahora que estoy a muchas millas de distancia pero cerca en el corazón, y en la comunicación diaria!!!:
Updated Dec 24, 2019, 8:23 AM
Fernando Castro-Chavez updated his status.
Recordando la secuencia cronológica de la historia humana pasada y futura conforme a la Biblia; la era actual, la Era de Gracia, es en la que a nosotros nos corresponde creer e invocar a nuestro Salvador Viviente Jesucristo y vivir a la altura de sus recompensas, obedeciéndole en la práctica diaria como Señor Nuestro: ¡¡¡Ven, ven Señor, no tardes, ven que te esperamos!!!
This song again, is dedicated to the One that I want to be mine, not for a moment but for a lifetime!!!: https://www.youtube.com/watch?v=zvCBSSwgtg4, My dear Woman that I want forever: I wish YOU were "standin' next to me", "I belong with YOU, YOU belong with me YOU're my sweetheart (Bis)"
Updated Dec 21, 2019, 12:54 AM
Fernando Castro-Chavez added an item to the featured collection: Highlight.
Dec 20, 2019, 8:45 AM
Fernando Castro-Chavez created the featured collection: Highlight.
Dec 20, 2019, 8:45 AM
I dedicated this epic song to the One I Love, in the hopes to be equally Loved by her, by the mercy of God, the inheritor of our companion: https://www.youtube.com/watch?v=nKhN1t_7PEY
"Broken Wings"
Mr. Mister
Baby, don't understand
Why we can't just hold on to each others' hands
This time might be the last, I fear
Unless I make it all too clear
I need you so, ohh
Take these broken wings
And learn to fly again
Learn to live so free
When we hear the voices sing
The book of love will open up and let us in
Take these broken wings
Baby, I think tonight
We can take what was wrong and make it right, mmm
Baby, it's all I know
That you're half of the flesh
And blood that makes me whole
I need you so
So take these broken wings
And learn to fly again
Learn to live so free
And when we hear the voices sing
The book of love will open up and let us in
Take these broken wings
You've got to learn to fly
Learn to live and love so free
And when we hear the voices sing
The book of love will open up and let us in, yeah, yeah
Let us in
Let us in
Baby, it's all I know
That you're half of the flesh
And blood that makes me whole
Yeah yeah yeah, yeah yeah
So take these broken wings
And learn to fly again
Learn to live so free
And when we hear the voices sing
The book of love will open up and let us in
Take these broken wings
You've got to learn to fly
Learn to live and love so free
And when we hear the voices sing
The book of love will open up for us and let us in, yeah yeah
Yeah yeah
Ooh (Note: I wish to see Star Wars Nine...)
"Broken Wings"
Mr. Mister
Baby, don't understand
Why we can't just hold on to each others' hands
This time might be the last, I fear
Unless I make it all too clear
I need you so, ohh
Take these broken wings
And learn to fly again
Learn to live so free
When we hear the voices sing
The book of love will open up and let us in
Take these broken wings
Baby, I think tonight
We can take what was wrong and make it right, mmm
Baby, it's all I know
That you're half of the flesh
And blood that makes me whole
I need you so
So take these broken wings
And learn to fly again
Learn to live so free
And when we hear the voices sing
The book of love will open up and let us in
Take these broken wings
You've got to learn to fly
Learn to live and love so free
And when we hear the voices sing
The book of love will open up and let us in, yeah, yeah
Let us in
Let us in
Baby, it's all I know
That you're half of the flesh
And blood that makes me whole
Yeah yeah yeah, yeah yeah
So take these broken wings
And learn to fly again
Learn to live so free
And when we hear the voices sing
The book of love will open up and let us in
Take these broken wings
You've got to learn to fly
Learn to live and love so free
And when we hear the voices sing
The book of love will open up for us and let us in, yeah yeah
Yeah yeah
Ooh (Note: I wish to see Star Wars Nine...)
Updated Dec 17, 2019, 11:25 AM
Fernando Castro-Chavez added a new video to Charly Carlos Vzqz's timeline.
You tagged Charly Carlos Vzqz
Felicidades por haber existido en este tiempo y por tu amistad perenne! |
Felicidades por haber existido en este tiempo y por tu amistad perenne!
Dedicated to The ONE, and of course, remembering that Jesus is the Son of God, being God the head of Jesus as Jesus Is my Head (at least in many times and willing to get to the point of Jesus being my head at almost all times!!!), willing myself to reach the blessed point of being (also at least many instances) the head of this woman that I am liking deeply at this day and time with no conditions, with an unconditional love at last!!!! (Or so I strive to do!!!)
Updated Dec 14, 2019, 10:58 AM
Updated Dec 13, 2019, 8:45 PM
Fernando Castro-Chavez added an item to the featured collection: More pieces of us!
Dec 12, 2019, 4:36 PM
Fernando Castro-Chavez added an item to the featured collection: More pieces of us!
Dec 12, 2019, 4:36 PM
Fernando Castro-Chavez added an item to the featured collection: More pieces of us!
Dec 12, 2019, 4:36 PM
Fernando Castro-Chavez added an item to the featured collection: More pieces of us!
Dec 12, 2019, 4:36 PM
Fernando Castro-Chavez added an item to the featured collection: More pieces of us!
Dec 12, 2019, 4:36 PM
Fernando Castro-Chavez added an item to the featured collection: More pieces of us!
Dec 12, 2019, 4:36 PM
Fernando Castro-Chavez added an item to the featured collection: More pieces of us!
Dec 12, 2019, 4:36 PM
Fernando Castro-Chavez added an item to the featured collection: More pieces of us!
Dec 12, 2019, 4:36 PM
Current writings in blood: Ethereal Cetacean: "My red heart and the tip of my red rose touched your red toenails and brought you that red dress... oh dearest spring of my life!; ...but you did not dance with me, and I was unable to kiss them all! (and I have not spoken of the yet to get Red Lipstick, and of the Blush, the Foundation and the Eye-shadow...); ...maybe other men did... stealing from you, from us, your sacred blood... while my being still bleeds here at home, with its red tears of love, in the current sunset of my life! But, I hope tomorrow, together, with the help of God, we could be able to do better and better...!!!" Entrenched Keys.
Updated Dec 11, 2019, 5:15 PM
This photo completes my 12th happiest days of my life by the side of the woman that I like, my friend, keeping going from now on to the heart of God... so much needed the spiritual prayers of our family in the living Christ!!! Thank you!!!
A Sugar Glider!!!: https://www.youtube.com/watch?v=RZosq9p73W4 And its Albino cool variety, a hot kind of pet to have!!!: https://www.google.com/search?q=sugar+glider+albino&oq=Sugar+glider+albino&, and its Wiki: https://en.wikipedia.org/wiki/Sugar_glider
Updated Dec 10, 2019, 6:21 PM
By Needtobreathe - "Bridges Burn": https://www.youtube.com/watch?v=dkDSvgoX7oM
Updated Dec 9, 2019, 1:30 PM
An amazing program of today about the State of the Art of genetic engineering: https://www.cbsnews.com/news/george-church-the-complicated-ethics-of-genetic-engineering-60-minutes-2019-12-08/, plus its portions saw on TV: https://www.cbsnews.com/news/harvard-geneticist-george-church-goal-to-protect-humans-from-viruses-genetic-diseases-and-aging-60-minutes-2019-12-08/
Updated Dec 9, 2019, 12:02 AM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Dec 7, 2015, 10:13 PM
Amados santos, primeramente Dios vamos a ver el tremendo tema de la Simiente Prometida en las Constelaciones para este viernes 11 de diciembre, comenzando a las 7:50 PM: https://www.youtube.com/c/catadoresdelapalabra1 con el ir manifestando espíritu santo después del tema, y con oraciones y salutaciones comenzando desde las 7:30 PM mediante Skype; las transparencias son: http://fdocc.ucoz.com/3/08_simiente_constelaciones.pdf En Cristo, Fernando.
Otra Constelación representando a El Rey, Jesucristo: Cepheus!!! (Perteneciente al grupo de las espadas entrecruzadas de Simeón..., hoy distorsionado como Piscis, al que también pertenece Andrómeda: La verdadera Nación de Israel en la Diáspora (no la falsa actual...), a la que Jesús y los suyos rescatarán personalmente al final de los tiempos), con una transparencia y claridad orgánica tan inocente y tan precisa, ¡¡¡como el hacernos como niños para la malicia pero no para el conocimiento, haciendo todo esto en AMOR!!!:
Updated Dec 7, 2019, 11:09 AM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Dec 6, 2015, 6:04 PM
Here we see how Jesus himself is carrying our load today with his declaration that the "eye for an eye" statement is something that "has been said" by somebody but not by God! Jesus puts that statement in the same category of the most erroneous "hate thine enemy"! Contrasting these two with Giving and with Loving!, respectively.
No matter how loaded we have our car with the things of our past, Jesus is there to really help us with our loads!!!:
Updated Dec 6, 2019, 9:16 AM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Dec 5, 2014, 7:01 PM
This is one of the slides for tomorrow's presentation; the real "walk on water" that Peter did, even if it was for few seconds... It's all about believing... Peter asked Jesus to go to him, Jesus said "COME", but the circumstances around him almost drowned Peter. "Why did you doubt?" Jesus asked him... Gabe is also going to share with us about belief!
When Jesus by belief and by necessity walked on water, and when Peter by unbelief and doubt started to drown after having walked some few steps on water too!!!:
Updated Dec 5, 2019, 8:51 AM
Updated Dec 4, 2019, 10:59 PM
And a Christian Rock song by the best rocker of all times!!!: Robert Plant, singer from Led Zeppelin, who became Christian after the bold testimony of the Bluegrass singer and composer Alison Krauss (thanks to my brother Caleb O. for showing to me this great song!!!): https://www.youtube.com/watch?v=dnqfnPkirwA, Amazing!!!, here at Austin, TX:
This was one of the new songs that I heard for the first time in N.Y. at the Cavalcade radio show: https://www.youtube.com/watch?v=AXPOF8WsQL4
Updated Dec 1, 2019, 7:49 PM
Updated Dec 1, 2019, 7:08 PM
Some Christmas lights at Fry Rd.: Lakeland Village!:
Fernando Castro-Chavez added an item to the featured collection: My 3rd day of joy.
Dec 1, 2019, 6:21 AM
Fernando Castro-Chavez added an item to the featured collection: My 3rd day of joy.
Dec 1, 2019, 6:21 AM
Updated Nov 30, 2019, 7:01 PM
Updated Nov 30, 2019, 5:17 PM
"Step Into Love"!!!:
The Beautiful Portion composed and sang by Sarah Reeves:
"Step into love like you've never been hurt before
Step into trust like you've never been burnt before
Would you just step in your heart and open your soul?
I'll be waiting when you let go
Step into love like you've never been, never been hurt before...
....You made it past all the past, you're a miracle
He's always there, cast your cares when it's difficult
Don't let your past hold you back, you're a miracle, miracle, miracle!
Step into love like you've never been hurt before..." |
"Step Into Love"!!!:
The Beautiful Portion composed and sang by Sarah Reeves:
"Step into love like you've never been hurt before
Step into trust like you've never been burnt before
Would you just step in your heart and open your soul?
I'll be waiting when you let go
Step into love like you've never been, never been hurt before...
....You made it past all the past, you're a miracle
He's always there, cast your cares when it's difficult
Don't let your past hold you back, you're a miracle, miracle, miracle!
Step into love like you've never been hurt before..."
The Beautiful Portion composed and sang by Sarah Reeves:
"Step into love like you've never been hurt before
Step into trust like you've never been burnt before
Would you just step in your heart and open your soul?
I'll be waiting when you let go
Step into love like you've never been, never been hurt before...
....You made it past all the past, you're a miracle
He's always there, cast your cares when it's difficult
Don't let your past hold you back, you're a miracle, miracle, miracle!
Step into love like you've never been hurt before..."
Updated Nov 23, 2019, 6:15 PM
Fernando Castro-Chavez added a new video to a timeline.
Nov 23, 2019, 11:03 AM
Y sí, yo compartí con ella ese maravilloso Lunes que pasé ocho increíbles horas a su lado, algunas de las melodías que llegan, apropiadas para ella, en español, cómo esta: https://www.youtube.com/watch?v=GCJ0jzU1GDE
Updated Nov 23, 2019, 9:34 AM
You tagged 沈信學
The top fruit of this photo is the delicious snack from China, the original dehydrated prune that Dr. Shen (沈信學) introduced to me, now my favorite dessert, that when I showed them to my new female friend from the Philippines, a 22 year old beauty, she immediately told me that in her Country they call them: "KIAMOY"!!! Also one of her favorite snacks, like myself. Below them, there is another great dehydrated fruit from China, made out of green grapes; both of them, I purchased at the Chinatown of New York (together wit the dehydrated Dragon's Eye fruits)!!!
One more of the contestants of the competition and exhibit "The Art of Science" at Secret City, TN:
Updated Nov 20, 2019, 9:38 PM
Heavenly Father, I am like this tree still providing its shade while dressed in its Autumn leaves, leaves that when they are close to the end (cerca "Del fin"), are still able to shake our hearts by producing their full spectrum of colors leading us to that great day of our being Thanksgiving with You, oh our dear God..., because You are my real LOVE and no one else can fill Your unique space in my heart!!! Fernando.
Then, I dedicated to her this song, and I dedicate it to every girl able to still like me and give me an offspring, because really, I am still free!!! As free as the wind, as free as the birds, as free as the flow of the waters in the rain...: https://www.youtube.com/watch?v=5jhocSCSZzk; "Waiting For A Girl Like You", composers Lou Gramm (A Christian Man), and Mick Jones (I still do not know about him)
So long
I've been looking too hard
I've been waiting too long
Sometimes I don't know what I will find
I only know it's a matter of time
When you love someone
When you love someone
It feels so right, so warm and true
I need to know if you feel it too
Maybe I'm wrong
Won't you tell me if I'm coming on too strong
This heart of mine has been hurt before
This time I wanna be sure
I've been waiting for a girl like you
To come into my life
I've been waiting for a girl like you
A love that will survive
I've been waiting for someone new
To make me feel alive
Yeah, waiting for a girl like you
To come into my life
You're so good
When we make love
It's understood
It's more than a touch or a word we say
Only in dreams could it be this way
When you love someone
Yeah, really love someone
Now I know it's right
From the moment I wake up 'til deep in the night
There's nowhere on earth that I'd rather be
Than holding you tenderly
I've been waiting for a girl like you
To come into my life
I've been waiting for a girl like you
A love that will survive
I've been waiting for someone new
To make me feel alive
Yeah, waiting for a girl like you
To come into my life
I've been waiting
Waiting for you
I've been waiting
I've been waiting, yeah
(I've been waiting for a girl like you
I've been waiting)
Won't you come into my life?"
So long
I've been looking too hard
I've been waiting too long
Sometimes I don't know what I will find
I only know it's a matter of time
When you love someone
When you love someone
It feels so right, so warm and true
I need to know if you feel it too
Maybe I'm wrong
Won't you tell me if I'm coming on too strong
This heart of mine has been hurt before
This time I wanna be sure
I've been waiting for a girl like you
To come into my life
I've been waiting for a girl like you
A love that will survive
I've been waiting for someone new
To make me feel alive
Yeah, waiting for a girl like you
To come into my life
You're so good
When we make love
It's understood
It's more than a touch or a word we say
Only in dreams could it be this way
When you love someone
Yeah, really love someone
Now I know it's right
From the moment I wake up 'til deep in the night
There's nowhere on earth that I'd rather be
Than holding you tenderly
I've been waiting for a girl like you
To come into my life
I've been waiting for a girl like you
A love that will survive
I've been waiting for someone new
To make me feel alive
Yeah, waiting for a girl like you
To come into my life
I've been waiting
Waiting for you
I've been waiting
I've been waiting, yeah
(I've been waiting for a girl like you
I've been waiting)
Won't you come into my life?"
Updated Nov 19, 2019, 7:26 PM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Nov 19, 2015, 8:32 AM
"The unique connections in your brain mean no one like you has ever existed or will ever exist again" = 'Las conexiones únicas en tu cerebro significan que nadie como tú ha existido ni existirá jamás' From: http://video.pbs.org/program/brain-david-eagleman/ [First Part - Whose free viewing expires tomorrow!]
She is the fixation within my brain since I was five years old... she is noble, she is youthful and truthful... nobody has a brain like mine or like hers, each one of us is unique and non disposable!!!... God, let her be Your mighty inheritance to me!!! By the Name of Our Living Christ!!!
Updated Nov 19, 2019, 8:17 AM
I was introduced to this song today, by the girl that I really like: https://www.youtube.com/watch?v=SUFSB2plwzM, alt.: https://www.youtube.com/watch?v=Biw012tPKMc; and it describes how I was extremely impressed by her, that to me she was shining like a precious jewel since the first instant, and the ensuing feelings that arrived unto me, and some real statements that are like a ring in its finger for us...: https://genius.com/311-amber-lyrics (...about relationships and appreciating life): "take me away from the norm... amber is the color of your energy... shades of gold displayed naturally... You glide through my head... You live too far away / Your voice rings like a bell anyway / Don't give up your independence / Unless it feels so right / Nothing good comes easily / Sometimes you've got to fight"!!! Yes! Nothing valuable (usually) arrives to us just because... but by keeping all of my energies up, and fight I will, like a hero for the one I love (which is her)!!!
Updated Nov 18, 2019, 10:47 PM
Fernando Castro-Chavez shared a memory.
3 Years Ago
Nov 18, 2017, 10:05 AM
In Corinth, as today myself, they needed to ask first for forgiveness to God and to their fellow believers (that's the third cup: "The Cup of Blessing", that was taken before eating the bread! (1 Cor. 10:16); then, after eating the healing bread, as per Jesus, "The Cup of The New Covenant" was the one that was taken (1 Cor. 11:25-26), when God Himself responds, giving us the complete forgiveness of sins, time after time as we remember to ask Him to do that! [So the 5th Cup, or the "Cup of The Living Grace (us) & Glory (him)", will be taken by Jesus when he enters as "King of Kings and Lord of Lords" in his future Millennial Kingdom on earth! Oh wonders of the infinite wisdom of God!!!]
Remembering those awesome biblical research days when I discovered that there were to different ceremonial cups the ones that Jesus Christ used in his Last Supper (still within the context of the O.T. Law), the first being clearly distinct from the second: The First requesting the forgiveness of God and the Second indeed thanking God for having granted that forgiveness!!! Now, in this age of grace it is different: Every time that we put something solid in our mouths we can remember that when Jesus was beaten and died on that cross, what he was giving to us by the grace of God was the assurance, when we believe so, of our full restoration of a sound mind and of a healthy body, and whenever we put any liquid in our mouths to drink, we can remember, when believing, that all our sins, including the most current ones: All of them have already been forgiven by the sacrifice of Jesus the Christ shedding his blood for you and me!!! (What God is granting me now corresponds to the first component: The bread of life!!! My bread of life which will be the certain inheritance of God of a strong, virtuous woman for me: Finally I will have my full body!!! Thank you Jesus!!!, instead of only being a bouncing big head....
Updated Nov 18, 2019, 9:55 AM
"For King and Country", JOY: https://www.youtube.com/watch?v=lA7n7TwPDmw
Updated Nov 17, 2019, 11:51 PM
One more of the photos that integrated "The Art of Science" exhibit that I saw at the "Secret City" (Oak Ridge) of TN, where the Atomic Bomb was developed in the WWII:
Updated Nov 17, 2019, 8:21 PM
One of our favorites: "Home", Foster, composer, with Bubblé and Shelton: https://www.youtube.com/watch?v=xk1jZm8L6CY
Updated Nov 17, 2019, 10:54 AM
Rescue!!! (No matter for what or how deep we have fallen, He is our Rescue!!!): https://www.youtube.com/watch?v=gYR0xP1j4PY
Updated Nov 16, 2019, 8:21 PM
Updated Nov 16, 2019, 6:49 PM
What if many times we are.... (I mean, I am, by trying to find the right one online): https://www.youtube.com/watch?v=FAyDmJvjxbg
Updated Nov 16, 2019, 12:54 AM
One more of the photos of the ORNL exhibit on "The Art of Science":
Updated Nov 14, 2019, 3:29 PM
This is another participant into the exhibit at the "Atomic City", a.k.a. as the "Secret City" in Tennessee, about the isolation of the "Petroporphyrins" (with a nice purple translucent color) that may help to improve the quality of the gasoline we daily gulp through our autos!:
Updated Nov 12, 2019, 7:52 PM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Nov 12, 2015, 9:10 AM
Divinos Santos Amados: Es con gran satisfacción que comparto las transparencias de mi presentación de mañana a las 7:50 PM: http://fdocc.ucoz.com/3/PC_b_7_h_e_l_con_interp.pdf Por el YT: https://www.youtube.com/c/CatadoresDeLaPalabra1 Después de esto, Sangat Bains nos comparte de su corazón; los que deseen estar desde antes para oraciones especiales y manifestar, mándenme en mensaje personal su identidad para encontrarlos a través del Skype y anexarlos. En Cristo, Fernando.
Tremendos secretos que Dios le reveló a Pablo:
Updated Nov 12, 2019, 8:39 AM
Another of the amazing "The Art of Science" photographs at the ORNL exhibit is this one of rust seen at the microscopic level!:
Updated Nov 11, 2019, 8:49 AM
So Will I !!! (I like this version that my brother Gabe showed me, because of the Creation in sight and the voice of belief in what is being described, from the first light, all the long way to our salvation by our last and definitive light, which is Jesus!!!): https://www.youtube.com/watch?v=FA4Vayl8G74
Updated Nov 10, 2019, 10:20 PM
This is another of the photos participating in "The Art of Science" at the Oak Ridge National Laboratory of the formerly Secret City, TN, USA:
Updated Nov 10, 2019, 7:46 PM
You tagged Tollie Moore DeGraw
On completing my reading of the great historical book "Secret City" by Tollie Moore DeGraw, I get these final gems to share with you: "The Oak Ridge High School Honor creed reads as follows, and we were also expected to know it by heart: "Honor and dignity depend upon the courage and integrity of the individual."" And also: "...the proud determination that inspired our brave parents to build the bomb that saved the world still flows in our veins... There are still secrets in The Secret City, many destined never to be told, but life goes on... today the fourth generation of the Secret City is entering Oak Ridge High School... Elm Grove has been replaced with a lively city park... Our daughter Jennifer is a secretary at the mammoth Y-12 Nuclear Weapons Facility, continuing the tradition started by her grandfather, some 62 years ago... the night-blooming Cereus (only one night in the year!!!), in its original bucket on the patio, continues to amaze us, year after year. And yes, there are many stories, yet to tell... with a challenge to remain honorable stewards of secrets; safe, secure, and steady as we go"!!!!!!! (Some vintage photos of those days are included here, other than the 45 personal photos by the author that enrich the mentioned book! And, of course, a white, succulent flower of the Cereus that lasts only one night!!! As ephemeral as this is the external beauty!, says the Lord):
Fernando Castro-Chavez wrote on Theresa Lewis's timeline.
Happy Day Today And Always!!!
A wonderful day today at Spring, TX, learning all that I can from my good Mentor appointed by God: Gabe, about Lands and Buildings, about Houses, Costs, Profits and so much more... our Heavenly Dad is providing great projects, jobs, and very good financial ideas (here, the contractor expressed his troubles with the swamp and mud that builds up at the back of the property, which will be rented by a very well-known gym of the USA; for me, this may be the biggest gym that I have ever seen, encompassing a whole block and more just by itself!!!):
You tagged Tollie Moore DeGraw
Two more priceless fragments of the real histories inside "Secret City", by Tollie Moore DeGraw: "People have asked me, through the years, if it was scary, growing up here... As the Cold War continued to grow colder, Oak Ridge was said to be Number Seven on the enemy's target list... as a young person I reasoned that since we were not on any maps, most likely the enemy could never find us anyway. // As the Oak Ridge story became more available to the public, there were questions about things like radioactivity in the air and pollution in the water... It is only natural that questions would arise regarding life in a nuclear Secret City..." and also: "Advice from my parents was fairly simple. 'You are known by the company you keep,' they said; 'Never behave in a manner which could deny you a government clearance. Do not gossip or betray a confidence. Remain strong in your faith, and remember, secrets are meant to be kept.' Honor, respect, and reputation were important in our family. We had the Oak Ridge legacy to uphold and pass on to future generations." These on continuing this, my amazing and amusing reading of The Fall... (found at the A.M.S.E. from the incredible Secret City of Tennessee, USA; also included in the photos is the equation by Einstein of the Photoelectric Effect: E = hv):
Other of the participants in "The Art of Science" presented this one:
Updated Nov 9, 2019, 8:54 AM
Updated Nov 7, 2019, 7:42 PM
You tagged Tollie Moore DeGraw
Two more fascinating fragments of the book by Tollie Moore DeGraw (Secret City. The Second Generation) are the next ones: 1) "Oak Ridge scientists were collecting fireflies. They were studying non-heat-producing light sources and they needed thousands of them... I preferred to catch them with my bare hand... to keep ours in the screened-in porch. They were beautiful twinkling fairy lights... We were paid a penny apiece if they were alive... a movie was only 25 cents..." and 2) "I suspect she (the teacher of penmanship, Mr. Walsh) was also working for the government, observing flora and reporting any changes, monitoring effects the Manhattan Project could be having on our natural habitat."
2018 Director’s Choice honorable mention
“Methylating Mercury” by Jerry Parks: "Methylation is a process in which certain naturally occurring bacteria transform inorganic mercury into its more toxin cousin, methylmercury. This image, created by scistyle.com for the University of Tennessee–ORNL Center for Molecular Biophysics based on the center’s research, depicts bacteria that methylate mercury. In the foreground, droplets of mercury are illustrated. Astute viewers may identify a Knoxville, Tenn., landmark in the background. // ORNL is managed by UT-Battelle for the Department of Energy's Office of Science, the single largest supporter of basic research in the physical sciences in the United States. DOE’s Office of Science is working to address some of the most pressing challenges of our time" For more information, please visit http://science.energy.gov/ Some of the black and white photos are part of the legacy of what Secret City has been disclosing since its foundation, but just a small portion of its discoveries... In the first of such photos we see Leslie Groves, the mastermind behind the Manhattan Project, just before targeting the two Atomic Bombs over Japan...
“Methylating Mercury” by Jerry Parks: "Methylation is a process in which certain naturally occurring bacteria transform inorganic mercury into its more toxin cousin, methylmercury. This image, created by scistyle.com for the University of Tennessee–ORNL Center for Molecular Biophysics based on the center’s research, depicts bacteria that methylate mercury. In the foreground, droplets of mercury are illustrated. Astute viewers may identify a Knoxville, Tenn., landmark in the background. // ORNL is managed by UT-Battelle for the Department of Energy's Office of Science, the single largest supporter of basic research in the physical sciences in the United States. DOE’s Office of Science is working to address some of the most pressing challenges of our time" For more information, please visit http://science.energy.gov/ Some of the black and white photos are part of the legacy of what Secret City has been disclosing since its foundation, but just a small portion of its discoveries... In the first of such photos we see Leslie Groves, the mastermind behind the Manhattan Project, just before targeting the two Atomic Bombs over Japan...
This photo was the 2018 Director’s Choice of the "Art of Science" awards by the ORNL of the former Secret City: “Majoranas on Honeycomb” by Jill Hemman: This visualization illustrates neutrons (blue line) scattering off a graphene-like honeycomb material, producing an excitation that behaves like a Majorana fermion—a mysterious particle that is also its own antiparticle (green wave). The visualization supports research by Arnab Banerjee, Mark Lumsden, Alan Tennant, Craig Bridges, Jiaqiang Yan, Matthew Stone, Barry Winn, Paula Kelley, Christian Balz, and Stephen Nagler. Together with other photos that I took from the place in the Secret City (now Oak Ridge, TN) where the Atomic Bomb was developed:
This is one of the photos that also were in the exhibit of "The Art of Science" at the AMSE's room of the Van De Graaf Live Exhibit, which always is a delight for children, especially for the girls with long hair!!!:
Updated Nov 7, 2019, 1:34 PM
Some of the awesome exhibits at the formerly Secret City's "Oak Ridge National Laboratory" (ORNL: https://www.facebook.com/Oak.Ridge.National.Laboratory) is one about "The Art of Science"!!! Being the people's choice winner, here portrayed with her "Photons of Light", Mrs Peyton Ticknor, staff member as administrative assistant, who here helps demonstrate immersive visualization capabilities by standing alongside a colorful simulation of quantum dots. Entry submitted by Peyton Ticknor; Photo: Jason Richards/ORNL. Then we had there, the frozen in speed colors of liquid painting by photographer John K. Clark (https://johnkclark.com/), some of the ones that I was able to capture are portrayed here:
Updated Nov 5, 2019, 10:22 PM
This was my first posting from the great book "Secret City", by Tollie Moore DeGraw: "We didn't ask what our parents did at work. We had a vague idea, but details were not to be known. There was no "Bring Your Child to Work Day." Rather, it was "Don't tell your child what you did at work today." Everyone knew the timely and now well-known phrase associated with our Secret City: "What you see here, / What you do here, / When you leave here, / Let it stay here." (Note: When I was reading this to my brethren and friends here they remembered a similar saying from Las Vegas: "What happens in...", and, later on, in the vintage photos of that time, I was able to find a billboard with those words (shown in another posting on the subject above this one), etc.) / / "...By 1960, Oak Ridge was still listed on very few maps and that same year the official Guide to Tennessee made no mention of our existence. It was years later before the words Oak Ridge appeared on n Interstate sign. Today our award-winning Secret City Festival brings in people from all over the world, and we appear proudly on every map and GPS system available." And, from the back cover: "Raised by a generation of brave and brilliant American Patriots, in the secret shadows of a nuclear reservation, children of the Atomic City were special. This second generation, including the class of 1965, grew up with air raid sirens and secret escape routes in a valley surrounded by oak trees in rural East Tennessee. They were sheltered and loved as one family united, not by DNA but by USA. Short snippets and warm tributes take you on a fascinating journey of hilarious classroom escapades, rodeos, bootleggers, rabid foxes, vegetable wars, country clubs, and clandestine field trips. You will peer into the bottomless, possibly corpse-infested rock quarry and learn why the children wore raw onions on strings around their necks. You will dance through life with Swank-ettes, Sub-Debs, Penguins, Gents and Chanticleers and cry with them in horror when white supremacists bomb Clinton High School. A great read for all ages, the second generation is sure to inspire you and will remain in your heart forever."
Entering into the hospitality of Tennessee! At their Welcome Center from the East!: https://www.tnvacation.com/local/chattanooga-i-75-welcome-center-chattanoogahamilton-county
The incredible version shared and found! Carol of the Bells!!! Enjoyed very much by Dr. Shen (沈信學) and I in one of our job breaks:
Updated Nov 2, 2019, 7:02 AM
Some of the important things to watch at the National Mall, from the Lincoln Memorial, a gigantic landmark of freedom, classic singers did an awesome "mob" by blending with the people and singing awesomely!!! (This time I blend here a fragment of it and some other videos); then, to the Washington Monument with its 50 flags beating under the wind!!! To then reach the Capitol Building, another shout to our great, wonderful freedoms achieved with lots of blood!!! Like that of Abe Lincoln himself!!!' Freedoms that NO ONE can or should attempt to remove from us!!!! If that attempts to fall over us by anyone, the Bible says that we should fly, to escape from the net, to fly on high like an eagle!!!! (Which reminds me of the great Steve Miller's futuristic and great song!!! Time keeps on... what? I feel it at!!!!!! my eagle's age!)
You tagged 沈信學
Memories of those great times with Dr. Shen (沈信學); you can see the delicious meals that he made, with rice at the bottom and a middle layer of a delicious meat, and then the veggies at the top, then a good prayer before starting eating, asking God for his protection, on the lab and on the road, respectively (and you can see there that I cut my hair on my own with an electric machine, Hehee!), then we had a good set of toasts with the red Merlot, and I was saying here, that every time I drink, it is a reminder for me of my inner cleansing and of all my sins completely forgiven, in the name of Jesus Christ!!! Then, the combination of meat and of red wine! Cheers and enjoy! (Or "bon appétit!"), with nice conversations about when the boss is pleased, and about Dad and Mom, their age, their state of health, and a bright future with the help of God!!! (Ah! And I also mentioned that the glass is from Houston, from the TUTS, where we used to go with my ex-wife Tracy, the open-space "Theater Under The Stars"!!!)
Después de haber descubierto que de Ken LaRoche eran los dedos sobre la Kalimba detrás de esa extraordinaria pieza musical con el mismo título (ver más abajo) compuesta e interpretada por Do'a (Armstrong y LaRoche, posteriormente con otros cuatro colaboradores), de la que anduve buscando durante unos 30 años esa información, me encuentro con que un par de sus últimas intervenciones musicales ya no fueron con Armstrong, sino con un grupo independiente a él, ¡y toca estas dos piezas con su flauta y con sax en una Iglesia en MA!, habiendo compuesto la primera melodía él mismo y la segunda uno de sus colaboradores de Do'a (parece entonces que nuestro amigo LaRoche murió de complicaciones cardiacas por su enorme sobrepeso, pero pareciera que al final se independizó de Armstrong, quien desde un principio prefirió ser de la religión Ba'hai y no cristiano, como al final vemos a su compañero LaRoche); finalmente, sus amigos lo quisieron tanto, que le compusieron una bella melodía a este LaRoche, ¡que en paz descanse!, y desde aquí mandamos bendiciones para sus descendientes: https://www.youtube.com/watch?v=fNWI5FMmcP8
Updated Oct 31, 2019, 1:01 PM
You tagged 沈信學
This is the wonderful melody that I had been looking for a long while, finding it here while still in Valhalla, New York!!! Listening at it while looking live at the very landscape here portrayed!!! However, I completely ignore the name of this piece or its interpreters!!! Maybe @[547248063:2048:Miguel Angel Ochoa] (which I think was the original recorder of it while he was in Europe, as his mother gave the tape to mine) or some of my former students, I think it was @[1264631500:2048:Abby Hdz], knowledgeable of international music, who previously identified it, when I had put another background from a documentary on Intelligent Design featuring Michael Behe (yes, that one showing an aerial cable-way from his town Bethlehem, PA, but that was removed from my YouTube as I lacked of the rights to post those precious images, and then I lost track of where it was, until now that I checked my old cassettes that I had here in the USA) could be able to tell me the name of this World Music brief treasured by me beauty!!! (I took all of these photos both in Valhalla and in the Central Park of NY): |
Place: Central Park, New York (40.768220878813, -73.974670433302)
Address: New York, NY 10023
This is the wonderful melody that I had been looking for a long while, finding it here while still in Valhalla, New York!!! Listening at it while looking live at the very landscape here portrayed!!! However, I completely ignore the name of this piece or its interpreters!!! Maybe Miguel Angel Ochoa (which I think was the original recorder of it while he was in Europe, as his mother gave the tape to mine) or some of my former students, I think it was Abby Hdz, knowledgeable of international music, who previously identified it, when I had put another background from a documentary on Intelligent Design featuring Michael Behe (yes, that one showing an aerial cable-way from his town Bethlehem, PA, but that was removed from my YouTube as I lacked of the rights to post those precious images, and then I lost track of where it was, until now that I checked my old cassettes that I had here in the USA) could be able to tell me the name of this World Music brief treasured by me beauty!!! (I took all of these photos both in Valhalla and in the Central Park of NY):
Fernando Castro-Chavez wrote on Héctor E. Gómez's timeline.
Estimado Prof. Héctor, Felicidades!!! Fernando.
Fernando Castro-Chavez wrote on Cesar Cosio's timeline.
Estimado César, felicidades en tu día y en muchos más por venir!!! Tu amigo Fernando.
And, the discovery of new and nearby twin parks (for adults (very nice for walking under the semi cloudy sun, especially its area at the left, filled with grass, here seen at the left of the ever present in almost every street fire hydrant, that looks like a neat and little tin man, with its red hat and gloves, while all its body is present in the silver color) and for children, this last one is closed at this time of the year), at Elmsford..., with all the vegetation of the fall similar to the one we saw right there at Central Park, NY:
You tagged 沈信學
These are the great photos and with high quality taken by the mighty camera-arm by Dr. Shen (沈信學) !!! (Closer and farther, a special "FB-eye", but different to that extinct and great show at PAX with Sue Thomas (https://www.dailymotion.com/video/x6u2cmx)! Posted all of them (Oops, when a video is within your last upload, you can not upload anymore, I had no idea, so it stopped short at 79)!! All of them precious postcards, with credits for all to Dr. Jason Shen):
With Cesar Cosío the friendship goes to the first Pre-Hispanic Concert that we organized together in The Big Stones (Las Piedrotas), in Tapalpa, Jalisco, MX. Jorge Reyes, as the most important musicians, was there, here remembering his music, here "El Ensoñamiento": https://www.youtube.com/watch?v=QTXo8BiQCc0 |
Fernando and Cesar are celebrating 2 years of friendship on Facebook!
With Cesar Cosío the friendship goes to the first Pre-Hispanic Concert that we organized together in The Big Stones (Las Piedrotas), in Tapalpa, Jalisco, MX. Jorge Reyes, as the most important musicians, was there, here remembering his music, here "El Ensoñamiento": https://www.youtube.com/watch?v=QTXo8BiQCc0
You tagged 沈信學
Central Park!!!, NY, 10/27/2019: 1) It all started with intense rain, with low clouds or fog covering thick the tops of the buildings (looked like in the evening so some street lights did turn on on themselves), and even some faint ice over the 6th Avenue!!!, 2) Followed the sun and a totally blue sky (like if it were another day), it got so warm that we started to sweat and needed to take off our coats, 3) Then everything cloudy in gray again with a colder wind, but in the end: 4) Open skies for the evening and for the night, giving us a grand orchestra of lights finale!!! Thank you God for showing us all these seasons in one and the same day (a New York typical minute)!!!
Fernando Castro-Chavez shared a memory.
4 Years Ago
Oct 28, 2016, 8:59 AM
For this 20th Class inspired by J. J. Arreola, another of his selections to "Read Out Loud", "The Beatitudes":
Matthew 5:1-12 (KJV):
“5 And seeing the multitudes, he went up into a mountain: and when he was set, his disciples came unto him:
2 And he opened his mouth, and taught them, saying,
3 Blessed are the poor in spirit: for theirs is the kingdom of heaven.
4 Blessed are they that mourn: for they shall be comforted.
5 Blessed are the meek: for they shall inherit the earth.
6 Blessed are they which do hunger and thirst after righteousness: for they shall be filled.
7 Blessed are the merciful: for they shall obtain mercy.
8 Blessed are the pure in heart: for they shall see God.
9 Blessed are the peacemakers: for they shall be called the children of God.
10 Blessed are they which are persecuted for righteousness' sake: for theirs is the kingdom of heaven.
11 Blessed are ye, when men shall revile you, and persecute you, and shall say all manner of evil against you falsely, for my sake.
12 Rejoice, and be exceeding glad: for great is your reward in heaven: for so persecuted they the prophets which were before you.”
And then, E. W. Bullinger’s Notes:
http://www.teleiosministries.com/companion_bible/New%20Testament/36%20Matthew%201303-1380.pdf
Mt. 5:1 - 7:29. Disciples Taught. "The Sermon on the Mount". (Introversion.)
Z (italics) | B | Mt. 5:1-2. Introduction.
C | Mt. 5:3-12. Characters. True Happiness.
D | Mt. 5:13-16. True Disciples.
E | Mt. 5:17 - 7:12. The Kingdom. Its Laws.
E (italics) | Mt. 7:13-14. The Kingdom. Entrance into it.
D (italics) | Mt. 7:15-23. False Teachers.
C (italics) | Mt. 7:24-27. Characters. True Wisdom.
B (italics) | Mt. 7:28-29. Conclusion.
Mt. 5:3-12. Characters. (Introversion.)
C | a | Mt. 5:3. Heirs of the Kingdom.
b | Mt. 5:4. Mourners. Reward for Mourners.
c | Mt. 5:5. Inheritance. Earthly.
d | Mt. 5:6. True righteousness.
d (italics) | Mt. 5:7. Fruits of righteousness.
c (italics) | Mt. 5:8. Inheritance. Heavenly.
b (italics) | Mt. 5:9. Peacemakers. Reward for Peacemakers.
a (italics) | Mt. 5:10-12. Heirs of the Kingdom.
Mt. 5:1. a mountain = the mountain. Well known and therefore unnamed, but corresponds with the Mount of Olives in the Structure of the Gospel as a whole! Cp. F and F (italics), p. 1315. There is a reference also to Sinai.
set. The posture of the Oriental teacher today.
disciples. Note this fact in interpreting the member Z.
Mt. 5:2. Opened his mouth. Heb. idiom. Fig. Metonymy (of Adjunct), Ap. 6, for speaking (Job 3:1; Dan. 10:16; Acts 8:35).
taught them. See note on 7:39, and the Structure, above. the Structure is the commentary showing that this teaching is connected with the proclamation of the kingdom (v. 3), and is to be interpreted by it. As the kingdom was rejected and is now in abeyance, so likewise this discourse is in abeyance with all its commands... until "the gospel of the kingdom" is again proclaimed, to herald its drawing nigh. Parts of this address were repeated at different times and on different occasions. Luke nowhere professes to give the whole address in its chronological setting or entirety. Only some thirty separate verses are so repeated by Luke out of 107 verses in Matthew. The later repetitions in Luke were given in "a plain" (Lk. 6:17) and after the calling of the Twelve (Lk. 6:13); here the whole is given before the calling of the Twelve (Mt. 9:9). These are marks of accuracy, not of "discrepancy" as alleged. Modern critics first assume that the two accounts are identical, and they say: "No one now expects to find chronological accuracy in the evangelical records"! For the relation of the Sermon on the Mount to Ps. 15, see Ap. 70; and to the seven "woes" of Ch. 23, see Ap. 126.
Mt. 5:3. Blessed = Happy, representing the Heb. 'ashrey (not "baruk", blessed). 'Ashrey (Fig. Beatitudo, not Benedictio) occurs in nineteen Psalms twenty-six times; elsewhere only in eight books (Dt., 1 Kgs., 2 Chron., Is., Pr., Job, Ecc., and Dan.). The Aramaic equivalent for 'ashrey is tob (sing., pl., or dual). See Ap. 94. III. 3, and Ap. 63. vi. Gr. makarios = happy (not eulogetos, which = blessed, and is used only of God (Mt. 14:61; Lk. 1:68; Rom. 1:25, 9:5; 2 Cor. 1:3, 11:31; Eph. 1:3; 1 Pe. 1:3)).
poor in spirit. The equivalent for the Aramaic (Ap. 94. III. 3, p. 135), 'anaiyim (Heb. anah. See note on Pr. 1:11) = poor in this world (as in Lk. 6:20), in contrast with the promise of the kingdom. Cp. Jas. 2:5.
spirit. Gr. pneuma. See Ap. 114.
heaven = the heavens. See notes on 6:9-10.
Mt. 5:4. Blessed. Note the Fig. Anaphora (Ap. 6). The eight Beatitudes are to be contrasted with and understood by the eight "woes" of 23:13-33. See Ap. 126.
Mt. 5:5. meek. Cp. Ps. 37:11.
the earth: or, the land. Gr. "ge". See Ap. 129. 4.
Mt. 5:6. hunger and thirst... The idiom for a strong desire. Cp. Ps. 42:1-2, 119:103.
Mt. 5:7. merciful = compassionate. Cp. Ps. 41:1.
mercy. Not merely now, but in the manifestation of the kingdom, Jas. 2:13 (cp. Heb. 4:16, 8:12, 10:28).
Mt. 5:8. pure in heart. Cp. Ps. 24:4, 73:1.
God. Ap. 98. I. i. 1.
Mt. 5:9. peacemakers. Cp. Ps. 133:1. Gr. eirenopoios. Occ. only here.
children = sons. Gr. huios, see Ap. 108. III.
Mt. 5:10. are persecuted = have been persecuted. Cp. Pss. 37, 39, 40.
for = on account of.
for righteousness' sake. Not otherwise.
Mt. 5:11. revile = reproach.
evil = harmful thing. Gr. poneros. Ap. 128. IV. 1.
against. Gr. kata. Ap. 104. x. 1.
falsely. This is another condition of the happiness of v. 3.
Mt. 5:12. Rejoice... See 1 Pe. 4:13. Cp. Acts 16:25.
in. Gr. "en". Ap. 104. viii.
for = because. Not the same as in v. 3...
Notices:
My dear sister, and Christ Cristina Tello González, from Spain, asks (sorry again for the delay on translating this to English):
1) Related to the repetitive use of the Aramaic word "Abba" plus the translation into Greek, or English, in which case will accompany the previous one, as: "Abba, Father" (as if repeating twice to the similar person: "Daddy, Father"); and,
2) About the timing of the crucifixion of Christ and a related event one day earlier.
These were my answers:
1) It seems that the best response seems to be that we are dealing with an Eastern Usage (an Idiom or 'Orientalism') in which when something wanted to be emphasized it was repeated twice (such as in all the times that Jesus says: "Amen Amen": "Verily, Verily" I say unto you...), and in this case with a slight variation seen in the Aramaic text: "Abba Aby" (Dad Daddy) in the Aramaic of Mk. 14:36, and "Abba Abun" (Dad Father) in the Aramaic of Romans 8:15 and Galatians 4:6. In the Greek, obviously, it is first put the Aramaic and then its translation to the Greek in a similar way for all the previous cases: "Abba ho Pater" (Dad the Father).
2) It´s advised to read the best book related to the topic: "Jesus Christ our Passover":
https://www.amazon.com/Jesus-Christ-Passover-Victor-Wierwille/dp/0910068305
There, we are able to see the next details:
In pp. 214-215 The Calendar shows for us that two Gospel writers are talking about two different things done in two different days; detailed as follows:
p. 202
John 19:14-15:
“…And it was the preparation of the Passover, and about the sixth hour [noon]: and be saith unto the Jews, Behold your King! But they cried out, Away with him, away with him, crucify him. Pilate saith unto them, Shall I crucify your King? The chief priests answered, We have no king but Caesar.”
p. 203:
“…here in John 19:14 it says that Jesus was before Pilate at noon, the sixth hour, after he had already been on trial before the Sanhedrin earlier in the morning. There is no one who can make any of these events fit chronologically unless he recognizes that this was only Tuesday…”
p. 207
John 19:16:
“Then delivered he him therefore unto them to be crucified. And they took Jesus, and led him away.” “...it was still Tuesday, the thirteenth of Nisan, about noon. Understanding this, the next events must have begun that Tuesday afternoon. Upon leaving Pilate, Jesus was not immediately taken and crucified. He was first taken by the Roman soldiers back into the Praetorium…”
p. 229:
“The time of the crucifixion, as stated in Mark 15:25, was the third hour, about 9 A. M. At this time Jesus was put on the cross and the malefactors were crucified with him.”
So, let´s keep on praying in tongues the ones for the others in order for God to continue surprising us with His Daily Wonders!
In Christ,
Fernando.
Related Links:
Jesus Christ Our Promised Seed:
https://web.archive.org/web/20151206175727/http://www.preteristarchive.com/Books/pdf/1982_promised-seed.pdf
Jesus Christ the Apostle and High Priest:
http://www.biblicalastronomy.com/jesusChristtheapostle.pdf
My Original Link is at: https://www.facebook.com/TastersOfTheWord/posts/1321706281185138:0
One of the favorite selections of Prof. and Writer Arreola, from MX:
Updated Oct 28, 2019, 1:42 PM
James William Ward is another great Homeopath, former student of the NYHC (now the NYMC), and then Honorary Member of its Board of Trustees, and whose painting can be seen also at the main entrance of the glass building of its College of Dental Medicine, H.R. and Gym (here shown at the left), he gave a speech to new graduates of the College in 1908 and said some very strong words there: "...it is a noticeable fact that when a man has been twenty years or so in a given community and seeks to gain entrance to some organization he generally meets his Waterloo for the first time; For no man in the right doing of his daily work, and certainly no man in the wrong doing of his daily work can do other than make enemies; the enemies may be those you least expect to find, and where it is impossible to avoid then, but it is most unpleasant to have them express themselves in that way. Enemies are important factors in stimulating things. Give me a man who has no enemies and I will show you a man who is accomplishing nothing for the world's progress. Nevertheless, avoid them when you can. It is important that you should do your life work without regard to friend of enemy - simply because it is right to do it...": https://babel.hathitrust.org/cgi/pt?id=mdp.39015076950172&view=1up&seq=543, published in the Magazine of the college that is still being published: https://issuu.com/newyorkmedicalcollege/docs/chironian2019?e=1841582%2F70560701, having been founded by the students in the 1880's: https://babel.hathitrust.org/cgi/pt?id=hvd.hc4hnh (J. W. W. wife has been added, Florence Nigthingale Ward, su estrecha colaboradora en todos sus proyectos):
My first presentation due yesterday: https://www.researchgate.net/publication/336826250_HO-1_and_Friends_versus_its_Enemies_-_Black_and_White_printer_friendly
Updated Oct 26, 2019, 7:18 AM
One of the amazing instruments invented by Benjamin Franklin is the "Glassarmonica" ('Glass Harmonica'), inspired in the idea of passing a wet finger to a cup with liquid, and one of the most intriguing compositions, by Philip Glass, doing honor to the instrument and the name!: https://www.youtube.com/watch?v=2WQ1H6f5Vs4, and also to hear non-stop more than 70 minutes of this instrument: https://www.youtube.com/watch?v=l8JfJumIXSQ; Franklin said: "Of all my inventions, the glass armonica has given me the greatest personal satisfaction." Here is a web page (one of many), talking exclusively a little bit about such a great and futuristic; "progressive", I must say, glass instrument (for which the great classic composers such as Mozart and Beethoven composed pieces)!!!: https://glassarmonica.com/ (Ah! And something brief about his writing about another of his passions:To play Chess!!!):
You tagged Mónica Do
Fernando and Mónica are celebrating 6 years of friendship on Facebook!
Fernando Castro-Chavez updated his status.
Fernando's most commented photo on Facebook of 2013
Dad, still alive at his 90 by the grace divine!
Studying, checking, and posting little by little the numerous things that I found at the "Benjamin Franklin Museum", where also was his house, at Philadelphia, PA, that belonged to Benjamin Franklin, or were invented by him, I found interesting from the start these ones: First, the Big Bible that he brought from Europe to America, to his daughter (who had seven children and kept it as their treasure!) and the importance of his wife for him to take off in his printing business after having arrived to Philadelphia, PA, which was a total success, even when he arrived with nothing, with no money but with the fullness of his will to prosper (as he was a very avid reader of everything!!!, even when he had a minimal formal education, having gone only until the second grade!!!)... and to build a good family (no matter what, he had a previous relation with a woman still unknown until today, with whom he had a son that his second woman willingly accepted and raised as their own!!! (A son that also had a son that had no descendants, so the name Franklin out of him, was lost at that point...!, as his other legitimate son died very young) So, as I keep on reviewing what I captured by my camera from that museum, I will be posting it... he invented the bifocal lenses among a lot of other inventions, ideas and occurrences, such as those "Magic Squares" of his invention that sum the same amount under any direction...!!! Even when in the school he was judged as no good for mathematics!!! (But, sorry that some of my photos are blurry...), but all of this and thousand things more make Benjamin Franklin a remarkable Founding Father of America!!!):
This is my film of the Washington Monument Fountain (in front of the Rocky Steps) in a Rainy Day: https://youtu.be/30b22PeKlhc
Updated Oct 21, 2019, 8:33 AM
You tagged 沈信學
"Proclaim Liberty throughout all the Land unto all the Inhabitants thereof" Inscription on the Liberty Bell, from Lev. 25:10 of the Bible. [Then the narrative continues as follows: "The Liberty Bell is a symbol of the American Revolution. It is a symbol of liberties gained and a reminder of liberties denied. It is a relic of the nation's beginning. It has inspired and challenged visitors, especially in times of crisis. Its outline, familiar throughout the world, conveys the idea of the continuing expansion of liberty to new peoples and into new aspects of life."] Then: "An investment in knowledge always pays the best interest". Benjamin Franklin. Rediscovering Franklin's Legacy, 1948 - present ...Archaeologists located the outline and basement features of Franklin's house and unearthed many 18th century artifacts... they decided... a representational design...the courtyard... ghost structures and landscape features seen today... won the Presidential award for its design excellence... then also the Rocky Steps at the Art Museum of Philadelphia and its Chinatown! The minimal essentials of our trip of today into PA!
Two great songs from the Philadelphia, PA, of "Rocky" (And there we go!): https://www.youtube.com/watch?v=-hNHgB5rAHQ (I really like this one, and Tracy used to do a very good work out of her signature at the gyms were she was a teacher!), https://www.youtube.com/watch?v=MR6FXpaECY8 (And now the "Rocky Steps" are the second most famous landmarks of Cinema (being the first landmark: Central Park, NY!!!), being the 72 stone-steps before the entrance of the Philadelphia Museum of Art! (Thanks to Kevin, from the Lab, for illustrating us on this one!)):
Updated Oct 19, 2019, 8:02 PM
I am very thankful that my previous research, when I had no lab or financing, or anything but only a brain and a trust in the Plan of God and in His Designs, is being valued and taken seriously, from all places, in Israel!!!, by the most progressive and free thinking individuals and researchers. So, I acknowledge עדי גולדנברג as one of the first ones to realize the importance of such findings; and this year, another researcher took it as a primary way to support his Discussion (And I used to tell my sisters: "I believe in what I am doing, even if nobody else does!"... However, some of the others and ridiculously vain evolutionists mocked this my work when it was just on its beginnings!!!):
You tagged 沈信學
My Facebook friend Sharon Kanwal asked me: "What do I do for a living?" And I responded to her: "Bible research for my personal joy (and actually to keep my brain as sane as possible), and I do molecules to eat!!!". Here am I, working on a clear blue and cold Saturday morning at the NYMC of Valhalla, NY (10/19/19), with my experienced colleague Jason (Shen, 沈信學)! He is very witty in the practical research! (Such as in those Western Blots and dealing with model animals!):
Fernando Castro-Chavez shared a memory.
4 Years Ago
Oct 19, 2016, 9:16 AM
Continuando con las clases que daba Juan José Arreola acerca de su primer punto, aquel de que para ser buenos escritores hay que ser buenos lectores, y que la fuente número uno de lectura e inspiración de él, y de muchos otros escritores que se distinguieron, era la Biblia, tanto por su información como por su insuperable estilo artístico en sus estructuras y diseños... Aquí, Arreola presenta una conferencia a las tan admiradas damas, la que él tituló: "La Implantación del espíritu"; aquí podemos ver su convicción en la veracidad histórica de la caída del hombre, así como en los literales seis mil años Bíblicos para la existencia del ser humano como tal sobre la tierra. Esta clase yo la presento primeramente en inglés, para dar a conocer internacionalmente las glorias de la literatura de mi tierra, reconociendo al profesor que me enseñó los fundamentos de lo que sé, y de lo que quisiera llegar a ser, gracias: https://www.facebook.com/TastersOfTheWord Fuente: https://books.google.com.mx/books?id=J3__DAAAQBAJ
Remembering the interface between science and literature, the real age of man on earth that Gosse understood based on the evidence, and that my professor Arreola also recognized, that of 6,000 years of antiquity for the humankind, based on the written and architectonic evidence that dates since from that time on. And then, writer Lopez Velarde acknowledging that the direct responsible of the fall of man was the man Adam, not Eve, towards whom he feels compassion.
Updated Oct 19, 2019, 7:37 AM
You tagged 沈信學
These are some of the silly photos that I requested Dr. Shen to take in New York: 1) Me, trying to catch "Spiderman" that went out of materials to prepare his twine; 2) then, remembering the profession of Tracy as fitness instructor, I added myself doing some unknown kind of exercise, to that group of exercising die-hard people; 3) later on, I got scared with the green Dragon from a tattoo parlor at Chinatown, and saw who was able to shout harder (I think I won, as in the end the animal got very quite and docile); and 4) Finally, I was just literally hanging-out over a gigantic and fantasy red dog...
Then, once at home and going through a South American store, I found a snack from Peru: "Chulpe (or "Chulpi") Corn", a nicely hollow and crunchy, with a little saltiness to it, an elongated variety of corn from those Peruvian lands:
You tagged 沈信學
And this is one of the most delicious desserts or snacks that I have ever tried, from the Chinatown market: Dehydrated Prunes coming directly from China! With sweet and salty flavor, and with a smell unique like in between powdered chocolate and cinnamon!!! (And by the side, the container in the store from which such delight was taken!; then I put the bone of the fruit or the seed into the water to keep on flavoring my drinks!!! But I need to go easy on eating these, because the tongue gets sore after too many of them!!!):
Fernando Castro-Chavez shared a memory.
7 Years Ago
Fernando Castro-Chavez added a new photo.
Oct 16, 2013, 5:18 PM
This is Coby's promotional for the presence of Lou Gramm at the LVH, and here is "Urgent", one of his early hits: http://www.youtube.com/watch?v=FHnNIoNUZig
Remembering those good days with my ex-wife Tracy at Las Vegas. Wishing the best for her and looking myself to have a family with good godly children:
Updated Oct 16, 2019, 6:40 AM
You tagged 沈信學
Dr. Shen (沈信學) and Dr. Fernando stranded in the 5th Avenue because a Parade of Latin American Nations was going on that Sunday 13th of Oct., so, in the end it was not possible to go to Central Park at that day, so we went to another place in the mean time...
Fernando Castro-Chavez shared a memory.
5 Years Ago
Oct 15, 2015, 11:58 AM
For the hardcore "Bible Researcher", the Strong's Exhaustive Concordance of 1890: https://archive.org/details/exhaustiveconcor1890stro [very big file in all its formats; takes a while to download] Found while searching something for my next presentation! In Christ!
The best concordance of the Bible, thus far, from those old days when I was doing biblical research in-depth, now I want to walk the walk live and in action, maybe some day again I will resume my studies, that I left when Paul was about to be in prison... (There is a time for each thing under the sun, said the "Convocator"):
Updated Oct 15, 2019, 8:44 AM
So, coming back from Times Square, NY, I turned on the radio to the next amazing song that let me wanting more, harpist and singer Erin Hill presents her version of "Dream On", from Aerosmith: |
So, coming back from Times Square, NY, I turned on the radio to the next amazing song that let me wanting more, harpist and singer Erin Hill presents her version of "Dream On", from Aerosmith:
This is the video recording of the trip that we did to the "Times Square Garden": https://youtu.be/DzxZA9g4lc0 of New York, after having been at the Chinatown and tasted some of the delicious and tasty duck and amazingly tasting prunes as desert with my colleague Shen (沈信學), apart of hundreds of more photos from there and from the Trump Tower and other dear locations...:
Updated Oct 13, 2019, 10:57 PM
This is the house in Cabot where I am living right now (in a room), and the car, courtesy of my older sister, now I just need my own Jessica Fletcher!!!
The earliest name of the "New York Medical College" (NYMC), where I am now, was the "New York Homeopathic College" (NYHC), and the seventh dean of it was an MD, a politician and an Homeopath: Royal S. Copeland, who: "Fought a good fight and finished his course and he kept his faith", and: "He was never so happy as in the midst of his own kin; and he was never more generous than in serving their pleasure and their needs. To him, 'home' was the sweetest word in the lexicon of worth wile things", and who appears here with his last wife Frances Copeland, portraits that in their originals are in the H. R. glass building also called the one of the School of Dentistry, where I started to go, in its basement, to the free gym of the college!!!: https://www.google.com/search?biw=1242&bih=568&tbm=isch&sxsrf=ACYBGNQ753Dy3bPoouelrottN41y75A6lg%3A1570904040985&sa=1&ei=6BeiXc_fO4T5rQHQySM&q=%22Royal+Samuel+Copeland%22+%22New+York+Medical+College%22&oq=%22Royal+Samuel+Copeland%22+%22New+York+Medical+College%22&gs_l=img.3...6116.6974..7581...0.0..0.317.2006.2-6j1......0....1..gws-wiz-img.sg_CDuB_Dlw&ved=0ahUKEwjP89rKqZflAhWEfCsKHdDkCAAQ4dUDCAc&uact=5
Fernando Castro-Chavez shared a memory.
4 Years Ago
Oct 12, 2016, 9:39 AM
Here's the detail with my best friend, my father, the only real friend that I have on this earth right now, from last Thursday's evening (10/06/16; photo by J.R.R.B, from http://www.zapotlangrafico.com/)
Remembering my great Dad, with whom I pray and speak almost daily, and with my mom!
Updated Oct 12, 2019, 7:40 AM
You tagged 沈信學
Place: NYMC Graduate School of Basic Medical Sciences (41.084052813081, -73.810430630215)
Address: 40 Sunshine Cottage Rd, Valhalla, NY 10595
The delicious plate prepared by Dr. Shen (沈信學): The sausage had spices that made the body of the taste amazing!!! Thank you God for having a neighbor that has expertise with the best flavors! The rustic plate, courtesy of my older sister.
You tagged 沈信學
Here, with my colleague Shen (沈信學), from Taiwan, having also colleagues from Egypt, Sweden, India, Spain, Argentina, Israel, USA, being myself born in Mexico, etc... (An international setting!):
Fernando Castro-Chavez shared a memory.
5 Years Ago
Oct 3, 2015, 1:05 PM
Today at Seven PM the Witness of the Stars 2, here is the set of slides: http://fdocc.ucoz.com/3/WS_3_02_witness_of_the_stars_2015.pdf In the image the superhighway (the Ecliptic of the sun, moon and planets)!
The celestial superhighway, where the sun, the moon, and the real planets drive: "The Ecliptic" (His "Line" says the Ps. 19), where they act as the pen, the pencil and the markers to pinpoint the fine-tuned details of the wonderful plan of salvation for us devised by God in His son Jesus Christ!!!
Updated Oct 9, 2019, 7:06 AM
This is one of my favorite songs by Stuart, because of the real concept so vivid and so important of what we are doing here as believers as revealed in Ephesians: "Working On A Building", by Marty Stuart & His Fabulous Superlatives (integrated by "Handsome" Harry Stinson, the taller of the pack, who sings his guts out in this great song, and by the one with glasses Kenny Vaughan, and also by Paul Martin), at the "Music City Roots" project of Nashville, TN: https://www.youtube.com/watch?v=CSA9C6GFYjg
Updated Oct 8, 2019, 6:28 PM
Place: BioInc at NYMC (41.082566433667, -73.814508921778)
Address: 7 Dana Rd, Valhalla, NY 10595
The place where I am here in New York!
Fernando Castro-Chavez added a new video to Mercedes Monroy Sánchez's timeline.
You tagged Mercedes Monroy Sánchez
Felicidades, por tu valiosa vida! |
Felicidades, por tu valiosa vida!
Updated Oct 8, 2019, 6:52 AM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Oct 8, 2015, 9:08 AM
Recordando que mañana viernes 9 de octubre a las 7:50 PM voy a presentar por YouTube: https://www.youtube.com/c/catadoresdelapalabra1 El Testimonio de las Estrellas 2. Estamos profundamente agradecidos con el trabajo de Büllinger y de otros en los que él se basó (Dr. Seiss, Miss Frances Rolleston, etc.), pero, amados míos, no hemos de quedarnos allí, sino que hemos de ir más adelante bajo la guía divina...
The Revelation of the plan of salvation narrated in the skies, courtesy of God in the millenarian meanings of Constellations (12 * 4) and the names of their stars!!!
Updated Oct 8, 2019, 6:49 AM
Fernando Castro-Chavez shared a memory.
3 Years Ago
Oct 7, 2017, 9:01 PM
Aquí dejo 1 Corintios del Griego Capítulos del 12 al 15: https://youtu.be/16IK8rRNuMY, en donde se ve el poder de la creencia, el del amor, y el de la esperanza que tenemos, ilusrando mi visita de hoy al bello paseo de "Las Peñas", en Zapotlan Jal
Two years ago in Las Peñitas, studying 1 Cor. 12-16, containing the power to manifesto Holy Spirit of God within! Useful wherever we are, under any circumstances, all opportunities to keep on believing on God and His messages to us!!! Now at NY, practicing those things that were studied in the past about our good God and His son, a very peculiar team!
Updated Oct 7, 2019, 6:47 AM
Going through Bristol, VA, inside the great "Birthplace of Country Music Museum" they had a photographic exhibit in black and white taken by Marty Stuart who apart of being a singer, player and composer of country music, he is an excellent photographer! (Famous for having taken the last living picture of Johnny Cash, 3 days before his demise! Which now reminds us also of the last tremendous recording of Cash at his house, a house that ended up burning down to the ground after the death of Cash and of his wife (who died some four months before him) soon after him; he died some seven months after this cover that he did (his wife can be seen in the video), which narrates his life just as it was...: https://www.youtube.com/watch?v=8AHCfZTRGiI, he sang this last song of him after listening hundreds of times the original version, and amending some offensive words from it, as this recorder did: https://www.youtube.com/watch?v=72yU7QWw-74; this is what Trent Reznor, the original composer, from the rock band "Nine Inch Nails" about the interpretation by Cash, which makes a knot on our throat: "Wow. Tears welling, silence, goose-bumps… Wow. [I felt like] I just lost my girlfriend, because that song isn’t mine anymore… It really made me think about how powerful music is as a medium and art form. I wrote some words and music in my bedroom as a way of staying sane, about a bleak and desperate place I was in, totally isolated and alone. [Somehow] that winds up reinterpreted by a music legend from a radically different era/genre and still retains sincerity and meaning — different, but every bit as pure...!") Here, I add one of the songs of Marty Stuart with which I had wanted and dreamed to identify my driving trip!: https://www.youtube.com/watch?v=scaNnHUyHrU; then he produced his own albums, being this, one of his acclaimed productions: a Gospel Album!!!: https://www.youtube.com/watch?v=Rh5EEB17tts, https://www.youtube.com/watch?v=SNK39ew3ONQ&list=PL3fEEOLO7951KEK6APjdvdqjRRiLpBiDX, and another Gospel song for the country album to help in the research against AIDS, in collaboration with the Sullivans and Larry Marrs: https://www.youtube.com/watch?v=Rh5EEB17tts
The Headquarters of George Washington in Winchester, VA, he was measuring lands first, and got 2,300 Acres of the best land for himself, including his Mt. Vernon, then he started serving the British (hence the two flags! At that time the British flag was mostly red with its current symbol occupying 1/4 of the flag in the upper left) against the French who had colluded with the Indians, promising the French to them to respect their lands... Then, he was elected representative of his land, marrying the wealthiest girl in the region... And all of these, even before his heroism in the independence, and his being the first president if the great USA!
In case there is interest by some of my former colleagues at Baylor (BCM), or of my former students at the UdeG (CUCS and CUC), a good acquaintance and colleague at the NYMC and in charge of hiring research personnel for "Regeneron" is seeking for some good Molecular and/or Medical researchers: https://careers.regeneron.com/job/REGEA002617305BR5080/R-D-Specialist-Ophthalmology (I wish when I was seeking myself, that someone had done this!!!):
Updated Oct 2, 2019, 1:16 PM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Sep 30, 2015, 6:46 PM
This Saturday (10/03/15), at 7:00 PM, by the sheer grace of God, I'll be sharing at home: "The Witness of the Stars 2", it can be followed online at the site: https://www.youtube.com/c/CatadoresDeLaPalabra1 Ps. 119:89 was found in Houk's class. Our love for God is beyond anything else! Not because of ourselves, but because of Him and only Him!!! One week later, God willing, Friday night (10/09/15) will be presented in Spanish at 7:50 PM, see you here, there, or in the air!!!
An awesome statement of the Plan of Salvation written on heaven!!! And the ideal couple worshiping God together!
Updated Oct 2, 2019, 12:14 PM
Recordando al de la Cd. de MX (gracias a J. Castro por corregirme en esto) José José, que en paz descansa: https://www.youtube.com/watch?v=RzJ3QjBsqM0 "Amar y Querer": https://www.letras.com/jose-jose/135213/ : "...Amar y querer no es igual / Amar es sufrir querer es gozar / El que ama pretende servir, el que / Ama su vida la da / Y el que quiere pretende vivir y / Nunca sufrir y nunca sufrir..."
Updated Sep 29, 2019, 8:06 PM
Fernando Castro-Chavez shared a memory.
2 Years Ago
Elva Marìa Ventura added a new photo — with Martín Adalberto Sánchez Huerta and 2 others.
A year ago, with the great literary and artistic crew at Zapotlan, this year surrounding an awesome scientific and research group at Valhalla!
Updated Sep 28, 2019, 5:19 PM
"""HE's Got the Whole World in HIS Hands!!!""" https://www.youtube.com/watch?v=3-32k9TuEUE, https://www.youtube.com/watch?v=bZ4mnEq5HNo, https://www.youtube.com/watch?v=UFFJhO90VN8
Fernando Castro-Chavez shared a memory.
Fernando's Summer Memories
From the complete fiasco at the Philippines, but keeping the joy of the Lord, to the current hard work on my field in the belly button of the Universe!!!
You tagged Eva Virginia Espinoza
Gratos recuerdos de poesía y de melodía en aquel EDUCEM de la "Arreolanza", EDUCEM que dirigía nuestro buen @[1044520597:2048:Victor Ricardo Cabeza De Vaca Perez]: |
Fernando and Eva are celebrating 1 year of friendship on Facebook!
Gratos recuerdos de poesía y de melodía en aquel EDUCEM de la "Arreolanza", EDUCEM que dirigía nuestro buen Victor Ricardo Cabeza De Vaca Perez:
Through the lands in memory of Francis Nash: |
Through the lands in memory of Francis Nash:
The Gospel roots in the Christian Foundation of Country Music in the USA!!!: Bristol, Virginia, its "Sessions" of 1927-28!!! With the song most characteristic of those recordings, dealing with the Mighty return of Jesus Christ for his own!!!: https://www.youtube.com/watch?v=36xj-2B_ZBQ (Added later: Some more photos presented in a great video at the place)
Fernando Castro-Chavez shared a memory.
3 Years Ago
Sep 15, 2017, 9:47 PM
En la Segunda Epístola a los Tesalonicenses descubrimos que la “Hé Apostasía” se corresponde con “La Partida”, es decir: con “El Rapto” (el “Harpazo”), y con nuestra reunión con Cristo: https://youtu.be/SpXO9jAjQdo Y aquí en la foto está lo que estos creyentes en el Señor han producido, lo que me ha ayudado en mi lectura del griego de la tremenda 2 Tes., algunos de los libros de estudio Bíblico textual (porque ellos estudian las escrituras en detalle, del texto griego original, versículo por versículo); sus autores correspondientes se muestran abajo. Esta ensalada de estudiosos Bíblicos me recuerda a la serie clásica de los 80´s: https://youtu.be/P7PRGiQjbqk, https://youtu.be/Ecmps6Mh5Yg, https://youtu.be/r29QauFlimw. ¡Gracias! En Cristo, Fernando.
Remembering my studies on 2 Tes., the restrainer, the holy gift of the spirit of God inside His own, is putting a boundary today for the full expression of evil, preventing the full expression of the antichrist on earth, but as soon as Christ takes us away from this planet, the Apocalypse will break loose! Thank you living Jesus for undeservedly taking us with you at that blessed moment, just by the grace towards us of having entrusted you with our whole lives!!!
Updated Sep 15, 2019, 9:35 AM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Fernando Castro-Chavez added a new photo.
Sep 11, 2015, 10:03 AM
Amigos! Parte de lo que vamos a ver hoy por la noche! Aproximadamente desde las 7:50 PM, hora de Houston en vivo, desde nuestro canal: https://www.youtube.com/c/CatadoresDeLaPalabra1 Las Constelaciones y Planetas se postraron, anunciando el nacimiento de nuestro Señor Jesucristo el primero de Tishri del año tres A.C., que ese año cayó en un once de septiembre. Si Dios numera y conoce el nombre de cada estrella, con mayor razón te conoce a tí, y tus más íntimas necesidades, y Él te promete que te las va a suplir!!! En Cristo, Fernando Castro-Chavez.
Remembering the wonder of wonders of the Creation by God of the Universe, and how the Psalm 19 clearly traces the starting original place of the beginning of the celestial narrative of the Plan of Salvation: From Virgo, from the virginal birth of our Savior!!! Then the line that the sun follows during the year is currently called the Ecliptic, which is the superhighway for the sun, the moon and the real planets, for them as the different colors are tracing their remarks through all of the twelve constellations of this "Line" as the Bible says (plus its extra three per main Constellation (per each "Zodiac Sign"), to detail even more the story, to give us a total of 48 ancestral Constellations given by God to the first men!):
Updated Sep 11, 2019, 8:31 AM
You tagged Lidia Ruiz Gomez
Lidia, muchas felicidades en tu día!!! Gracias por todo tu apoyo y oraciones!!! Sea Dios el que siga directamente iluminando tu vida!!! |
Lidia, muchas felicidades en tu día!!! Gracias por todo tu apoyo y oraciones!!! Sea Dios el que siga directamente iluminando tu vida!!!
Fernando Castro-Chavez shared a memory.
5 Years Ago
Fernando Castro-Chavez added a new photo.
Sep 7, 2015, 12:07 PM
Para los amados santos de habla hispana: La presentación en vivo de la "Astronomía del Nacimiento de Jesús" será este viernes a las 7:50 P.M., hora de Houston, TX, en: https://www.youtube.com/c/catadoresdelapalabra1 Sus transparencias: http://fdocc.ucoz.com/2/06_estrella_de_belen_2015.pdf Comenzamos a las 7:30 por Skype para oraciones y manifestar espíritu santo, y después para la sobremesa!!! En Cristo, Fernando.
Here again, in the minute detail of the wondrous God we have, regarding what happened in the second and third conjunction of Jupiter with Regulus, when the moon eclipsed, two times! (to simulate the retrieval by the "Justice of God": Jupiter: Tsedek, of two things mentioned next, to be delivered to their proprietor, represented with Venus: "The prototype of the human perfection": Jesus Christ!), just as I found that the Septuagint translates such word in Gn. 49:10a: "The scepter shall not depart (be eclipsed) from Judah, nor a lawgiver from between his feet, until Shiloh (their owner: Jesus!) comes":
Updated Sep 7, 2019, 10:21 AM
Fernando Castro-Chavez shared a memory.
3 Years Ago
Sep 6, 2017, 5:54 PM
!El Señor Jesús viene a transformar a estos pobres pecadores que le han creído a él! Y aquí mi lectura de 1 Tesalonicenses: https://youtu.be/1Xs4HO2X2LM (En la foto: Schoenheit, y un humilde servidor, Büllinger, Dake, Lacueva, y Constable):
De cuando preparaba mis estudios de las Epístolas, cuando aún existía ese bendito tiempo de hacerlo:
Updated Sep 6, 2019, 9:25 AM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Fernando Castro-Chavez added a new photo.
Sep 4, 2015, 4:18 PM
So, if you are around and want to come, tomorrow Saturday 09/05/15 at 7:00 PM we'll study the astounding 'Astronomy of the Birth of Jesus', also possible to be seen at: https://www.youtube.com/c/CatadoresDeLaPalabra1 (live and afterwards); and its slides: http://fdocc.ucoz.com/2/03_star_bethlehem_1_2015.pdf (the same info. will be shared in Spanish next Friday 11 at 7:50 PM) See ya!
Remembering that glorious moment when Jesus Christ was born, on that September the 11th of the year 3 B.C., the 1st of Tishrei (or Tishri), the beginning of the civilian year of the Hebrews (that this year of 2019 falls into the 30th of September, at the center of their Rosh Hashanah, as every year changes in relation to our calendar, according to the moon); so, here is one of my animations with that extinct software that @[1415462595:2048:Mike Mandi Ackerman] gave me on that great day of 2000 ("First Light") when Tracy and I went to the hospitable house of @[1761157665:2048:Dianne McAllister] and family...; the music: "Feast of Trumpets" is that of another of our brethren, the muscular George Saint George: https://www.youtube.com/watch?v=53_10GfaN4c, praying for the family of God and for its love, really with no conditions (unconditional love of Christ), as the master of love is remembered, here being born exactly at the instant when one of the stars representing him: Spica (Tsedek: The Branch) was posing itself into the horizon of the sky of Bethlehem!!!:
Updated Sep 4, 2019, 8:11 AM
Desmond Thomas Doss: A real life Superman hero due to his trust in God! (So we can be! And more in Christ...):
This is a real-life Desmond T. Doss program: "This Is Your Life" (NBC), where the parents, wife and son, and some of his war buddies and bosses show up to bear homage to him; in this edit that I did, I removed commercials of long gone and almost all of them useless sponsoring products, putting him at the start with his family, and there can be seen that his treasure is his pocket Bible (the one lost and found), that small Bible given to him by his wife, which he is holding in his hands, and then the (nervous at the cameras) war companion that talks about the prayer life of Desmond in the battleground, and also of on of his bosses, talking about his Bible-reading habit and study, even while in the midst of the worst war scenarios! (precisely where all of this is the most needed!!! So,as he could in Christ!: Why not each one of us??? To see the original order of the show and those 4 extinct commercial products (a mild dishwasher, a ladies shampoo, a dry toothpaste, & an airline long gone...; the only that I left, near the end is the one of a fund of those days to fight against the heart disease...!), go to: https://www.youtube.com/watch?v=4_V6h6EJh9c; and the place from where I realized about the existence of this program: https://web.archive.org/web/20180501054647/https://faithofdoss.com/tag/history): |
This is a real-life Desmond T. Doss program: "This Is Your Life" (NBC), where the parents, wife and son, and some of his war buddies and bosses show up to bear homage to him; in this edit that I did, I removed commercials of long gone and almost all of them useless sponsoring products, putting him at the start with his family, and there can be seen that his treasure is his pocket Bible (the one lost and found), that small Bible given to him by his wife, which he is holding in his hands, and then the (nervous at the cameras) war companion that talks about the prayer life of Desmond in the battleground, and also of on of his bosses, talking about his Bible-reading habit and study, even while in the midst of the worst war scenarios! (precisely where all of this is the most needed!!! So,as he could in Christ!: Why not each one of us??? To see the original order of the show and those 4 extinct commercial products (a mild dishwasher, a ladies shampoo, a dry toothpaste, & an airline long gone...; the only that I left, near the end is the one of a fund of those days to fight against the heart disease...!), go to: https://www.youtube.com/watch?v=4_V6h6EJh9c; and the place from where I realized about the existence of this program: https://web.archive.org/web/20180501054647/https://faithofdoss.com/tag/history):
Fernando Castro-Chavez shared a memory.
5 Years Ago
Fernando Castro-Chavez added a new photo.
Aug 30, 2015, 9:31 PM
This coming Saturday at Seven we are going to remember the amazing and all-wise Father we have! One that organized the Heavens and His old Laws in a way as to announce the precise hour of the birth of His precious son, our Lord and Savior Jesus Christ!
Remembering those days, when sharing about it was the best! And even before, when all of this happened! How God revealed to John the Apostle and Prophet that just at the moment of the birth of Jesus, on September the 11th of the year 3 A.C., which was the beginning of Tishri the 1st, the start o the Civilian year for the Hebrews, the day of the double blow of trumpets: With the silver ones and with the ones made using the long and twisted horns of rams! So, as the star of "Spica" ("Tsemah" in Hebrew: "The Branch", representing baby Jesus) in the constellation of "Virgo" (representing Mary the mother of baby Jesus) was touching the horizon, at the very same time that the baby was being born!!! So the sound of trumpets started, receiving the Jewish leaders their King with special sounds of trumpets, without even knowing it!!! So the heavens created by God where giving their testimony of the arrival of the Savior of the believers of the world, and the law revealed by God was giving also its testimony of the same: The promised Messiah (Christ) was breathing for the first time the air of this planet with the sound of trumpets celebrating it year after year until that moment of its final fulfillment!!! Oh precious wonders of God that keep us at awe and alive to praise Him ever and ever, no matter what!!!
Updated Aug 30, 2019, 8:18 AM
The heroism of Desmond Thomas Doss in "The Bible Tells Me So": Another Comic Book that took seriously the history of his strength taken from the Bible, is this one, of which the 42 most significant drawings have been added here, those where the Bible is the inspiring power behind the resolve to save 75 wounded soldiers in a span of 12 hours (taken from: https://www.facebook.com/DesmondTDoss/photos/a.1837185809884490/1837185856551152/?type=3&theater):
Here is the portion, in order and scene by scene, of the original classic "True Comic" cartoons from 1946 regarding the heroic actions of Desmond Thomas Doss, which I have saved: https://web.archive.org/web/20190828014331/https://fdocc.yolasite.com/resources/DesmondDossComic.pdf, and originally: https://adventistdigitallibrary.org/islandora/object/adl:366778, the original Editorial board included Mr. Gallup, the same one which is famous for his Polls:
Fernando Castro-Chavez shared a memory.
4 Years Ago
Aug 27, 2016, 1:54 PM
Aquí está el 'Eclesiastés' del hebreo: https://youtu.be/4qCfu6l01jc (o Koheleth en hebreo, "Convocador" en español), que se leía durante los siete días de la "Fiesta de los Tabernáculos", escrito por Salomón, y conteniendo una maravillosa 'Estructura Fractal' inspirada por 'El Gran Elohim': "El Dios que con sus Huestes en Justicia Controla al Universo": En este libro, entre muchas otras cosas, se observa claramente que en realidad la palabra para referirse a Dios como "El Creador" es otra palabra hebrea bien definida (presente en Ecl. 12:1): "Bowreka" (Creador), derivada de la raíz "Bara" (Creó, Gén. 1:1). La otra fiesta que también duraba 7 días y en los cuales también se leía otro libro de Salomón, "El Cantar de los Cantares", era la "Fiesta de los Panes Sin Levadura" o "Pascua": https://youtu.be/z2oJxAGeAyM, mientras que en el "Día de Pentecostés" se leía el libro de "Rut", la Tatarabuela de Salomón: https://youtu.be/zee-VkOV8_s ¡Qué gran privilegio para el hombre más sabio que existió en el Antiguo Testamento, Salomón, el haber estado involucrado de una forma u otra en los escritos importantes de las tres fiestas obligatorias para todo varón hebreo! Y de ninguna manera fue perfecto sino que cayó en errores muy graves, pero a pesar de eso, ¡nunca perdió su conexión con Dios! ("nunca me dejó la Sabiduría", diría él). Alabado sea Dios por la Era de Gracia en la que con mayor razón tenemos el constante acceso a Dios y una mayor sabiduría de la que tuvo Salomón, ¡pues mayor que él es el Cristo que mora en nosotros! Tan sólo platiquemos con él, ¡y él mismo nos garantiza que recibiremos!
This is of those days when I had the humble privilege to discover the fractal structure in the book of Ecclesiastes, designed in a way such as when God the Creator designed the Nautilus shell, a feat divinely inspired, as the rest of the Bible by God!!!:
Updated Aug 27, 2019, 9:20 AM
I just saw the movie of "Hacksaw Ridge", about Desmond Thomas Doss, represented by Andrew Garfield (but this time representing a real life "Amazing 'superman'"), and directed by Mel Gibson, which won two Oscars for it!: The powerful tool ever present in all the movie from beginning to end is The Bible!: https://desmonddoss.com/photos/index.php?c=Doss+Catalog and https://www.google.com/search?q=Doss+Commandment+Picture+HD
You tagged Luis Fernando Guzman
This bird needs to be flying high again, up north, with the help of God, in deep need of my female companion (could I wait for two years?), of a job, of a car, and of course, of a place to live, open to be anywhere there!; so, spiritual prayers are the most needed please! (And, obviously, any inspired personal message as well is very welcome! In Christ, https://www.youtube.com/watch?v=szFtU8-JcGY: The Bird Walk):
Fernando Castro-Chavez shared a memory.
10 Years Ago
Fernando Castro-Chavez added a new photo.
Aug 18, 2011, 9:48 AM
Esta hoja muestra en la parte inferior izquierda, en el sitio donde se pega la estampa, el dibujo de la tierra como debería de estar al principio, la pangea, un bloque con todos los continentes unidos que Dios hizo emerger el día 3.
These were the first images I saw in my childhood and the first histories that were read to me by my parents, I needed to retrieve that book of stamps and drawings, just to keep the memories alive and to pass them to the next generation, the history of Creation (and later in my 20 I did learn that those six days plus the day of rest were rather the history of the re-ordering of a previously already ruined, fully drowned in water, with no light and not a shred of breathing life, due to the rebellion of Lucifer already in the second verse of all the Bible: Genesis 1:2: "And the earth BECAME (hayaṯah, because Is. 45:18 says that it was NOT made that way!!!: "He established it (the earth) not in vain (tohu)!!!") without_form (tohu) and (wa) void (bohu) and darkness...", here, this was already the presence of the Adversary (Satan) and Accuser (Devil), and his 1/3 of fallen angels, now being the demons, in total contrast and opposition to God, until the end of times, were he is called also the Dragon (allusive, as per the symmetry of the Bible found by E. W. B., to his involvement in the design of the dinosaurs before his fall...)...: https://biblehub.com/interlinear/genesis/1.htm)... [I want to teach all of these things to my dear and personal future family, but: Oh dear future wife and future offspring: Where are thou?] Y, en español, aquí está el libro completo en 5 partes, preservado para la posteridad y para esos mis niños, ¡cuando los tenga!: https://web.archive.org/web/20190820234018/https://fdocc.ucoz.com/LibroDeOroDeEstampasDeLaBiblia-1-10.pdf, https://web.archive.org/web/20190820234134/https://fdocc.ucoz.com/LibroDeOroDeEstampasDeLaBiblia-11-20.pdf, https://web.archive.org/web/20190820234303/https://fdocc.ucoz.com/LibroDeOroDeEstampasDeLaBiblia-21-34.pdf, https://web.archive.org/web/20190820234402/https://fdocc.ucoz.com/LibroDeOroDeEstampasDeLaBiblia-35-45.pdf, https://web.archive.org/web/20190820234511/https://fdocc.ucoz.com/LibroDeOroDeEstampasDeLaBiblia-46-56.pdf (aquí en esta última parte es en donde se encuentran las estampas.)
Updated Aug 18, 2019, 9:31 AM
Fernando Castro-Chavez updated his status.
Y, con el gran gusto de compartir finalmente mi estudio de Hechos 17 al 20 del Griego: https://youtu.be/-SzfCs8lgWA
Updated Aug 16, 2019, 11:20 AM
Fernando Castro-Chavez updated his status.
This is when I was sharing about Song of Songs, which in reality was written for Solomon and not by him, because it narrates, as per the E. W. Büllinger's research, the loss or failure of Solomon to conquest this Shunammite dark brown woman (a native of the town of Shunem, north of Mt. Gilboa in ancient Palestine) that he liked the most!!! (And remember that by divine design: This was the main reading during the seven days of the Passover!!!), because she was faithful to her blond and white poor shepherd, instead of all the riches and promises of King Solomon!!!, here is the extraordinary phrase of that Song (and that is why in Eccl. Solomon said that one wise man in a thousand at least he has found, but not even one woman, sorry but he said that, in all of his thousands upon thousands... and the one he thought was like that: She precisely is the one that did NOT liked him!!!); here then, those words of gold from the Hebrew, as said by her humble and truthful to her, that man, a little country dweller (with my notes in brackets, read on the seventh (perfection) day of the Passover feast!): "Oh, put me like a seal over your heart [And you know dear how painful is the fire burning with my name engraved in the heart as you are in mine!!!] and also like a seal over your arm [Which means in the invisible parts first:The heart!!! But also in the visible evidence that I am the one in your life: Your visible arm!!!], because strongest as death is love and hard and cruel as the sepulcher, the Sheol the jealousy feelings, the flames of them are flames of fire, so, love is the intense flame of the faithful God: Yah, the many waters can absolutely not [being this the absolute not instead of the conditional one, so it refers of the Love of God, the same one that we can express now as part of the fruit of the spirit!!! But just if we want!] stop love, and the rivers can absolutely not drown it!!!
Y, ahora que veo lo de las protestas en el aeropuerto de Hong Kong, recuerdo cuando éstas comenzaban, cuando pasé por allí la primera vez (estuve atorado la noche del cinco de Julio del presente)...: https://youtu.be/BEYsoROFnfo, que es la historia número cinco del video que acabo de subir del 13 de Agosto, 2019, y el recuerdo de mi paso por allí; a ver si ya terminan esas protestas para poder pasar de nuevo pacíficamente por allí, con el triunfo de los manifestantes que no desean que China aumente su injerencia sobre Hong Kong, en este caso en relación con los presos de Hong Kong (pero eso sería tan sólo el comienzo), que no sean enviados a China (donde todos temen que serían torturados y jamás se volvería a saber de ellos): https://www.facebook.com/fernando.castrochavez.90/posts/2572218236164170, la historia principal de ayer fue la de: https://web.archive.org/web/*/https://www.animalpolitico.com/estafa-maestra/, ¡miren desde cuando estaban los primeros datos salvados y hasta cuando se le hizo caso a esto!
Updated Aug 14, 2019, 10:27 AM
Fernando Castro-Chavez shared a memory.
7 Years Ago
Fernando Castro-Chavez added a new photo.
Aug 14, 2014, 8:23 AM
At the moment of the birth of Jesus, unbeknownst to them, the Priests started to play their double sound of trumpets: 1) The monthly one with silver trumpets, but most specially, 2) the unique sound for the beginning of the 7th. month (Tishri 1): The sound of the Shophar, the cornet made by the horn of the Ram (prophecy of the arrival of the Lamb of God); thus, the periodicity of the Law was/is also prophecy! It's the shadow of things to come! Unawares, the Hebrews received Jesus as the King!: http://www.youtube.com/watch?v=XXw3LgmGUI8
Entonces, así como los cielos anunciaron la venida de Jesús, la misma ley dada por Dios la anunciaba, ya que Dios estableció en esa ley que el primer día del año civil, el Primero de Tishri, hubiera un doble toque de trompetas justo al comenzar el día, que era en cuanto el sol se ocultara, en ningún otro día del año había esto tan especial, en el que tocaban con sus largas trompetas de plata y además con los retorcidos cuernos del carnero (los Shofar), entonces, los judíos sin saberlo y sin siquiera aceptarlo, ¡recibieron a su rey con doble toque de trompetas!, ya que Jesús nació precisamente el 1 de Tishri del año 3 A.C. al atardecer (entre 6 y 7 PM) que entonces cayó en nuestro 11 de septiembre; y ¡ahora nos parece evidente que era obvio que nuestro gran Dios sellara el nacimiento de Su amado hijo, el salvador del mundo con señales en los Cielos de Su Creación y en la Escritura de Su Revelación!:
Updated Aug 14, 2019, 9:01 AM
Fernando Castro-Chavez updated his status.
Con dos palabras dadas consecutivamente por los profetas, tenemos los nombres: 1) De la más brillante estrella en la constelación de Virgo (recordando que el hebreo se lee de derecha a izquierda) "Semah": El renuevo, el brote, la rama: ¡referente a Jesucristo a punto de nacer! (Luego viene "Libra" que antes representaba al producto de Virgo: Al bebé Jesús recostado en su pesebre: El sacrificio sobre el altar, y aún el símbolo antiguo de esa constelación indica eso), nombre hebreo de la hoy llamada "Spica", la primera constelación de la eclíptica del llamado "Zodiaco", la cabeza: la mujer dando a luz, de la que sale el sol al comenzar su recorrido como el esposo contento saliendo de su lecho nupcial, nos dice el Salmo 19, y 2) "Saddiq", que era el nombre hebreo del hoy llamado planeta Júpiter, que se ve en la foto comenzando su serie de tres conjunciones con la más brillante estrella de la última constelación o Leo: El rey de reyes y Señor de Señores:¡Jesucristo que viene a reinar en su segunda venida!, siendo la profecía acerca de Régulo ("Raglaw" en hebreo) aquella de Génesis 49:10: "No será quitado (¡eclipsado!, dice la Septuaginta, y sabemos que eso sucedió en dos consecutivas ocasiones, ya que eran dos cosas las que simbólicamente tenían que ser removidas de entre las patas del león, como nos dice a continuación la escritura, ¡por la luna eclipsando a Régulo!, en ese movimiento retrógrado de Júpiter alrededor de Régulo) el cetro de Judá ni el bastón de mando de entre sus pies ("Raglaw": las patas delanteras del león que está reposando), hasta que llegue Siloh ("Al que le corresponde", es decir a Jesucristo)"... oh maravilla del evento magno visto alrededor del primer año del nacimiento de Jesús por esa multitud de sabios de Persia, ¡los que vinieron a presentarle sus regalos al salvador de los creyentes en él de este buen planeta tierra!
One more evidence, unearthed from Ephesus, about the existing guild of silversmiths, mentioned in Acts Ac 19:23-28, which lasted for centuries, is this one of the 3rd century A. D. in honor of Valerius Festus, proconsul and benefactor of them, and also for his work on cleansing the harbor (which was filled with silt from the Cayster River, reason why mariners avoided Ephesus, if they could). The key word, that is "Arguro": "Silver" is found in the right side of the fifth line (historical stone at the Efes Müzesi (Museum, of what was previously Ephesus), Selçuk, Izmir, Turkey, evidence just published three years ago, in 2016, precisely from August, B.A.R. 42:4, "Archaeology Gives New Reality to Paul’s Ephesus Riot", so I say that the amazing evidence of the complete truth of every single original detail of the historical Bible can be corroborated, and in an ongoing process of discovery!!! Locked at: https://www.baslibrary.org/biblical-archaeology-review/42/4/2):
Amazing visual art, in blend with that previous track of the live concert by Mike Oldfield done in Galicia, Spain (1999), with his amazing: "In The Beginning" & "Let There Be Light"!!!: |
Amazing visual art, in blend with that previous track of the live concert by Mike Oldfield done in Galicia, Spain (1999), with his amazing: "In The Beginning" & "Let There Be Light"!!!:
Fernando Castro-Chavez wrote on Amaury Rodriguez's timeline.
Dios bendiga tus 56, y muchos más hasta el retorno de Jesús por tí y por mi, y por nuestros amados hermanos!!!
Fernando Castro-Chavez wrote on Eduardo Azuri Miranda's timeline.
Feliz cumpleaños ¡al Eduardo Azuri Miranda de aquellos días del arte, la cultura y la poesía! Parece que fue ayer...
And one of my favorites: Mike Oldfield interprets his tracks "In The Beginning" & "Let There Be Light"; Live at a FREE concert in Santa Cristina, Galicia, Spain (the country in which he sold most of these records, in 07/31/1999, in front of 60,000 spectators), and fragments with the voice of astronaut William Anders, at the official video for the second song (which Oldfield said that costed to him, in Dollars: $ 200,000.00, here to be seen in full: https://www.youtube.com/watch?v=HZw_sZH0bGs, and with his comments about it: https://www.youtube.com/watch?v=vJ1Skb2xfdE):
Ajijic, MX, 26-29 July, photos of the place (with my dear parents; also, there we had the rest of the family and their in-laws) and more at the videos that I have updated with them, of my radio program of "Ecocidio": https://www.youtube.com/watch?v=BvByqVtzj3M, https://www.youtube.com/watch?v=IWmyedo853k, https://www.youtube.com/watch?v=xOIfMKWBCVo (being these last two, the great melodies in Spanish: "Carta del Mundo al Hombre" ("Letter from the World to Man") & "La Ciudad Pregunta" ("Questions from The City") composed by Gerardo Ochoa, in company with Victor Velasco Neri), https://www.youtube.com/watch?v=b-pn_kuhP0I, https://youtu.be/oRKp1eP2-1o, https://www.youtube.com/watch?v=Xq1xVDRLmGk, https://www.youtube.com/watch?v=MOVjKZlJwqM (before, I had them with photos of the debtor, but because that debt is paid, I removed those and added these, I think prettier ones, from that memorable trip!):
Fernando Castro-Chavez shared a memory.
5 Years Ago
Aug 9, 2016, 9:40 AM
Amadas Santas y Santos, Ésta es mi lectura del libro de Rut del Hebreo, libro que se leía el día de Pentecostés, dedicada a aquella que será mi mujer, sea quien esta fuere: https://youtu.be/zee-VkOV8_s [Y el que se leía en la Pascua: https://youtu.be/zee-VkOV8_s] En Cristo, Su Fer.
The beloved (grrrr...) told me yesterday that the true love is able to wait, but I know that also the true love is able to follow through what she has promised... So, here we see a really faithful woman, the very same strong woman of Pr. 31:10-31!!! (may the good God grant to us a similar one!), and in the loving case of Ruth the Moabite, in the end got the best of the best in every aspect, even to be the ancestor of Jesus the Christ!!!:
Updated Aug 9, 2019, 8:44 AM
You tagged Pedro Mariscal
También, en este mes de agosto, "La Gaceta Jimeniana" (antes "La Gaceta Literaria"), ha sacado la evaluación crítica a mi "Arreolanza" de Carlos Axel Flores Valdovinos, la cual completa a aquella realizada por Pedro Mariscal, y publicada en junio en la "Cruz del Sur", ambos periódicos dirigidos por Héctor Ag, quien nos dice esto en su Editorial actual, con la que estamos totalmente de acuerdo: "Que Jesucristo, como primogénito de toda creatura, nos siga ayudando a seguir esforzándonos como lo hemos hecho durante estos últimos años con este trabajo cultural. Seguiremos llevando adelante nuestro compromiso de Evangelizar la Cultura, para continuar anunciando la buena nueva a todas las gentes de noble voluntad. ¡Que así sea!"; al final del presente artículo se observan fragmentos de los comentarios, a mi obra honrando la memoria educativa de Juan José Arreola, por parte de Orso Arreola Sanchez, Virginia Arreola Zúñiga (autora del prefacio a mi libro), y de Cayetano Chavez Villalvazo. Para ver esto mismo en sus diferentes componentes, ir a: https://fdocc2.wordpress.com/2019/08/08/la-gaceta-jimeniana-y-cruz-del-sur-de-zapotlan-el-grande-publican-evaluaciones-de-arreolanza/, que en formato electrónico se puede ver en: https://fdocc2.wordpress.com/2018/11/30/comentarios-a-mi-libro-arreolanza-el-dia-de-su-presentacion-por-pedro-mariscal-y-axel-flores/ y https://fdocc2.wordpress.com/2018/12/12/dos-periodicos-del-sur-de-jalisco-narran-nuestra-arreolanza-del-27-de-nov-2018-en-la-cabana-de-arreola/, y otras notas relacionadas al evento mismo se encuentran en: https://fdocc2.wordpress.com/2018/12/12/dos-periodicos-del-sur-de-jalisco-narran-nuestra-arreolanza-del-27-de-nov-2018-en-la-cabana-de-arreola/, referentes al libro impreso: https://www.amazon.com/gp/product/172000000X y a su formato electrónico para Kindle: https://www.amazon.com/gp/product/B07H15V6Q2, que fuera presentado en la Casa Taller Literario Juan José Arreola a finales de noviembre del 2018:
So, I am happy that my most recent research article on the wonders of the Genetic Code created by God: https://web.archive.org/web/20190817211325/https://biomedres.us/pdfs/BJSTR.MS.ID.003413.pdf and its updated Appendixes: https://web.archive.org/web/20190806211133/https://fdocc.yolasite.com/resources/fdocc-appendixes-2019.pdf; present with a brief review also in HTML at: https://tinyurl.com/fdocc3413, has finally being published! (Here the link for the whole volume that includes my article: https://web.archive.org/web/20190817211219/https://biomedres.us/volume20-issue2.php), this is what I say in the Acknowledgments about Him and Him first (I was even allowed to put my strong criticism to the bullies in science, which can be seen before of my thanking GOD first in the Acknowledgments: thank you Jesus too!!!):
Fernando Castro-Chavez shared a memory.
Julio del 2019 dicen que fue el mes más caliente del año, y de la vida contemporánea cronometrada hasta hoy (y desde luego, fue el tiempo en el que conmemoramos, a sombrero quitado y con la diestra en el pecho, el alunizaje del ser humano ("Un pequeño paso para el hombre, un gran salto para la humanidad", de Armstrong), con el Apolo 12, y yo conmemoré lo que sucedió siete meses antes: https://youtu.be/PmzKVLTCXBQ: La lectura del Génesis desde la órbita de la luna por los astronautas del Apolo 8: Anders, Lovell y Borman; el nexo aquí es de mi segundo intento por honrar a ese momento tan trascendental para el bien humano, y a los músicos que se inspiraron en él, en este caso a una dama Jessica Locke con "Genesis", y un varón, Mike Oldfield con dos: "In the Beginning" y "Let there be Light", ¡espero les guste como a mí me gusta!; otra gran novedad que me emociona es que fue precisamente el 31 de Julio cuando me dijeron de la aceptación final de mi artículo científico más reciente sobre el Código Genético, del que aquí anexo sus Apéndices (no incluidos en el mismo como política de la editorial que me publica): https://tinyurl.com/fdocc-appendixes-2019 (y aquí actualizo mi artículo completo!!!: https://biomedres.us/special-issue-5/pdfs/BJSTR.MS.ID.003413.pd); me emociona haber puesto en esos apéndices, para consignarlos en algún lado, y en este caso en una revista internacional científica, mis hallazgos de los 20 cambios a "La feria" de mi querido profesor Juan José Arreola!!!); en mi caso, durante este mes, yo ardía en el fuego del calor al haber conocido en persona y tratado solamente durante unas nueve horas a... (oh, my God, she is standing for me on that waiting during two years... and I say: But of course that I still long for her, like the desert that is asking for the waters, for his waters!!!), y a sus tres amigas (¡y los cinco ardiendo en un sólo cuarto...!), a partir de la una y media AM del 6 de Julio, cuando llegué al lugar, antes de que ella me dijera que si yo la amaba realmente, que debía de estar dispuesto a esperarla durante dos años, por allá por Manila, y entonces dije que no (claro, si ambos seguimos libres para ese entonces y aún lo queremos, pues sí...; oh Dios mío, sigo sintiendo algo importante por ella...), y esos fueron todos mis calores... ¿o no?...; ¡Ah!, y me olvidaba, también caminé: Caminé, caminé y caminé por todo aquello de Manila de día y de noche, como para alejar de mi a la nostalgia, hasta que mis ropas terminaban totalmente húmedas con la temperatura húmeda y cálida de por allá...; me dice mi amiga @[1339687409:2048:Victoria Shaykhislamova] (a quien saludo desde aquí, con quien fuimos al volcán Taal (por Cuaal), Frank y yo, y a quien acompañábamos al otro hotel para ducharnos, y esperar a que saliera, ¡cuando no había agua en nuestro propio hostel Tambayán (lo que a diario ocurría al atardecer)!), viviendo ella en la república Checa, que las lluvias fuertes comenzaron por allá por la ribera de Manila (Manila Bay), en donde nos encontrábamos, justo cuando me vine (for her, greetings, volcano, showers, and all it means: My friend Victoria told me that the strong rains, at least one strong rain, started just the same day that I left Manila). Ah, y también la que me debía me pagó (https://www.facebook.com/profile.php?id=100007200436234); y tuve el gusto de conocer a otra amiga: Bidz Lagua, y también de pasar un par de gratos días con ella, pero fuera de eso, esos fueron todos mis calores del mes más caliente que jamás haya existido, ¿o no...? (Sobre todo en la Europa que no visité... Pero, de las otras que titubearon para conocerme, o que no me reconectaron, o que ni caso me hicieron cuando yo anduve por allá, o de la que se avergonzaba de mi edad en presencia de sus amigas y familiares..., ¡ya ni hablar! De allí en más, no esposa ni novia todavía, pero Dios permita que la nueva sangre que estoy conociendo resulte mucho mejor que todo aquello nacido por alla (digo, lo que yo pude conocer hasta aquel entonces en persona...), ¡por favor, oh Dios!). |
Fernando's July Moments
Julio del 2019 dicen que fue el mes más caliente del año, y de la vida contemporánea cronometrada hasta hoy (y desde luego, fue el tiempo en el que conmemoramos, a sombrero quitado y con la diestra en el pecho, el alunizaje del ser humano ("Un pequeño paso para el hombre, un gran salto para la humanidad", de Armstrong), con el Apolo 12, y yo conmemoré lo que sucedió siete meses antes: https://youtu.be/PmzKVLTCXBQ: La lectura del Génesis desde la órbita de la luna por los astronautas del Apolo 8: Anders, Lovell y Borman; el nexo aquí es de mi segundo intento por honrar a ese momento tan trascendental para el bien humano, y a los músicos que se inspiraron en él, en este caso a una dama Jessica Locke con "Genesis", y un varón, Mike Oldfield con dos: "In the Beginning" y "Let there be Light", ¡espero les guste como a mí me gusta!; otra gran novedad que me emociona es que fue precisamente el 31 de Julio cuando me dijeron de la aceptación final de mi artículo científico más reciente sobre el Código Genético, del que aquí anexo sus Apéndices (no incluidos en el mismo como política de la editorial que me publica): https://tinyurl.com/fdocc-appendixes-2019 (y aquí actualizo mi artículo completo!!!: https://biomedres.us/special-issue-5/pdfs/BJSTR.MS.ID.003413.pd); me emociona haber puesto en esos apéndices, para consignarlos en algún lado, y en este caso en una revista internacional científica, mis hallazgos de los 20 cambios a "La feria" de mi querido profesor Juan José Arreola!!!); en mi caso, durante este mes, yo ardía en el fuego del calor al haber conocido en persona y tratado solamente durante unas nueve horas a... (oh, my God, she is standing for me on that waiting during two years... and I say: But of course that I still long for her, like the desert that is asking for the waters, for his waters!!!), y a sus tres amigas (¡y los cinco ardiendo en un sólo cuarto...!), a partir de la una y media AM del 6 de Julio, cuando llegué al lugar, antes de que ella me dijera que si yo la amaba realmente, que debía de estar dispuesto a esperarla durante dos años, por allá por Manila, y entonces dije que no (claro, si ambos seguimos libres para ese entonces y aún lo queremos, pues sí...; oh Dios mío, sigo sintiendo algo importante por ella...), y esos fueron todos mis calores... ¿o no?...; ¡Ah!, y me olvidaba, también caminé: Caminé, caminé y caminé por todo aquello de Manila de día y de noche, como para alejar de mi a la nostalgia, hasta que mis ropas terminaban totalmente húmedas con la temperatura húmeda y cálida de por allá...; me dice mi amiga Victoria Shaykhislamova (a quien saludo desde aquí, con quien fuimos al volcán Taal (por Cuaal), Frank y yo, y a quien acompañábamos al otro hotel para ducharnos, y esperar a que saliera, ¡cuando no había agua en nuestro propio hostel Tambayán (lo que a diario ocurría al atardecer)!), viviendo ella en la república Checa, que las lluvias fuertes comenzaron por allá por la ribera de Manila (Manila Bay), en donde nos encontrábamos, justo cuando me vine (for her, greetings, volcano, showers, and all it means: My friend Victoria told me that the strong rains, at least one strong rain, started just the same day that I left Manila). Ah, y también la que me debía me pagó (https://www.facebook.com/profile.php?id=100007200436234); y tuve el gusto de conocer a otra amiga: Bidz Lagua, y también de pasar un par de gratos días con ella, pero fuera de eso, esos fueron todos mis calores del mes más caliente que jamás haya existido, ¿o no...? (Sobre todo en la Europa que no visité... Pero, de las otras que titubearon para conocerme, o que no me reconectaron, o que ni caso me hicieron cuando yo anduve por allá, o de la que se avergonzaba de mi edad en presencia de sus amigas y familiares..., ¡ya ni hablar! De allí en más, no esposa ni novia todavía, pero Dios permita que la nueva sangre que estoy conociendo resulte mucho mejor que todo aquello nacido por alla (digo, lo que yo pude conocer hasta aquel entonces en persona...), ¡por favor, oh Dios!).
You tagged Betty Trigo
Dios bendiga a la gran mujer de Dios Betty!!!, felicidades hoy y siempre!!! De @[100001280559168:2048:Fernando Castro-Chavez] |
Dios bendiga a la gran mujer de Dios Betty!!!, felicidades hoy y siempre!!! De Fernando Castro-Chavez
Revisiting the places of the book of Acts, here we have the Great Theater at Ephesus (capable to seat 50,000 persons!), where the silversmith Demetrius did his massive riot against Paul and his friends (Acts 19:23-41) because of their teaching that idols (such as Artemis = Diana) were not real "gods", but that there is only one God to pray to, and only one Lord to call upon to!!!; we also see the road called the "Arcadian Way", leading to that theater, where the rioter had a chance to gather as much gullible people as possible to be then shouting for hours their foolish litany (and most of them, says the Scripture, had no idea about the reason for such fuss...); noticeably, quoting Paul, Demetrius said the truth: "they are not gods which are made with hands"!!!, and his lips even "prophesied" what indeed happened afterwards: "the temple of the great goddess Diana may be despised and her magnificence destroyed"!!! (Acts 19:26-27). Indeed, that certainly happened (and it will happen again and again and again with every single religious image, no matter the name or the "denomination", every icon that is not God itself for our Adoration and our Prayers, will fall into the ground, being transformed into absolutely nothing!!!, as it indeed is since right now, because as Isaiah said: 'Those wretched objects have ears but can not hear, and have mouths but can not speak...')":
Fernando Castro-Chavez updated his status.
Fernando's most loved photo on Facebook of 2017
Remembering, that the most important thing to me is the Bible, the source of every single piece of joy available in my being, of my salvation through the living brother Jesus Christ, of all of my hopes and promises to me by God, of my staying busy all the remaining days of my life, and of more thousands of things (people comes and goes, but the ever present in my heart revelations of God: Remain Forever)!!!:
Fernando Castro-Chavez posted in All Us Single Ladies🙊.
Glorilyn Guisongan, thank you for accepting me, I am seeking for the suitable woman & wife for me: Is she here? Let me introduce myself: Fernando, fifty three, Latino, American and Mexican Citizen, Postdoctoral PhD from Baylor (BCM), Houston, a firm Christian, with the strong belief in the mutual success of the couple; willing to establish a numerous family, open to move, with no children yet; so: Who wants to be my girlfriend with the purpose to be my wife?
Fernando Castro-Chavez wrote on Carlos Axel Flores Valdovinos's timeline.
Arte y Cabeza se Funden en una Guitarra: ¡Axel! Felicidades
Fernando Castro-Chavez shared a memory.
3 Years Ago
Fernando Castro-Chavez updated his cover photo.
Aug 1, 2018, 7:41 AM
Pr. 19:14b: ¡Esta es la HERENCIA de Dios para mí!: "Una esposa prudente es la que procede del Dios Fiel": Esta gran verdad sigue siendo cierta, lo mismo ayer, ahora, y mañana (independientemente de todo...) = This is the INHERITANCE of God for me!: "A prudent wife is coming from the Faithful God": This great truth continues being for real, the same yesterday, today, and tomorrow (no matter what...):
Updated Aug 1, 2019, 9:21 AM
Fernando Castro-Chavez added an item to the featured collection: Historia destacada.
Jul 27, 2019, 10:30 AM
Fernando Castro-Chavez added an item to the featured collection: Historia destacada.
Jul 27, 2019, 10:30 AM
Fernando Castro-Chavez added an item to the featured collection: Historia destacada.
Jul 27, 2019, 10:30 AM
Fernando Castro-Chavez created the featured collection: Historia destacada.
Jul 27, 2019, 10:30 AM
Fernando Castro-Chavez added an item to the featured collection: Historia destacada.
Jul 27, 2019, 10:30 AM
Fernando Castro-Chavez created the featured collection: Historia destacada.
Jul 27, 2019, 10:30 AM
Fernando Castro-Chavez posted in separados y divorciados.
Fernando Castro-Chavez wrote on a timeline.
Jul 25, 2019, 10:12 AM
Otro gran descubrimiento arqueológico en Delphi es la inscripción de Galión, el procónsul de Acaya nombrado en Hch. 18:12 (que duró 2.5 meses en su cargo, recibiéndolo el 1ero de julio del año 51 D.C.), hermano de Séneca (ambos distinguidos españoles sirviendo a Roma), el famoso filósofo estoico y tutor de Nerón, quien se refirió a Galión en los términos de: "Ningún mortal es tan agradable a cualquier persona como lo es Galión para todos" (Naturales Quaestiones 4a, Prefacio 11); otro escritor también habló del gran ingenio de Galión (Dio Cassius, History of Rome 61.35), reflejado en dicha escritura de Hch. 18:12-16; algunos sitios que hablan de este hallazgo monumental son: https://en.wikipedia.org/wiki/Delphi_Inscription, https://www.kairos2.com/BL_Gallio.htm y https://www.bibleplaces.com/acts18/, entre otros...
As per my research on Acts 17:18, with obvious exceptions: The Stoics, such as Zeno and Henley versus Epicureans, such as Swinburne and Epicurus, are still represented today and yesterday by Republicans and Pharisees versus Democrats and Sadducees; the Stoics are the conservative and suffering ones who think that their self-sacrifice will make them better, while the Epicureans are the liberal ones who think that as long as you are happy, you can have as many pleasures as you like with no restraint! So, the two opposite views are still today represented in the good planet earth, and for both of them, as Paul in Athens, Jesus himself offered salvation if they just consider him as their real Messiah and Savior!!! Another point of vital importance in my current biblical studies, consists in seeing the multiform wisdom of God on revealing to Paul different formulas of salvation according to the crew listening to his message, something that is raising the eyebrows, but that is real in the heart of God, here the way that he was inspired to present the Gospel was to tell these two groups that Jesus is the living judge! In Acts 17:31 we read: "He (God) has appointed a day on which He will judge the world in righteousness by the Man (Jesus) whom He has ordained. He has given assurance of this to all by raising Him from the dead"!!!
Fernando Castro-Chavez shared a memory.
3 Years Ago
Jul 22, 2018, 10:25 AM
Mi incansable paisano Héctor Ag me ha pedido escribir una cuartilla sobre algo curioso e inédito que yo recuerde de Arreola, para uno de sus múltiples periódicos; esto es algo que viví con mi próspero y trabajador primo Vicente Castro en Zapotlán cuando éramos niños, hoy él viviendo también en el norte, cómo yo, a ver qué les parece (también se lo paso a Orso Arreola Sanchez, a ver cuando me deja ir a tomarme algunas fotos al lugar en donde conserva algunas de éstas históricas sillas de metal que aquí menciono, Jejee; en las fotos, de esos "parecitos" que agrupa "Google Photos" como si fueran familia, hijo y padre, o algo así, y luego con mi primo Vicente, y con mi ex-esposa Tracy... Acompañada de una buena canción juvenil: https://www.youtube.com/watch?v=9AEoUa0Hlso y de la misma talentosa, una más grave: https://www.youtube.com/watch?v=FGT0A2Hz-uk):
"De cuando subí con mi primo al mirador de Arreola
Por Fernando Castro-Chavez
22 de Julio del 2018, Zapotlán el Grande, Jalisco, MX
Era una mañana sabatina con un sol radiante.
Acabábamos de llegar de Guadalajara a la casa de Mireya Cabeza de Vaca.
El imitador enjaulado hablaba con la misma voz del fallecido padre de la pianista, diciendo: “Señora”.
Mi primo y su hermana se encontraban entonces en visita con ellas, madre e hija.
Salimos corriendo al escuchar una moto que pasaba.
Gritamos: - ¡Maestro, maestro!
Entonces, se detuvo brevemente y nos dijo: - Voy de prisa pero los espero en mi casa en media hora.
Se siguió derecho, pero nosotros de todos modos nos encaminamos a esperarlo a su casa de altura.
Del puro gusto de que nos recibiría corríamos sin importarnos el tiempo y ya llegábamos al empedrado.
Al poco rato llegó él, traía su capa negra, amablemente nos pasó y nos sentó frente al pueblo, y se fue...
Después de un buen rato, regresó con una bebida rosada y con un par de vasos con agua en una charola.
Luego, se envolvió con su capa negra que le quedó por detrás del respaldo, todo parecía como un sueño.
Nosotros estábamos boquiabiertos, así se nos figuraba como un gran cuervo o aún como un murciélago.
Inclinado él mirando hacia el suelo, observábamos su grata boina de la cual brotaba su blanco cauce.
Dijo estar deprimido…; le presenté a mi primo, él le preguntó que de dónde era: - ¡de la sierra!, escuchó.
Mientras apuraba su copa le preguntó su nombre, mi primo sorprendido respondió: - ¡Atemajac!
Arreola se sonrió con gusto, y luego con voz reposada le dijo que se refería a su nombre personal.
- ¡Vicente! - Respondió mi primo, y dijo: - ¡mi papá, que en paz descanse, fue su presidente municipal!
Arreola se sonrió de nuevo, mientras le daba otro sorbo a su bebida, resultó que él lo había conocido.
Después de unos intercambios divertidos y espontáneos, Arreola salió contento golpeteando la charola.
Nosotros, exploramos un poco el lugar y miramos desde allá al pueblo y sus volcanes, y decidimos salir…
Sobre la mesa y sus sillas de metal que usamos, posaba una copa vacía con dos vasos llenos de agua."
Recuerdos de una vida bien vivida, que apenas comienza a vivir:
Updated Jul 22, 2019, 7:16 AM
Today that we celebrate the 50th Anniversary of the Landing on the Moon by Neil Armstrong, from the Apollo XI, first I wish to share, in the words of William Anders, the one that took the most famous photo of the good earth rising, from the Apollo VIII, and the reading, decided by a friend of Frank Borman, to read the first verses of Genesis One, in the voice of the three astronauts, including Jim Lovell on the Christmas of the 24th of December of 1968, the best moment thus far, with the highest audience of the world for that time (and maybe for all times still (remembering that the radio did broadcast it, and it was even more popular then than the TV), thus far; also I want to put the amazing inspiration that it was for the music of Mike Oldfield ("Viejo Terreno" (but it sounds better "Campoviejo"), in Spanish): https://www.youtube.com/watch?v=1JusNN5gv9c): |
Today that we celebrate the 50th Anniversary of the Landing on the Moon by Neil Armstrong, from the Apollo XI, first I wish to share, in the words of William Anders, the one that took the most famous photo of the good earth rising, from the Apollo VIII, and the reading, decided by a friend of Frank Borman, to read the first verses of Genesis One, in the voice of the three astronauts, including Jim Lovell on the Christmas of the 24th of December of 1968, the best moment thus far, with the highest audience of the world for that time (and maybe for all times still (remembering that the radio did broadcast it, and it was even more popular then than the TV), thus far; also I want to put the amazing inspiration that it was for the music of Mike Oldfield ("Viejo Terreno" (but it sounds better "Campoviejo"), in Spanish): https://www.youtube.com/watch?v=1JusNN5gv9c):
Estudiando ahora lo que dice Hch. 19:18-19: “Muchos de los que creyeron seguían llegando... de los habiendo practicado la magia trajeron los libros y los quemaron... su valor... era de cincuenta mil piezas de plata”, Schoenheit (en el comentario a su REV del NT) señala que se trataba del Tetradracma Ático (proveniente de Atenas, con el perfil de ella de un lado y un búho del otro, que se siguiera estampando durante cientos de años, con ligeras variantes), en ese entonces, una moneda de esas era el valor de un día de trabajo para un soldado o un obrero, su equivalente actual sería, al salario mínimo de los EE.UU.: $ 7.25 por hora x 8: $ 58.00 al día por 50K = ¡2.9 millones de dólares! (Esto lo ilustro con variantes que se acuñaron durante un periodo de unos quinientos años: ¡estuvo en plena circulación del 510 A.C. al 38 D.C. (tiempo este último en el que Pablo andaba predicando en Éfeso!!!: https://en.wikipedia.org/wiki/Tetradrachm; ver también (por el asunto de su uso como salario de un día): https://en.wikipedia.org/wiki/Attic_talent)!):
Fernando Castro-Chavez wrote on Aida de la Torre's timeline.
Happy Birthday! Now and always the best in your life!
Fernando Castro-Chavez wrote on a timeline.
Jul 19, 2019, 8:13 AM
Arte de la China Milenaria!: La cultura Cantonesa de Guangzhou: Esto complementa al mensaje que puse desde la misma China represiva usando un VPN (el CyberGhost, desde su Aeropuerto de 5 estrellas): https://www.facebook.com/fernando.castrochavez.90/posts/2583585851694075, así como al promocional de esta exposición que puse con posterioridad: https://www.facebook.com/fernando.castrochavez.90/posts/2588184794567514; aquí se observa a uno de sus artesanos en plena labor, y la belleza de su jade labrado y de su afamada porcelana, entre muchas otras cosas bellas (pinturas, ropas, labrados, maderas, etc., etc.):
Fernando Castro-Chavez shared a memory.
5 Years Ago
Jul 18, 2016, 5:17 PM
Y aquí estamos, Estéfano y yo, a la entrada de la Biblioteca del Centro Universitario (C. U.) de la Universidad Autónoma de Guadalajara (U.A.G.), donde se encuentra una pareja de Mamuts excavados en Jalisco. Platicábamos el fin de semana, de cómo la segunda glaciación, que fue parcial, en tiempos del diluvio de Noé, arrasó con los grandes mamíferos de todo el mundo; para ver mi estudio Bíblico acerca de esto, favor de dirigirse a, "Las Aguas Arriba ' 2": https://youtu.be/VMzndWIMLD8
Recuerdos de mamuts, desaparecidos en el diluvio, los cuales no entraron en el arca, como sí lo hicieron los elefantes que aún tenemos, diseñados por Dios; mi parecer como creyente y como científico es que estos mamuts no pertenecían al diseño original del Creador, ya que la Biblia nos dice que toda carne había ya corrompido sus caminos, no sólo la humana con los monstruosos Neandertales y otras aberraciones, sino todos esos mamíferos que en ese entonces ya alcanzaban proporciones antinaturales:
Updated Jul 18, 2019, 8:59 PM
Regresando a mi estudio bíblico frente al Nevado, en donde soy más feliz que en ningún otro lado (aún más que si tuviera mujer e hijos, aunque los quisiera tener, pero bueno:), tenemos esto de Hch. 20:28: A la izquierda el error en rojo de la traducción de 1569 de la Biblia del Oso de Casiodoro de Reina, luego abajo el error en la de KJV (aún cuando mi admirada Hannah enfatiza esta versión como la mejor, pero no hay como el texto original), y luego el comentario erróneo en "The Companion Bible" de E.W.B.; a la derecha tenemos lo correcto en azul, en la versión corregida Reina Valera, por ejemplo la de 1960 y en un texto de Patmos del S. IX D. C., base de una tesis, que contiene lo correcto: http://images.csntm.org/Manuscripts/GA_2464/Codex2464-BackgroundCollationandTextualAnalysis.pdf, donde lo correcto es "Señor" referente a Jesús, y no "Dios", ya que a continuación se refiere a su sangre derramada, la cual fue la de Jesús!!! Belleza de bellezas el ver a la Escritura antigua embonando con los detalles más pequeños de su integridad!!!:
More random photos that I took from the Guangzhou five-star Airport in Canton, China, starting with the Chinese Dragons for my friend Cesar Cosio, and then with a meal of fully roasted ducks for my chief expert brother and friend from Houston Jeremiah Oliver, and then with the fancy of "Pitera", heard by me here for the first time, sounding to me like a Mexican joke, or even better, like an SNL Brit-Asian version of a comedy show, being SNL a show that every Saturday Night my ex-wife Tracy and I used to watch on TV: "La publicidad acerca de este producto es pura pero pura "Pitera", diría yo..." ("Pitera", nombre desafortunado para el mundo hispano, jejee): https://www.youtube.com/results?search_query=P%26G+SK-II+Pitera+Comedy & Song: https://www.youtube.com/watch?v=EMgNdh4bz1E; they even have in this Airport, a special space for the little ones to play!!!
More shots from my goings into China from the Philippines, I was the only foreigner within a plane filled with Chinese people, some of them laughed at it, as well as at my flight schedule that I have drown by hand as I had just got it; then, the scheduled departures from the Manila Ninoy Airport can be seen, as well as a set of Muslims sitting at the floor awaiting for their trip to Abu Dhabi:
Aquí es cuando nuestro estimado @[1028804856:2048:Cesar Cosio] menciona que ha sido DJ para Manny Pacquiao (aquí el video en MSN, en caso de que falle el otro: https://www.msn.com/es-mx/video/soccer/el-asalto-a-la-razón-viernes-musical-presenta-a-césar-cosío-curador-musical-parte-iii/vp-AADUVRU, activar allí el audio), a quien conoció gracias a Marco Antonio Barrera, lo mismo que a Don King; tocó hasta en Siberia (Krasnoyarsk, en donde se congregó lo mejor de la música de Asia), y para Ricardo Salinas Pliego, Gloria Trevi, Emilio Azcárraga, etc. Señala que él toca la música que a su festejado e invitados les gusta, en vez de aquella que él quisiera tocar que a él le gusta, poniendo primero el gusto de los demás al de sí mismo; habla también de su amistad con su vecino de Ciudad del Sol: Guillermo del Toro, director cinematográfico multi-laureado de padres Zapotlenses, y que fue precisamente en la casa de éste en la que celebró su primera experiencia de DJ a sus catorce años, y desde entonces sin parar, durante 41 años, habiendo entrado al "Hall of Fame of the American DJs", con sus huellas en Anaheim, CA, y también al Salón de la fama de los DJ Mexicanos, en Puebla, entre muchas anécdotas más brillantes, con otras curiosas... Y acompañando a esto, sus recomendaciones del Rock Sinfónico en Español, buscando siempre la calidad musical: https://www.youtube.com/watch?v=QVlx153KgQo
Updated Jul 16, 2019, 2:44 PM
So, the Airport of Guangzhou is considered a five star one, specially because of its exquisite museum with the arts and crafts of the region: Cantonese and elementary for all of it that the Chinese culture is, as it originated there its works in porcelain, the paintings of the face and body typically Chinese, the clothing and costumes (including those long dragon ones were several people fits inside), the paintings with written and soothing messages in Chinese, the bronze, the fine carving over jade, ivory, etc., etc., the cake industry and its shapes, etc. (so, as I am able, I will be posting the additional pictures I took of such peculiar art):
Fernando Castro-Chavez shared a memory.
Aún buscando compañera (Still searching for companion): Esperaba yo aquí mi salida a México desde Vancouver, Canadá, por la línea China Southern Airlines:
Fotos que tomé cuando iba en taxi al programa televisivo de Raffy Tulfo en TV5 de Filipinas (se ineresó en exponer mi caso pero le pedí esperar, y no me arrepiento porque la dama fue lo suficientemente honesta en responder por sí misma sin un escándalo televisivo al estilo de "Cristina"), y sí, hablamos bastante de Dios con el taxista en inglés, que es el idioma que la mayoría de la nueva generación sabe hablar:
Este Fer ya va de regreso a México, regresa sin chica pero contento y en paz por haber hecho las paces con la primera, la que le devolvió lo que el le había mandado antes; aquí es la sala de espera, Terminal 1, del Aeropuerto de Manila. (Añadido: Iti: Esperando aquí hasta las 4:45 AM, y de aquí a Guangzhou, Canón, China; y de allí, después de seis horitas de espera, hasta Vancouver, Canadá, y luego de allí a la Capital de MX, y luego a Guanatos, llegando a las once de la noche de mañana, por lo que me quedo a dormir, o a despertar, en ese aeropuerto al estilo del Tom Hanks mexicano, antes de regresarme a nuestro Zapotlán bendito!)
This is the show of the fountains at the Rizal Park in Manila (in the background, heaven added its own special effects!): |
This is the show of the fountains at the Rizal Park in Manila (in the background, heaven added its own special effects!):
6) Part six of a concert that continued at that big food market of the Makati Av. (and of course, my little friends from the Philippines continued around, and they even were singing in Filipino the song that the Filipino woman was singing at the stage, as this band was open to the participation of the public), we left them still at it to go to the bar "Z", at the top of one condominium that can be seen elsewhere, nearby this wealthy area at the center of Manila: |
6) Part six of a concert that continued at that big food market of the Makati Av. (and of course, my little friends from the Philippines continued around, and they even were singing in Filipino the song that the Filipino woman was singing at the stage, as this band was open to the participation of the public), we left them still at it to go to the bar "Z", at the top of one condominium that can be seen elsewhere, nearby this wealthy area at the center of Manila:
5) Part five of such concert at such big food market in the Makati Av., near the Malls called "Glorietas"; as just before, we went to the one with the number five, to visit the branch of the C.F.F. that is located there, close to this place of meal and rock!: |
5) Part five of such concert at such big food market in the Makati Av., near the Malls called "Glorietas"; as just before, we went to the one with the number five, to visit the branch of the C.F.F. that is located there, close to this place of meal and rock!:
3) Part three of that concert at that big food market, Makati Av., as far as I remember, they also did the singing in Chinese, in Korean and, of course, in Filipino, apart of English!!!: |
3) Part three of that concert at that big food market, Makati Av., as far as I remember, they also did the singing in Chinese, in Korean and, of course, in Filipino, apart of English!!!:
2) This is my part two of that concert at the big food market, Makati St. (the man at the side playing the guitar is an Ukranian married to a woman from the Philippines): |
2) This is my part two of that concert at the big food market, Makati St. (the man at the side playing the guitar is an Ukranian married to a woman from the Philippines):
1) This is at the beginning of the concert in the food market at Makati: |
1) This is at the beginning of the concert in the food market at Makati:
4) This is when I requested the musicians from the Philippines to play "Smooth", by the Mexican Santana: |
4) This is when I requested the musicians from the Philippines to play "Smooth", by the Mexican Santana:
Telling my little friends from the Philippines to put God first (such as the little ones that I want to have!!!), and to be kind to each other while a rock concert was going on (I just had the iPad by the side as I was facing them face to face): |
Telling my little friends from the Philippines to put God first (such as the little ones that I want to have!!!), and to be kind to each other while a rock concert was going on (I just had the iPad by the side as I was facing them face to face):
A panoramic view from the top of "Z", place where I was with a very valuable person who is living at Makati: |
A panoramic view from the top of "Z", place where I was with a very valuable person who is living at Makati:
Visiting volcanoes with persons from Singapore, MX, Russia, Holland, and Philippines; below, going out of TV5, with April...
One of the amazing effects that I liked from the architecture at Makati; Waters!!! |
One of the amazing effects that I liked from the architecture at Makati; Waters!!!
But the best moment thus far has been when we were at the C.C.F. up in the uptown of Glorieta Number Five, where I talked with Ivan and Leslie that as per my most recent biblical research, Rom. 10:9 is an invocation! Fully in line with Rom. 10:13: Every one calling upon the name of the Lord: "Lord Jesus!" shall be saved!!! And this is the true meaning in the Greek of these verses, so salvation is to talk to Jesus because he is alive!!! This is the salvation!!!, on the other hand, to make him Lord (as all of the versions twist this verse): that then will be works!!!, and doing that is for our recompenses but NOT for our salvation by grace!!!; so, as it is commonly translated, that is not what Rom. 10:9 says in the original Greek, it says nothing about making him Lord as a condition to be saved at all (because again, that will be a legalism by works, towards our obeying him)!!! THIS FOR ME IS AMAZING!!! And this just shows how much the adversary has blurred and blinded the understanding even of our most basic verse of salvation!!!
My dear brother in Christ Jeremiah Oliver, as a great chief himself, asked me to pay attention to the foods, these are the ones available at a food market, where there is live music daily on the night, we requested a squid, that right there they prepared for us, with coconut water flavored with mint:
I have walked thus far to find those secret places, those details unable to see in a car, such as the ancient writing of the "Ang Alibata", the Tagalog, language from Babylon (that is why the person who was with me, thought it was from the Middle East!!!), with its respective drawings as seen in that long street that starts in the Pasig Lane originated in Pedro Gil:
This is me before my flight (and I was so excited for it that I was sleeping just for some hours a day since admire than a couple of weeks ago, reason of the darkness around my eye; if it appears backwards in your tablet or phone, the one little video that just shows my dancing eyes just moving is the one "before", and the other with that line down below the eye is the "after" one); and then, below, after some almost 30 hours of an almost too straight time with no sleep (waiting at the Hong Kong waiting room), I was going there, willing if God was willing, to met my destiny from, or in, whatever being the best, the Philippines!!!
In this bar, we even have the security guard as one of the musicians greeting the newcomers with his green guitar, and below is the blend of music in Philippine and in English that's played on it:
At the gigantic airport of Hong Kong, were my final "waiting room" for my departure to Manila had the number 509, and it was needed to be taken by a bus to lead us to such terminal
The most common transportation here are these really "mini" buses that are very abundant (notice the height of the cyclist in comparison to the rooftop of these short buses, with multiple colonies that I visited today by feet, packed with them, parked in long lines, many of them I saw that were being washed, another transportation is that of the, also smaller "uber" motors, invented by the Philippine people many years ago, with another variant for the shorter distances being propelled by a cyclist, who makes the engine with his legs! (To this, Conchita Saramosing Heramis has added that she realizes, as a person from the Philippines, how real hard it is to do this cycling with loads of people in order to provide for their families).
Fernando Castro-Chavez updated his status.
Fernando's most commented photo on Facebook of 2015
Ante los reveses de la vida y de la gente, tenemos una firme esperanza que no se desvanece, parte de ella es que habrá nuevos cielos y nueva tierra!
Mi lectura del "Réquiem por la ciudad moderna", de Emma Godoy (disculpen que esta vez andaba muy cansado, y por instantes varias veces me dormí); rematada precisamente con "Sola", del gran Gerardo Ochoa Castro: https://youtu.be/5Kt9oydbt3E
Updated Jul 2, 2019, 5:32 PM
You tagged Gerardo Ochoa and Victor Velasco Neri
"Sola", del gran compositor e intérprete tapatío @[100003606788744:2048:Gerardo Ochoa] Castro, le acompaña @[1183464292:2048:Victor Velasco Neri] (que eran: "La Papa y el Cerillo", ya que al primero se le decía así con este último término, e "idem" para el segundo con el primer término!) |
"Sola", del gran compositor e intérprete tapatío Gerardo Ochoa Castro, le acompaña Victor Velasco Neri (que eran: "La Papa y el Cerillo", ya que al primero se le decía así con este último término, e "idem" para el segundo con el primer término!)
Aquí está mi lectura de hoy de "El Héroe", cuento de Emma Godoy inspirado en Jesús García, el héroe de Nacozari: https://youtu.be/tDSpfcxLfVo
Updated Jun 30, 2019, 12:09 PM
Aquí, leyendo yo el cuento de Emma Godoy titulado "Mi Criada Ladrona" y una Eulogía a ella por Michelena: https://youtu.be/-GX4fJIM9_s
Updated Jun 29, 2019, 3:48 PM
Recordando esos momentos bellos del pasado, para luego dejarlos atrás, y seguir entonces adelante, con aquella compañera tan anhelada, para aquella familia tan deseada, la cual se encuentra, por la pura gracia divina, ahora sí: ¡¡¡Al alcance de mi mano!!! ¡Gracias Señor Jesús, y gracias también a nuestro Padre Dios! (It says here: Remembering those beautiful moments of the past, so to leave them behind, and then move ahead, with such companion so longed for, in order to build that family so wished for, which is located, just by grace divine, now indeed: To the reach of my hand!!! Thank you Lord Jesus, and thank you too our Father God!) |
Recordando esos momentos bellos del pasado, para luego dejarlos atrás, y seguir entonces adelante, con aquella compañera tan anhelada, para aquella familia tan deseada, la cual se encuentra, por la pura gracia divina, ahora sí: ¡¡¡Al alcance de mi mano!!! ¡Gracias Señor Jesús, y gracias también a nuestro Padre Dios! (It says here: Remembering those beautiful moments of the past, so to leave them behind, and then move ahead, with such companion so longed for, in order to build that family so wished for, which is located, just by grace divine, now indeed: To the reach of my hand!!! Thank you Lord Jesus, and thank you too our Father God!)
Fernando Castro-Chavez wrote on Stefano Macedo Reyes's timeline.
Felicidades, un año más de servir de ejemplo a otros que, aunque te dimos clases, ahora queremos seguir tus pasos!!!
Del Templo de Artemisa (Diana) en Éfeso, una de las 7 Maravillas del Mundo Antiguo que se menciona en Hch. 19, sólo han quedado ruinas, o algunas de sus porciones en los museos; como también se profetiza, que sitios como esos serían convertidos en refugios de aves de rapiña (en la cima de la columna única que queda, se puede observar a un nido), y así sucederá con la adoración idolátrica de todas esas Artemisas del planeta en el futuro: https://turkisharchaeonews.net/object/temple-artemis-ephesus, https://www.ancient.eu/Temple_of_Artemis_at_Ephesus/, y con esto prosigo mis investigaciones bíblicas, ya que sí, soy muy enamorado de aquella que será la madre de mis hijos, pero más enamorado soy de Dios y de Sus maravillosas revelaciones:
Fernando Castro-Chavez shared a memory.
4 Years Ago
Jun 15, 2017, 7:01 PM
Aquí, con mi papá Manuel, y con mi mejor amigo del norte, y hermano cristiano en Cristo, Gabriel Oliver. Y, quiero yo felicitar a mi papá, y recordar su oración que dice antes de irse a dormir:
"Dios, gracias por darme un día más.
Gracias por mi vida y por mis seres queridos:
Por mi esposa, por mis hijos y nietos;
Ayúdalos a llevar a cabo
Los proyectos de su vida,
Para que te conozcan cada día más,
Por el amor que le tienes a tu hijo Jesucristo,"
Amén.
Dad, me, Gabe, San Antonio, TX.
Updated Jun 18, 2019, 7:44 AM
Fernando Castro-Chavez posted in Australian Overseas Lovers.
Jun 17, 2019, 5:43 PM
Fernando Castro-Chavez posted in Asian Ladies and Western Gentlemen looking for friendship, love & marriage.
Thank you for accepting my request to be part of it! My recent photo and comment: https://www.facebook.com/groups/1536543979799522/permalink/2217333448387235/ Wishing the best to the ladies of this site, that they may find their one as I wish to find my girl!!!
Fernando Castro-Chavez posted in LOVELY ASIAN WOMAN MEET FOREIGN MEN.
Saying hello to all the lovely young girls of this group, this is me in my most recent one, photo and message: https://www.facebook.com/groups/1536543979799522/permalink/2217333448387235/ for all of you, ladies!!!
Fernando Castro-Chavez posted in 🔥❤️ White and Black American European,Canada FILIPINA find new love❤🔥.
This was today my first post in a related place: https://www.facebook.com/groups/1536543979799522/permalink/2217333448387235/ Seeking for my real deal wife, as young as possible the best, to build a strong and big family together!!!
Fernando Castro-Chavez posted in THE FILIPINO & INTERNATIONAL CUPIDON WEB COMMUNITY💗💗.
Thank you for the approval, this is what I did put in a related group: https://www.facebook.com/groups/1536543979799522/permalink/2217333448387235/ My hugs and kisses to all the female members from America!
Fernando Castro-Chavez posted in International Asian Dating Sites 👑👑👑King @ Queen of Hearts👑👑👑🌐🌍🌐.
Jun 17, 2019, 10:20 AM
9 años han pasado desde que en una conferencia en el Baylor una pareja de expositores norteamericanos me recomendaran unirme a esta red de amigos, curioso es que inicialmente me dijeron que era una buena herramienta laboral... Laboro para Dios en este sitio, mostrando principalmente mis avances "investigativos" en la Biblia y en la Creación de Dios, a veces, y ocasionalmente cosillas personales o fotos, así pues, desde aquí les mando mis saludos a todos! De norte a sur, de este a oeste... |
Fernando joined Facebook 9 years ago
9 años han pasado desde que en una conferencia en el Baylor una pareja de expositores norteamericanos me recomendaran unirme a esta red de amigos, curioso es que inicialmente me dijeron que era una buena herramienta laboral... Laboro para Dios en este sitio, mostrando principalmente mis avances "investigativos" en la Biblia y en la Creación de Dios, a veces, y ocasionalmente cosillas personales o fotos, así pues, desde aquí les mando mis saludos a todos! De norte a sur, de este a oeste...
Celebrando a mis papás, y al papi, en el día del padre |
Fernando's most commented photo on Facebook of 2012
Celebrando a mis papás, y al papi, en el día del padre
"Them Old Cotton Fields Back Home" (Excerpts)
by Glen Riddle
"The toughest weeds to cut down were the tumbleweeds 3-4 feet in diameter, and the "careless weeds" which grew to six feet tall."
"...Right now I am in another country almost exactly halfway around the world from that little Texas hometown. Once again I am meeting with a group who have meetings in a building with a small walled courtyard containing a garden. At lunchtime on the first day, I was observing four of the biggest vegetable plants; you guessed it, they were careless weeds about seven feet tall. I asked the students what they did with them. They proudly showed me the big leaves they used for delicious greens on the dinner table.
I've had many thoughts about these two incidents. One is the saying, "One man's trash is another man's treasure." I've also thought about Christ's words, when He said where our treasure is, there is our heart also. It makes me ask, "What do I really value? Do I put too much value on weeds? Do I put too little value on some things that could have great use?..."
Taken from: http://media1.razorplanet.com/share/511568-2652/resources/807217_BEEInformed.pdf
The "Careless Weed" is also known in Mexico as the Amaranth, from which very small seeds, toasted (as you do with corn), one of the most delicious and nutritious meals are prepared, such as its crackers and bars!!! Happy Father's Day!!! Dreaming to be one myself very soon as per my Heavenly Dad's Will!:
by Glen Riddle
"The toughest weeds to cut down were the tumbleweeds 3-4 feet in diameter, and the "careless weeds" which grew to six feet tall."
"...Right now I am in another country almost exactly halfway around the world from that little Texas hometown. Once again I am meeting with a group who have meetings in a building with a small walled courtyard containing a garden. At lunchtime on the first day, I was observing four of the biggest vegetable plants; you guessed it, they were careless weeds about seven feet tall. I asked the students what they did with them. They proudly showed me the big leaves they used for delicious greens on the dinner table.
I've had many thoughts about these two incidents. One is the saying, "One man's trash is another man's treasure." I've also thought about Christ's words, when He said where our treasure is, there is our heart also. It makes me ask, "What do I really value? Do I put too much value on weeds? Do I put too little value on some things that could have great use?..."
Taken from: http://media1.razorplanet.com/share/511568-2652/resources/807217_BEEInformed.pdf
The "Careless Weed" is also known in Mexico as the Amaranth, from which very small seeds, toasted (as you do with corn), one of the most delicious and nutritious meals are prepared, such as its crackers and bars!!! Happy Father's Day!!! Dreaming to be one myself very soon as per my Heavenly Dad's Will!:
Lo curioso es que E. W. Büllinger (en su p. 1630: "Comp. Bibl."), a finales del S. XIX se sorprende de la existencia de una monedita en el Museo Británico mostrando en el reverso a Artemisa (que es Diana) de los Efesios en su templo, como evidencia histórica de lo que leemos en Hch. 19:23-41, cuando los plateros vieron su negocio a los idólatras mermado tras la predicación de Pablo; pero ahora, si ponemos en el buscador esas palabras: Artemis Diana Coin Temple Ephesus, cientos de esas monedas aparecen (aquí resumí 456 letras en solamente 32; y agrego una de esas monedas de los tiempos de Pablo, con Claudio al frente y esa O-"diosa" al reverso), https://tinyurl.com/artemiscoins
Estela Núñez es otra gran cantante, paisana mía, tapatía, nacida en Guadalajara, la que ya cantaba cuando yo apenas estaba naciendo, aquí mi más favorita de ella, una de sus más tempranas, breve y profunda (polémica pues se le atribuía a otra cantante hasta que todo se aclaró que ella era "la voz" tras bambalinas), a dueto con Enrique Guzmán: https://www.youtube.com/watch?v=4vx0wSWp6Ik
Updated Jun 13, 2019, 8:33 PM
Y, hace poco recordé con @[100009913777900:2048:Alicia Saldaña], hablando de esas cosas del corazón, a quien fuera mi primer cantante favorita a mis seis años de nacido, en su versión "Premium", según yo: https://www.youtube.com/watch?v=-ulAhmERPWE; luego en su versión "PrimaDonna" del 71: https://www.youtube.com/watch?v=3kfGyNd0xrI , y finalmente en su más reciente versión, la "Platinum", del 2018, con la bella de Dulce y con la fuerte de la Rocío Banquells: https://www.youtube.com/watch?v=bmU21t33jYs
Updated Jun 13, 2019, 12:38 PM
En Hch. 18:4 se menciona a una Sinagoga en Corinto, y la evidencia arqueológica era conocida desde los días de E. W. Büllinger, ya que él así nos lo dice, y que en el "Museo de Corinto" existe esa evidencia con una antiguedad de entre el 100 A.C. y el 200 D.C.:
Luego tenemos el texto griego original que Pablo memorizara y citara en Hch. 17:28: "De Él Ciertamente También Linaje Somos": "Tou Gar Kai Genos Esmen", tomado del "Phaenomena" astronómico en griego de su paisano Arato, que gracias al internet ahora todos podemos leer en su original (con esta frase siendo única de la hoja, en mayúsculas): https://ia800603.us.archive.org/18/items/phenomenadioseme00arat/phenomenadioseme00arat.pdf (en la página siete, abajo, Tufts también lo tiene a este texto, electrónico: https://web.archive.org/web/20180912103801/http://www.perseus.tufts.edu/hopper/text?doc=Perseus%3Atext%3A2008.01.0483):
Siguiendo mi estudio de Hechos, ya en el 17:23, nos encontramos con el discurso de Pablo en Atenas, Grecia, que incluye el pedestal al "Dios Desconocido", al "Agnosto Theo", teniendo en la historia rescatada semejantes estructuras, como la más famosa preservada y encontrada en Roma (en la colina Palatina en 1820), la que comienza diciendo en latín: "SEI•DEO•SEI•DEIVAE...", que es: “Ya sea a Dios o a Diosa...", y termina diciendo: ",,,DE•SENATI•SENTENTIA RESTITVIT", que significa: "…por orden del senado lo ha restaurado”.
Luego, me encuentro con la grata noticia de que la reseña a mi "Arreolanza" por parte del talentoso poeta, difusor, conductor, educador y político, entre otras muchas cualidades, dn. Pedro Mariscal, proferida en la Casa Taller Literario Juan José Arreola que dirige Orso Arreola Sanchez, ya ha aparecido impresa por parte de la editorial del organizador de la misma Héctor Ag, con la ayuda de Chávez Brambila, otro autor... Aquí les va la parte uno:
Y, entonces, de remate, nos estuvimos (hasta que nos pidieron salir a las dos de la tarde, para su tiempo - fuera de comida y siesta que aún se acostumbra de dos a cuatro, como en antaño), en el café "Confabulario", palabra que Arreola mismo inventara para su libro más popular, y con al menos cuatro connotaciones, y contando..., como todo aquello que salía de su variada imaginaria, al decir de su estudiosa Rosa Pellicer, siendo el primer punto para mí el más significativo desde el punto de vista inventivo: 1) El lector entra en acuerdo con el escritor para interconectar y expandir su propia obra, 2) Conversar, 3) Tratar una cosa entre dos personas y 4) Colección de fábulas..., talentos de los que mis amigas, su nietecita Sara Fernanda AC y su bella sobrina E-Virgis Espinoza también comparten!:
Y aquí, estamos en esa tradición de disponernos a alimentar a las palomas con Cris, Stefano Macedo Reyes, hijo ilustre de Brisette Reyes y del Lic. Macedo, y con Alicia Saldaña, en el jardín principal de Zapotlán el Grande (también conocido como Ciudad Guzmán):
Fernando Castro-Chavez wrote on Anabel Ramirez Guerrero's timeline.
Felicidades!
Place: Zapotlán el Grande (19.7036, -103.465)
Con el gran gusto de la visita del Dr. en células madre, nutrición, genes y genomas, Stefano Macedo Reyes, Alicia Saldaña e hijo, saliendo del café "Confabulario" con rumbo a "Lapso", café y librería de la hermana de Julio César Aguilar, quien anda por Europa, con el fondo de la casa del entonces niño, J. J. Arreola... Y me llevaron a su casa para conversar con Lulú, su amiga...
Updated Jun 9, 2019, 10:29 AM
Fernando Castro-Chavez shared a memory.
Hace 50 años = 50 years ago... [Music: Waltz from Mexico's 'Belle époque': "Dios Nunca Muere" ["God Never Dies"] of 1868, by Macedonio Alcalá (1831-1869)]. |
9 Years Ago
Jun 8, 2012, 2:22 PM
Hace 50 años = 50 years ago... [Music: Waltz from Mexico's 'Belle époque': "Dios Nunca Muere" ["God Never Dies"] of 1868, by Macedonio Alcalá (1831-1869)].
Place: Ciudad Guzmán, Jalisco (19.6833, -103.483)
Address: Ciudad Guzmán, Jalisco, Mexico
De cuando mis papacitos se casaron en Zapotlán el Grande, hace 57 años, y siguen vivos por pura gracia divina:
Updated Jun 8, 2019, 7:48 AM
Otra joya arqueológica es aquella de los "Politarcas" (que es la primera palabra del bloque: π̣ολειταρχούντων: "POLEITARXOUNTON") de Tesalónica, descritos en la Biblia (en Hch. 17:6 y 8 solamente), ahora presente en el Museo Británico, pero en tiempos de E. W. Büllinger aún adornaban muchos de éstos bloques a los arcos de Tesalónica y de la Macedonia (y así lo meniona él con gran emoción en su pág. 1622 de "The Companion Bible": "¡5 de ellas en Tesalónica!): https://www.britishmuseum.org/research/collection_online/collection_object_details.aspx?objectId=398975&partId=1 , diciendo él que aún se podían observar nombres bíblicos semejantes a los mencionados por Lucas, que llegaron a ser discípulos de Pablo, tales como (en esta piedra inscrita): Sosipatros (Sosípater), Demetrios (Demetrio), Gaios (Gayo), etc...
Aquí está ya funcionando mi estudio de Hechos del 13 al 14: https://youtu.be/9akcNYIunlQ y del 15 al 16: https://youtu.be/KlyKyBfVzts (actualizados el siete de junio, tuve que partirlo en dos para que lo aceptara el YT) , en el que soberabunda la gracia!, a pesar de que apedrearon a Pablo, matándolo, con el ministrarle los discípulos de nuevo la vida, y a pesar de que lo azotaron sin piedad, junto con Silas, aún cuando eran ciudadanos romanos, con el pedir justicia él al final, por el bien de sus discípulos... Saulo Paulo, de los Paulos romanos por adopción, quien jamás se jactó de ello, aunque despertara algnos celos de sus propios colaboradores iniciales...
Updated Jun 7, 2019, 2:03 PM
Fernando Castro-Chavez shared a memory.
Acerca de las Maravillas de Mayo, y aún Más Grandes Milagros de Dios para mí en lo que Viene!!!: |
Fernando's May Moments
Acerca de las Maravillas de Mayo, y aún Más Grandes Milagros de Dios para mí en lo que Viene!!!:
Fernando Castro-Chavez added a new video to Raul Martín Cruz-mireles's timeline.
You tagged Raul Martín Cruz-mireles
Raúl: Muy cercanos en nuestros cumpleaños, e igualmente colaboradores de un sólo Dios y Padre, Creador y Fuente de Poder, pero también Fuente de nuestra subsistencia diaria: Proveedor, así de que:: ¡Felicidades verdadero hermano en Cristo!, Fernando. |
Raúl: Muy cercanos en nuestros cumpleaños, e igualmente colaboradores de un sólo Dios y Padre, Creador y Fuente de Poder, pero también Fuente de nuestra subsistencia diaria: Proveedor, así de que:: ¡Felicidades verdadero hermano en Cristo!, Fernando.
Fernando Castro-Chavez shared a memory.
5 Years Ago
Jun 4, 2016, 10:28 PM
Otra tremenda verdad poco conocida por la cristiandad en general son los textos antiguos de Jn. 19:18, y que al juntar los cuatro Evangelios, ¡vemos sorprendidos que fueron cuatro los crucificados con Jesús! La importancia de ello es que los cuatro Evangelios son como cuatro piezas complementarias de un mural hermoso, en los que se ve el énfasis dado por cada uno: Por ejemplo en Mateo, los dos ladrones (duo lestai) que él describe, ambos blasfemaban en contra Jesús, y ambos fueron llevados a última hora, aún después de que los soldados ya se habían repartido la túnica de Jesús y habían puesto su letrero "acusatorio" en tres idiomas, mientras que antes, junto con Jesús, Lucas describe que habían llegado al Calvario dos malhechores (duo kakourgoi), de los cuales uno habló en contra de Jesús, mientras que el otro le tapó la boca a éste al decir que ellos sí merecían dicho castigo pero no Jesús, y al decirle a Jesús que se acordara de él: "cuando VINIERA en gloria en su Reino", a lo que Jesús le respondió al estilo de un Rey: En verdad te digo hoy: Estarás conmigo en el Paraíso, que por el contexto es sobre la tierra, restaurado, en los Mil Años del reinado de Jesucristo. Juan corrobora ésto al decir que había: ¡dos crucificados a cada lado de Jesús! Lo que se observa en el interlineal que he preparado para ustedes, de nuevo tomado del Codex Vaticanus del S. IV: http://www.csntm.org/manuscript/View/GA_03?OSIS=John.19.18 (más evidencia dada también por Juan y tomada de este MS UNCIAL se verá más adelante...)
Uno de los descubrimientos más asombrosos de lo que es la investigación bíblica, y el juntar todas las escrituras que hablan de un mismo tema: Fueron cuatro los crucificados con Jesús: Dos malhechores (uno blasfemó y el otro no, venían con él) y dos ladrones (ambos blasfemaron, los trajeron después), lo que nos demuestra que hay que ir directamente a La Fuente, es decir: Ir directamente a Dios para consultarle, y luego, para los que pueden hacerlo, con humildad leer y estudiar las Escrituras en sus textos originales, ¡es un universo maravilloso!, lo digo por experiencia:
Updated Jun 4, 2019, 9:24 AM
Esta es la entrevista del valeroso mexicano Jorge Ramos con Camilo, hablando de su entrevista con "Maduro" (la cual se ve completa, con subtítulos en inglés en el último segmento): https://www.youtube.com/watch?v=nz7DI9EQ2mY, https://www.youtube.com/watch?v=FKGOO2U1hdk, https://www.youtube.com/watch?v=ETMdZ9PUS2E, https://www.youtube.com/watch?v=i-u5EXF0Ong, https://www.youtube.com/watch?v=Qwbqr2cZzJY, https://www.youtube.com/watch?v=Y_7cGrChESs, y el extra del video que Ramos le estaba mostrando al usurpador cuando éste decidió suspender la entrevista: https://www.youtube.com/watch?v=oCiz4cVP3tw
Updated Jun 4, 2019, 9:09 AM
"You are a burning sun that gives its warmth, you are a torch that heals the darkness!!!... Nevermore anticipate your defeat, stop renouncing without being asked to do so, as of today, only speak victories!" (And the Eagle of our victory flies!, I imagine the sound of its voice!) |
"You are a burning sun that gives its warmth, you are a torch that heals the darkness!!!... Nevermore anticipate your defeat, stop renouncing without being asked to do so, as of today, only speak victories!" (And the Eagle of our victory flies!, I imagine the sound of its voice!)
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Jun 2, 2015, 10:49 AM
This Saturday at 6 PM [Houston time] I'll present live, findings on the actual location of Noah's Ark and its design! I fervently prayed with you last month for help to find its current location, and to understand its windows! By grace divine, I found that this Ark had two kinds of windows!!! 1) One ordered by God (Sohar, Episunagon, the open skylight! Running 1 cubit all along the roof of the ark) and 2) One designed by Noah (hallown, turida, the little window with a door to release and retrieve birds!) if you want to see this presentation, it will be available live (and afterwards), online at: https://www.youtube.com/catadoresdelapalabra1 [Remember to 'refresh' your page near the time. I thank God for His Unconditional Love and Mercy towards us!]
Hace cuatro años, por estas fechas, lo que investigaba y presentaba en nuestras reuniones bíblicas caseras, eran éstos descubrimientos, también nuevos para mí, del lugar preciso en que se encuentran restos del arca de Noé, que coincide con todas las descripciones del mundo antiguo, incluyendo la de Flavio Josefo, descubrí que la madera "Gófer" ("Gopher" en inglés) era la madera petrificada, a falta de grandes aleaciones de acero en esa época, y que la habían ensamblado, entre Noé y sus hijos, de manera vertical... esta maravilla histórica se encuentra dentro de la cadena montañosa Ararat, pero no en la montaña congelada del mismo nombre a la que suelen ir a buscarla exponiendo sus vidas los aventureros engañados, pues esa es de más reciente emergencia comparada con esos días del diluvio...
Updated Jun 2, 2019, 8:42 AM
Y aquí pongo el reportaje que salvé ayer de otra gran venezolana acerca de los niños migrantes: https://www.youtube.com/watch?v=u3Ml0ETiucc y su segunda parte: https://www.youtube.com/watch?v=u3Ml0ETiucc, y la tercera que grabé: https://www.youtube.com/watch?v=FBNvJ7LF11E, había más entre la segunda y la tercera, pero eso yo ya no lo grabé, https://www.dredithbrachosanchez.com/
Updated Jun 1, 2019, 3:25 PM
Fernando Castro-Chavez shared a memory.
7 Years Ago
Fernando Castro-Chavez added a new photo.
May 31, 2014, 8:26 AM
Thanks y'all! This is for our next study at home!!! See you here! And God's blessings on you! Handout: http://fdocc.ucoz.com/2/03_witness_stars.pdf Slides: http://fdocc.ucoz.com/2/03_witness_of_the_stars_final.pdf
Place: Houston, TX
Address: Houston, TX
Un recuerdo de lo que estaba preparando hace cinco años en inglés, en Houston, en nuestras reuniones bíblicas que teníamos por allá. Por mi parte, hoy preparo voluntariamente y de corazón, según el llamado de Dios, Hch. 13 - 16 del griego en español, obviamente para mis santos creyentes electrónicos de habla hispana (tal vez alguna vez los traduzca en inglés si ese es el parecer de Dios, para el bien de aquellos santos también):
Updated May 31, 2019, 9:39 AM
Aquí está mi lectura de hoy, algo pertinente de Emma Godoy: https://www.youtube.com/watch?v=rBk7yqpvr0E, la costumbre oriental era que cuando uno cumplía años, uno daba en vez de sólo recibir...:
Updated May 30, 2019, 6:12 PM
You tagged Aida Castro-Snyder
A detail of the older eating flap of my carnivorous local plant, today, with 15 small and dead insects attached to it, plus one day later the newer "catching racket" with some white insects already trapped, and how the older trap looks, and a third photo of the looks of the whole plant:
Fernando Castro-Chavez shared a memory.
3 Years Ago
May 29, 2018, 3:28 PM
Aquí está mi lectura del griego de "2 Cor. del 10 al 13 y más": https://youtu.be/qrluUDZ7JD0 "Derrumbando argumentos contra Cristo": Así como celebro este cumpleaños (el 30)... así también Pablo celebró la salvación por gracia de los creyentes de Corinto primero, para luego exhortarlos a que como vírgenes puras, ¡se definieran por un solo hombre! (pues eran cortejados por los labiosos y falsos apóstoles, curiosamente también procedentes de los judíos), la Epístola era un pedido divino: ¡para que se definieran por Cristo, y que por siempre anduvieran bajo su guía directa! Comienzo leyendo: "no os unáis en yugo desigual con los incrédulos..." (En las fotos me encuentro frente a la fundada por Arreola, en Chapultepec: "Casa del Lago"... And also, celebrating yesterday with my dearly beloved parents (while reminiscing my whole life with them)!!!
Time goes on, God is First ever!, then us and the family... If I re-marry to see my offspring, fine; if I do not do it, well, also fine, God is my Everything and that is enough for me, furthermore, I am enjoying extremely my wonderful parents, still alive, now in my "new beginning", fully focused at this time in the Wonders of God! ...Oh well, God knows for real the hearts of men...
Updated May 29, 2019, 7:59 AM
Y conforme investigo mi estudio de Hch. 13-16, veo lo costoso en tiempo y esfuerzo que ha sido el ir descubriendo cada una de las ciudades desaparecidas hoy, pero claramente descritas en la Biblia, como cuando se descubrió a Derbe, de la que incluso se dudaba su existencia, como de muchas de ellas, en base a una inscripción que la menciona por parte de su concejalía y sus ciudadanos, dice que uno prominente es de Derbe en la parte superior derecha, usando a la siguiente palabra griega que ustedes pueden ver: "derbeton" (es fascinante el descubrir arqueológicamente todo aquello que la Biblia describe, en su tiempo, con tanta naturalidad!!! Actualizo esto para decir que encontré la fuente con libre acceso para el artículo original, dentro de excelentes descubrimientos de aquella región: https://www.era.lib.ed.ac.uk/handle/1842/29076 con dos diferentes PDF, el primero con su tesis (con un breve paso por Derbe en las págs. 245-248 del PDF, que son las 238-241 numeradas por él), y el segundo incluyendo al artículo que nos concierne, más otras cosas que complementaron su disertación):
Continuando con las investigaciones actuales, Constable cita a Ramsay, quien descubrió otra evidencia sobre la roca del L. Sergius Paullus que vemos en Hch. 13:7, la cual él pone en la pág. 151 de su interesante libro: “The bearing of recent discovery on the trustworthiness of the New Testament” (1915), siendo en este caso el texto en latín: https://archive.org/details/bearingofrecentd00ramsuoft, la nota dice: "L Sergio L F Paullo filio...": "L. Sergio L. F. Paulo hijo..."
Fernando Castro-Chavez shared a memory.
5 Years Ago
May 27, 2016, 10:34 AM
¡Nuestros muertos duermen!: https://web.archive.org/web/20091027120153/http://www.geocities.com/fdocc3/duermen.htm; recordando que Jesús mismo estuvo bien muerto durante 72 horas (del atardecer del miércoles 14 al atardecer del sábado 17 de Nisan del año 28 D.C.); y por ejemplo, vemos que el malhechor (el "Kakourgoi" en gr.) que creyó, le dice a Jesús: "Señor, acuérdate de mí cuando vengas con gloria en tu reino"; es decir, ¡él ya estaba creyendo en el futuro regreso triunfal de Jesús! Y es en ese contexto que Jesús le responde: "¡En verdad ("¡Amén!", en gr.) te digo hoy!: ¡Estarás conmigo en el Paraíso!"; Jesús enfatizó su respuesta en ese instante (el "¡hoy!"), diciéndole que a futuro, en su retorno a la tierra, ¡también el malhechor que creyó en eso volvería a vivir!, ¡y que estaría con Jesús en el Paraíso sobre esta tierra (el reino de los mil años de Jesús)! He elaborado un breve interlineal que anexo para que vean la directa equivalencia con el español del griego UNCIAL ("untado", todo en mayúsculas sin signos de puntuación ni espacios) del S. IV, el "Codex Vaticanus": http://www.csntm.org/manuscript/View/GA_03?OSIS=Luke.23.43 (Ver dos evidencias adicionales más abajo, del S. III, el Papiro Bodmer; del S. V, el Codex Washingtonianus; del S. IX, el Leccionario de Atenas...
Updated May 27, 2019, 9:24 AM
You tagged Rafa Castro
Me preparaba a poner "mi historia" temporal, que es la continuación del discurso en Colombia de Daniel Habif para Venezuela, cuando me encontré con este excelente mensaje: "Billonario dice que conocer a Jesús es más importante que tener mucho dinero": https://www.facebook.com/permalink.php?story_fbid=2313475372025283&id=201549889884519 ¡Ciertísimo!
Éste es otro de los videos que he puesto que ha llamado la atención a mis amados hermanos venezolanos, y es lo que el general Faller dijo antier en Florida, en relación con ya estar listos para el llamado de Guaidó (que primeramente implicaría, desde luego ayuda humanitaria): https://www.youtube.com/watch?v=_oEhIKxg5Oo%2Cpero más que nada nuestras fervientes oraciones espirituales para que nada les falte donde quiera que estén los miembros de nuestra familia espiritual de Venezuela:
Otro hallazgo arqueológico basado en la Biblia, según avanzo en mi estudio e investigación de Hechos, es aquel en el que se menciona en Hch. 16:14 a Lidia, la comerciante en el colorante púrpura de Tiatira: Se han encontrado múltiples inscripciones en piedra en esa ciudad, hechas por los famosos comerciantes en colorantes locales, aquí está una de las más tempranas, del año 50 D.C., tiempo cercano a cuando Pablo anduvo por aquellos lugares, el nexo es: http://philipharland.com/greco-roman-associations/honors-by-dyers-for-a-priestess-of-the-augusti/, y su texto comienza diciendo: "Usando sus propios recursos, los tintoreros honraron..." (Siendo la palabra "tintoreros" la traducción del griego "bapheis" (¡que son las primeras letras, de la tercera a la octava de la inscripción que se anexa!) y del inglés "dyers"; es decir, que originalmente una "tintorería" era el lugar en el que pintaban del color que el cliente quería sus prendas que originalmente eran del color del lino blanco!!!)
Rescatando viejos archivos, me encuentro con que uno de ellos fue citado en el 2009, justo antes de desaparecer, en la página 190 del trabajo sexenal: https://web.archive.org/web/20190522123309/http://www.cdi.salud.gob.mx:8080/BasesCDI/Archivos/Vigilanciaepidemiologica/ENFERM_de_NOTI_SEM.pdf nuestra obra: http://web.archive.org/web/20010411002458/http://www.geocities.com/fdocc/2.htm (también citaron otros en obra semejante, este sitio nuestro, en relación con el "axólotl", pero esa referencia no la alcancé a salvar en su nexo, y se ha ido como se van los sexenios..., pero al menos el anterior lo dejaron durante todos estos diez años, aunque apenas hoy me lo cachó el buscador...)
Hoy me pregunta Luis (del Perú), para mi presentación de "El Testimonio de las Estrellas - Parte 1 - "Astronomía del Nacimiento de Jesucristo" ": https://www.youtube.com/watch?v=9-EcBMbt9bc lo siguiente: "Una pregunta: ¿Quien le puso esos nombres a las estrellas, es cierto que fue Dios, y como se los comunió a los hombres para que las llamen así?, es increible esto, es la prueba de Dios, solo que Satanás distorsionó estre grandioso evangelio dibujado en las estrellas." A lo que yo le respondo: "Excelente pregunta!!!, durante muchos años, unos más de dos mil, no existió la palabra escrita de lo que conocemos como los más tempranos libros de la Biblia: Job primero, luego el Pentateuco, Josué, Jueces, etc..., por lo que el único "libro" disponible entonces era el mensaje escrito en los cielos, por lo que la más simple respuesta es que ellos le preguntaban a Dios y Él les revelaba los nombres, igual que sucedió al principio con Adán para nombrar a los animales: Oh sabiduría altísima de nuestro gran Dios!!!, aquí traduje para la gente hermosa que ama a Dios de corazón, como tú, la tremenda introducción de E. W. Büllinger a su antiguo libro elemental de "El Testimonio de las Estrellas" (basado a su vez en otros anteriores a él: del Dr. Seiss y de la dama Rolleston): https://web.archive.org/web/20091027125626/http://www.geocities.com/fdocc/bull.htm, y de aquí me gustaría citar su contexto histórico: "... los zodiacos de los templos de Denderah, en Egipto son sin duda copias de zodiacos aún más antiguos que, por evidencia interna, deben de ser colocados hacia 4,000 AC, cuando el solsticio de verano estaba en Leo. Josefo nos transmite lo que dice ser las tradiciones de su propia nación, corroborada por su referencia a ocho autoridades antiguas gentiles, cuyas obras se hallan perdidas. Dice que todas ellas afirman que: "Dios dio a los hombres anteriores al diluvio una tan larga vida, para que pudieran perfeccionar aquellas cosas que habían aprendido e inventado en la astronomía"." " Y aquí para ustedes yo añado: Podrán sacudirse los cielos y la tierra, pero nuestra inquebrantable fidelidad a DIOS y primera y únicamente a DIOS, permanece y permanecerá con SU ayuda inquebrantable hasta el día de mi último suspiro!!! Fernando.
Comenzando con mi estudio de Hch. del 13 al 16 del griego, me encuentro con éstas monedas del 43 DC de Chipre, en donde se ve la palabra "Procónsul" ("Anthupatou"), que es lo que era Sergio Paulo, aquí las he preservado, pues son de reciente hallazgo, "Claudio" (que significa "El Cojo"), era el César de esa época; oh maravillas arqueológicas que una y otra vez encuentran su inefable sustento en las Escrituras!: https://web.archive.org/web/20190516204944/http://www.wildwinds.com/coins/greece/cyprus/t.html
Con un gran gusto presento aquí mi estudio de hoy de Hechos del 9 al 12 del griego: https://youtu.be/WO9dMYL3BYM
Updated May 14, 2019, 3:36 PM
Los del "YouTube" me mandan esto por correo electrónico, y luego me piden compartirlo aquí en el "Facebook"; bueno, pues aquí va, y con la gran noticia de que primero Dios, mañana presento y luego subo mi estudio de Hechos capítulos 9 al 12 del griego, se observa la salvación de Saulo, los milagros de Pedro, con Eneas, Tabita y Cornelio, miren que Dios nos dice aquí en la estructura maravillosa de eso: Curar a un paralítico es maravilloso, levantar a una creyente de entre los muertos es tremendamente maravilloso, pero lo más sobrenaturalmente maravilloso es llevar a alguien a renacer del santo espíritu de Dios, lo cual tiene un valor para toda la eternidad, y aquí el gran corazón de ese Capitán, jefe de cien soldados, es que su casa estaba llena cuando Pedro llegó, de sus familiares y de sus amigos más cercanos: los "philous" NECESARIOS ("anankaious"), ¡qué palabras tan bellas en griego, especialmente la última que según Lacueva es eso: ¿tienes tú acaso algún o algunos amigos que al decir de la Biblia sean "necesarios"?!... (Yo en estos momentos, por mi parte voy "bananas" con ese nuevo concepto que Dios nos da):
Updated May 13, 2019, 7:28 PM
Fernando Castro-Chavez shared a memory.
Recordando una vez más a mi pura madre, en este bello recuerdo de mi graduación de la Prepa Varonil de la UAG, con Cañedo:
Updated May 10, 2019, 9:31 AM
Esta es la entrevista de anoche que Juan Guaidó tuvo con Fernando del Rincón: https://youtu.be/PUdtjCLmw7s
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
May 7, 2015, 9:28 PM
Mañana a las 7:50 PM por el YouTube veremos en vivo otro descubrimiento maravilloso de la exactitud de de la Palabra de Dios que me tocó hacer por la pura gracia de Dios y que comienza con el hecho de que María ya llevaba tres meses de embarazo cuando se casó con José, y por eso él pensó en dejarla; según las Costumbres Orientales, un año antes de la boda eran los esponsales, cuando el futuro marido daba a su futura esposa las 10 monedas de plata (equivalentes al anillo de compromiso). Una vez casados, la luna de miel de la Ley de Moisés duraba también durante todo un año!
Recordando los inicios de nuestra salvación, que yacía en el vientre de María, quien viniendo del linaje directo de Salomón, se vio forzada a romper a la mitad con la luna de miel hebrea que duraba todo un año para ir a cumplir con la vanidosa ley de César Augusto de que todo miembro de su Imperio Romano firmara fidelidad absoluta a él, dando así cumplimiento a la profecía de que nuestro salvador (y eso significa Jesús, idéntico significado el de Josué y similar el de Isaías) nacería en Belén!!! Acompañada del buen padre adoptivo de Jesús, José, primo lejano de María, ya que provenía de Natán, hermano menor de Salomón, quien al casarse con María, ésta ya llevaba tres meses de embarazo, por lo que en un principio se sintió engañado, hasta que el ángel le dijo que así debía de ser, que el bebé era de origen divino, lo que José creyó y aceptó, engendrando después con María cuatro hijos y al menos tres hijas, ya que la pareja, el matrimonio, los hijos, todo ello son cosas benditas de Dios para los hombres y no impuras ni inmundas, es decir, para concluir este breve, que un medio hermano de Jesús llamado Jacobo procedente de María y de José llegó a ser el autor de la epístola que hoy conocemos como de Santiago (Saint-Jacob), además de que fue el líder de Jerusalén, desgraciadamente tornado al legalismo, y otro de sus medios hermanos fue el que escribió la brevísima y tan profunda epístola de Judas... oh maravillosas revelaciones verdaderas de la Escritura inspirada por Dios cuando se estudia con un corazón humilde y fiel ante Dios y no ante los hombres ni ante sus doctrinas torcidas!
Updated May 7, 2019, 7:39 AM
Esta vez, intenté meter esto que es el consecutivo de la serie en mi historia, y ya no tuve la opción de hacerlo, por lo que lo meto aquí en "público" para no perder la continuidad y seguir orando sin cesar por Venezuela, por favor, y yo, orando y haciendo lo que puedo, ya que en unas cuantas horas están por aparecer videos tremendos de lo que no se había hablado en los medios hasta hoy (de "Conclusiones" del 6 de Mayo, 2019, con Fernando del Rincón), ¡el caso injusto del Maduro injusto contra José Planchart!: https://youtu.be/U1o0hvECTg0 y https://youtu.be/0PswU3hLKI8 y una foto inédita enviada al Gral. (r) Antonio Rivero de cómo los militares de Venezuela han revelado sus secretos a China y Cuba, en contexto (abajo pongo esa foto de la pantalla de la tele): https://youtu.be/iNDAn_B29OY, y falta el primer segmento, en donde les habla a sus colegas militares con el corazón en la mano y las evidencias al desnudo: https://youtu.be/p6QCdxNoQcI (cuando aparezca, al haberse subido todo). |
Esta vez, intenté meter esto que es el consecutivo de la serie en mi historia, y ya no tuve la opción de hacerlo, por lo que lo meto aquí en "público" para no perder la continuidad y seguir orando sin cesar por Venezuela, por favor, y yo, orando y haciendo lo que puedo, ya que en unas cuantas horas están por aparecer videos tremendos de lo que no se había hablado en los medios hasta hoy (de "Conclusiones" del 6 de Mayo, 2019, con Fernando del Rincón), ¡el caso injusto del Maduro injusto contra José Planchart!: https://youtu.be/U1o0hvECTg0 y https://youtu.be/0PswU3hLKI8 y una foto inédita enviada al Gral. (r) Antonio Rivero de cómo los militares de Venezuela han revelado sus secretos a China y Cuba, en contexto (abajo pongo esa foto de la pantalla de la tele): https://youtu.be/iNDAn_B29OY, y falta el primer segmento, en donde les habla a sus colegas militares con el corazón en la mano y las evidencias al desnudo: https://youtu.be/p6QCdxNoQcI (cuando aparezca, al haberse subido todo).
Aquí les dejo un avance de mi próximo estudio a presentar de Hechos; aquí me sorprende el darme cuenta hasta ahora que la Biblia menciona a cuatro Herodes directamente implicados o con Cristo o con sus discípulos: 1) "El Grande", 2) El Antipas I, 3) El Agripa I y 4) El Agripa II, además de que en total se menciona: ¡A 11 miembros de esta familia infame!, de los cuales 4 son mujeres: Berenice, Drusila, Herodías y Salomé (de la que no se da el nombre), tres de ellas se casaron con sus tíos, excepto Drusila que se casó con el corrupto de Félix (es decir que la maravillosa Escritura está siempre llena de grandes sorpresas, unas buenas y otras malas, como el linaje de esta gente que provenía del pelirrojo Edom, quien fue Esaú):
Y sí, seguimos poniendo en nuestra historia nuestras oraciones espirituales y con entendimiento para la pronta liberación de Venezuela, al tiempo que recordamos esas tomas de diferentes ángulos del excelente mensaje profético de Daniel Habif (para que al verlas ustedes, también eleven conmigo una oración por las buenas gentes de aquel país):
Operación Libertad de Venezuela Hoy: https://www.youtube.com/watch?v=uSrYp02P1Is
Updated Apr 30, 2019, 9:59 AM
Con gran gusto comparto aquí mi lectura de Hechos, capítulos del 5 al 8 de mi traducción del griego: https://youtu.be/_U72pGJ8hI8 que le da continuación a mi primera parte en donde cubrí los capítulos del 1 al 4: https://youtu.be/kzd4w8f1f6I Esto, para la gloria de Dios y de Su santa familia aquí sobre la tierra. En la de hoy se observa desde el asunto de Ananías y Safira, pasando por la liberación de prisión de los Apóstoles, luego al asunto del primer conflicto entre cristianos provenientes del judaísmo helénico de la diáspora y los cristianos del judaísmo hebreo de Jerusalén, los que discriminaban a las viudas, y la elección de 7 servidores de ellas, destacándose Esteban, del que se estudia su gran discurso que derrumbó la soberbia del sanedrín saduceo por la tierra santa, por Moisés y la Ley, y por el templo, costándole la vida..., hasta cuando Felipe, otro de los servidores de viudas, llega a Samaria, dada la persecución que desató Saulo, en donde renacen y sanan al por mayor, incluyendo a un mago que manipulaba demonios llamado Simón, y cómo Pedro y Juan los llevaron al punto de manifestar el poder que ya llevaban dentro, y cómo luego Felipe responde al llamado divino de ayudar a renacer a un eunuco de Etiopía...
Updated Apr 27, 2019, 1:51 AM
Fernando Castro-Chavez shared a memory.
10 Years Ago
Fernando Castro-Chavez added a new photo.
Apr 26, 2011, 6:40 PM
By the mouth of babes..." These pictures by Michael Lindsey touch my heart very hard, encouraging me to always do a better job for God. Here is my fast translation including that little one, Aaron, who witnessed me for salvation 24 years ago: http://fdocc.ucoz.com/living_letters.doc
Little ones from India sharing with pure heart and boldness the Word of God (but right now, they may be big!), under that fruitful ministry of my dear brother in Christ Sangat Bains:
Updated Apr 26, 2019, 7:59 PM
"Tú pudiste haberlo perdido todo estos últimos 20 años. Pudieron haberte robado todo. Pero aún tienes vida para recuperarlo todo. Hoy lo intentaremos de nuevo. Porque ha llegado el momento, la hora: ¡Donde tendrás la victoria total!" |
"Tú pudiste haberlo perdido todo estos últimos 20 años. Pudieron haberte robado todo. Pero aún tienes vida para recuperarlo todo. Hoy lo intentaremos de nuevo. Porque ha llegado el momento, la hora: ¡Donde tendrás la victoria total!"
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Apr 18, 2015, 11:10 PM
Yes, I believe in God’s prophecies! Of all the time that Jesus and his Dad God talked during the 70-week Ministry of Jesus, as prophesied by Daniel, it is amazing that only three times it was audibly heard the actual voice of God! The first time was when he was baptized by his older cousin John; at this time, God was Anointing Jesus to be ‘The Apostle’!
De nuevo, recuerdo la maravilla de esas únicas tres veces audibles en las que Dios habló con Jesús en su tan breve y efectivo servicio de salvación para con el ser humano, ¡del que aún la duración exacta había sido ya profetizada para evitar falsificaciones: solamente 70 semanas (coronadas por una Pascua inicial y la Pascua final): siendo aquel el año agradable del Señor! (el error de pensar que duró 3 años viene de que alguien agregó un versículo falso, el de Jn. 6:4: “Y estaba cerca la pascua, la fiesta de los judíos”, ¿y cómo sabemos que eso es falso? ¡Porque la Ley decretaba que todo hombre judío fuera a Jerusalén en esa fiesta, y para nada Jesús ni los suyos van a Jerusalén en ese momento que andaban por allá por Galilea, sino hasta la Pascua en la que él entregó su vida por ti y por mi!): 1) Primero le habló a él sólo, a Jesús al salir de su bautizo en el Jordán, dando inicio a su servicio como Apóstol, 2) Segundo, le habló en compañía de sus tres más cercanos Apóstoles: Pedro, Jacobo y Juan, allá en el monte Hermón en Damasco, cuando Dios lo "transfiguró" llenándolo de luz, con lo que lo estaba ungiendo como Sumo Sacerdote según el orden de Melquisedec (Melek Tsedek Shalom: Rey de Justicia y Paz): ¡el mismo día que el Sumo Sacerdote según el orden Aarónico Levita entraba por solamente una vez durante todo el año al "Lugar Santísimo" del templo de Jerusalén!, y 3) Tercero, le habló delante de toda la gente para designarlo ¡como el Cordero del sacrificio para ese año!, estando él ya dentro de Jerusalén. De nuevo: ¡Oh maravilla de maravillas no exploradas, novedosas y reales de la vida de nuestro Señor y Salvador Jesús!
Updated Apr 18, 2019, 3:41 PM
Fernando Castro-Chavez shared a memory.
Marzo, con papás y el escrito de papá, con la luna más grande del año, con mis lecturas de "El Día Cien" y de "El Gran Viaje" de J. Manuel Chávez, etc... |
Fernando's March Moments
Marzo, con papás y el escrito de papá, con la luna más grande del año, con mis lecturas de "El Día Cien" y de "El Gran Viaje" de J. Manuel Chávez, etc...
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Apr 14, 2015, 9:09 AM
This was the audio introduction of the original presentation from January of 1984 of the Seminar on "A Harmony of the Gospels": https://youtu.be/X1zqSfjjU8s
Recordando aquí que Jesús es el brote o renuevo ("Zemach" en hebreo) profetizado con exactamente cuatro facetas: 1) Que vino como rey (en Mateo, que da la genealogía de María, directa descendiente de Salomón), 2) como esclavo (en Marcos), 3) como un hombre compasivo (en Lucas, quien da la genealogía de José, padre adoptivo de Jesús; viendo que José no descendía de Salomón, sino de otro de sus hermanos menores: Natán), 4) ¡y en Juan se nos presenta a Jesús como el hijo de Dios! ¡Oh, maravillas de la multiforme sabiduría de nuestro gran Dios!
Updated Apr 14, 2019, 7:42 PM
La desconocida MCVR, con todo el amor de Dios que es capaz de contener en ese su cuerpecito, me ha mandado desde sus islas esta canción: https://www.youtube.com/watch?v=dW7m2uDJEww que equivale al inglés: https://www.youtube.com/watch?v=T0ip40j82ws, se trata de su cantante cristiana favorita, espero les guste como a mí, atentamente, Fernando.
Updated Apr 4, 2019, 9:20 AM
Al saber que CNN está prohibida en Venezuela por el del Podrido usurpador gobierno, he decidido aquí grabar desde mi iPad, y poner el programa completo de la entrevista de Fabiana Rosales, Primera Dama Interina a sus 26 años, con mi admirado paisa y "namesake" el Fernandote del Rincón. Así también he querido hacer una captura histórica de las noticias que se encuentran ahora en CNN acerca de lo mismo: https://cnnespanol.cnn.com/video/argentina-hecho-del-dia-lado-crudo-crisis-venezuela-primera-persona-perspectivas-buenos-aires/
#ElHechoDelDía: Relato que retrata la crisis de Venezuela, sin luz y sin medicamentos
“Murió porque no había asistencia en el hospital, porque no tenían medicamentos, por eso murió la mujer de mi vida”, estas fueron las palabras de un hombre durante las manifestaciones por falta de luz en Venezuela. Mientras tanto, el gobierno del cuestionado presidente Nicolás Maduro anunció un plan de 30 días para racionar la energía.
Por Juan Pablo Varsky, CNN Radio Argentina Publicado a las 21:15 ET (01:15 GMT) 1 abril, 2019
https://cnnespanol.cnn.com/video/ninos-venezuela-emergencia-pediatrica-medicamentos-paula-newton/
Niños sufren en los hospitales de Venezuela por falta de medicamentos y electricidad
Los apagones en Venezuela han causado que las guardias de emergencia pediátrica estén sobrecargadas y sin medicamentos. Los tratamientos son rudimentarios por donde uno mire y cada niño cuenta una historia desgarradora. Con el informe, Paula Newton.
Por Paula Newton, CNN Publicado a las 17:02 ET (21:02 GMT) 1 abril, 2019
https://cnnespanol.cnn.com/video/venezuela-ayuda-humanitaria-entrega-cruz-roja-camilo-sot/
¿Cómo entregará la Cruz Roja la ayuda humanitaria a Venezuela?
Lester Toledo, coordinador de ayuda humanitaria para Venezuela, nombrado por el presidente de la Asamblea Nacional de Venezuela, Juan Guaidó, afirmó que al permitir el régimen del cuestionado presidente Nicolás Maduro el ingreso de ayuda a Venezuela, están reconociendo que esta hace falta. Dijo que la entrega no será politizada, ni la gente necesitará un carnet del gobierno para recibirla.
Por Camilo Egaña, CNN Publicado a las 00:09 ET (04:09 GMT) 2 abril, 2019
https://cnnespanol.cnn.com/video/situacion-caracas-venezuela-kay-guerrero-conclusiones/
Así operan los colectivos armados en Venezuela
Venezuela vive su tercer apagón generalizado en menos de un mes. Tampoco hay agua. La frustración se siente en la calle donde cientos de manifestantes demandan soluciones y exigen la renuncia del asediado presidente Nicolás Maduro. Sin embargo, los venezolanos pagan un alto precio por manifestar el descontento. Grupos armados progobierno, conocidos como “colectivos”, rodean varias ciudades del país con armas largas para interrumpir las protestas. Maduro, lejos de condenar la violencia, les ha pedido a los colectivos que den la batalla en la calle en busca de la paz.
Por Kay Guerrero, CNN Español Publicado a las 23:28 ET (03:28 GMT) 1 abril, 2019
https://cnnespanol.cnn.com/video/fabiana-rosales-secuestro-2012-entrevista-fernando-del-rincon-conclusiones/
Fabiana Rosales: “En el 2012, yo fui secuestrada”
Fabiana Rosales, esposa de Juan Guaidó, presidente de la Asamblea Nacional, reconocido como presidente encargado de Venezuela por más de 50 países, le confiesa a Fernando del Rincón cómo su familia ha vivido de cerca la crisis humanitaria en Venezuela. Cuenta cómo en 2012, fue secuestrada en Zulia y su papá tuvo que rescatarla. Detalla, además, en las condiciones en las que se crió y educó.
Por Fernando del Rincón, CNN Publicado a las 23:31 ET (03:31 GMT) 1 abril, 2019
https://cnnespanol.cnn.com/video/venezuela-onu-ayuda-humanitaria-nicolas-maduro-cafe-live-yilber-vega/
Borrador filtrado de un informe de la ONU revela las carencias de los venezolanos
El borrador de un informe interno de la ONU que se filtró y fue publicado por el diario The New York Times, revela dramáticos números sobre la situación que vive el país suramericano. El borrador indica que el 94% de los venezolanos en la pobreza, 3,4 millones han abandonado el país y se espera que casi dos millones más han lo propia durante el 2019.
Por Yilber Vega, CNN Español Publicado a las 10:07 ET (14:07 GMT) 2 abril, 2019
https://cnnespanol.cnn.com/video/apagones-venezuela-mecanismo-control-incapacidad-resolver-racionamiento-electricidad-jorge-alejandro-rodriguez-entrevista-serbia-dinero/
Más apagones en Venezuela, ¿mecanismo de control o incapacidad para resolver?
El Gobierno de Venezuela extendió la suspensión de actividades laborales y escolares. Además, estableció un plan de racionamiento de electricidad por 30 días. La discusión con Jorge Alejandro Rodríguez, ingeniero electricista y exvicepresidente de generación y transmisión de energía en la empresa venezolana Cadafe.
Por Xavier Serbiá, CNN Publicado a las 22:21 ET (02:21 GMT) 1 abril, 2019
https://cnnespanol.cnn.com/video/venezuela-juan-guaido-inmunidad-lkl-osmary-hernandez/
Venezuela: El oficialismo cierra el cerco en torno a Juan Guaidó
Mientras el Tribunal Supremo de Justicia de Venezuela instruyó a la Asamblea Nacional Constituyente para que retire la inmunidad parlamentaria a Juan Guaidó, quien se declaró presidente interino del país, este asegura que todo forma parte de una persecución política. En tanto, para algunos juristas, la disposición contra Guaidó es ilegítima porque la Asamblea Nacional Constituyente no está autorizada para ejecutar el mandato del alto tribunal de justicia.
Por Osmary Hernández, CNN Publicado a las 06:46 ET (10:46 GMT) Martes, 2 abril, 2019
https://cnnespanol.cnn.com/video/juan-guaido-inmunidad-venezuela-nicolas-maduro-tribunal-camilo-sot/
¿Por qué quieren quitarle la inmunidad al presidente de la Asamblea Nacional de Venezuela?
Orlando Viera Blanco, embajador de Juan Guaidó en Canadá, expresa que el tribunal supremo de Venezuela, al tratar de quitarle la inmunidad al presidente de la Asamblea Nacional, lo que está haciendo es un acto de provocación para tratar de detener lo que a su juicio es incontenible, el cese de la usurpación.
Por Camilo Egaña, CNN Publicado a las 00:10 ET (04:10 GMT) Martes, 2 abril, 2019
https://cnnespanol.cnn.com/video/juan-guaido-fabiana-rosales-entrevista-fernando-del-rincon-conclusiones/
Fabiana Rosales: “Nunca he imaginado a Juan encarcelado”
Fabiana Rosales, esposa de Juan Guaidó, presidente de la Asamblea Nacional y reconocido como presidente interino de Venezuela por más de 50 países, le responde a Fernando del Rincón si se ha imaginado a su esposo detenido. Del Rincón recuerda los casos de los opositores Leopoldo López, Daniel Cevallos y Enzo Scarano.
Por Fernando del Rincón, CNN Publicado a las 23:23 ET (03:23 GMT) 1 abril, 2019
https://cnnespanol.cnn.com/video/venezuela-precariedad-hospitales-sin-electricidad-pkg-osmary-hernandez/
Venezuela: precariedad en los hospitales por las fallas en el servicio eléctrico
Una serie de videos que circulan por las redes sociales muestra el estado de precariedad de decenas de pacientes en el hospital Luis Gómez López en Barquisimeto, Venezuela, afectados por los apagones de electricidad. Se trata de imágenes sensibles, que CNN no ha podido aún confirmar de forma independiente. En algunos videos se relatan las duras condiciones que enfrentan los profesionales de la salud para atender a los pacientes. CNN ha intentado comunicarse con el hospital Luis Gómez López sin éxito. Este miércoles Osmary Hernández visitó un centro de diálisis que no está prestando servicio debido a la interrupción del servicio eléctrico.
Por Osmary Hernández, CNN Publicado a las 15:51 ET (19:51 GMT) 27 marzo, 2019... |
Al saber que CNN está prohibida en Venezuela por el del Podrido usurpador gobierno, he decidido aquí grabar desde mi iPad, y poner el programa completo de la entrevista de Fabiana Rosales, Primera Dama Interina a sus 26 años, con mi admirado paisa y "namesake" el Fernandote del Rincón. Así también he querido hacer una captura histórica de las noticias que se encuentran ahora en CNN acerca de lo mismo: https://cnnespanol.cnn.com/video/argentina-hecho-del-dia-lado-crudo-crisis-venezuela-primera-persona-perspectivas-buenos-aires/
#ElHechoDelDía: Relato que retrata la crisis de Venezuela, sin luz y sin medicamentos
“Murió porque no había asistencia en el hospital, porque no tenían medicamentos, por eso murió la mujer de mi vida”, estas fueron las palabras de un hombre durante las manifestaciones por falta de luz en Venezuela. Mientras tanto, el gobierno del cuestionado presidente Nicolás Maduro anunció un plan de 30 días para racionar la energía.
Por Juan Pablo Varsky, CNN Radio Argentina Publicado a las 21:15 ET (01:15 GMT) 1 abril, 2019
https://cnnespanol.cnn.com/video/ninos-venezuela-emergencia-pediatrica-medicamentos-paula-newton/
Niños sufren en los hospitales de Venezuela por falta de medicamentos y electricidad
Los apagones en Venezuela han causado que las guardias de emergencia pediátrica estén sobrecargadas y sin medicamentos. Los tratamientos son rudimentarios por donde uno mire y cada niño cuenta una historia desgarradora. Con el informe, Paula Newton.
Por Paula Newton, CNN Publicado a las 17:02 ET (21:02 GMT) 1 abril, 2019
https://cnnespanol.cnn.com/video/venezuela-ayuda-humanitaria-entrega-cruz-roja-camilo-sot/
¿Cómo entregará la Cruz Roja la ayuda humanitaria a Venezuela?
Lester Toledo, coordinador de ayuda humanitaria para Venezuela, nombrado por el presidente de la Asamblea Nacional de Venezuela, Juan Guaidó, afirmó que al permitir el régimen del cuestionado presidente Nicolás Maduro el ingreso de ayuda a Venezuela, están reconociendo que esta hace falta. Dijo que la entrega no será politizada, ni la gente necesitará un carnet del gobierno para recibirla.
Por Camilo Egaña, CNN Publicado a las 00:09 ET (04:09 GMT) 2 abril, 2019
https://cnnespanol.cnn.com/video/situacion-caracas-venezuela-kay-guerrero-conclusiones/
Así operan los colectivos armados en Venezuela
Venezuela vive su tercer apagón generalizado en menos de un mes. Tampoco hay agua. La frustración se siente en la calle donde cientos de manifestantes demandan soluciones y exigen la renuncia del asediado presidente Nicolás Maduro. Sin embargo, los venezolanos pagan un alto precio por manifestar el descontento. Grupos armados progobierno, conocidos como “colectivos”, rodean varias ciudades del país con armas largas para interrumpir las protestas. Maduro, lejos de condenar la violencia, les ha pedido a los colectivos que den la batalla en la calle en busca de la paz.
Por Kay Guerrero, CNN Español Publicado a las 23:28 ET (03:28 GMT) 1 abril, 2019
https://cnnespanol.cnn.com/video/fabiana-rosales-secuestro-2012-entrevista-fernando-del-rincon-conclusiones/
Fabiana Rosales: “En el 2012, yo fui secuestrada”
Fabiana Rosales, esposa de Juan Guaidó, presidente de la Asamblea Nacional, reconocido como presidente encargado de Venezuela por más de 50 países, le confiesa a Fernando del Rincón cómo su familia ha vivido de cerca la crisis humanitaria en Venezuela. Cuenta cómo en 2012, fue secuestrada en Zulia y su papá tuvo que rescatarla. Detalla, además, en las condiciones en las que se crió y educó.
Por Fernando del Rincón, CNN Publicado a las 23:31 ET (03:31 GMT) 1 abril, 2019
https://cnnespanol.cnn.com/video/venezuela-onu-ayuda-humanitaria-nicolas-maduro-cafe-live-yilber-vega/
Borrador filtrado de un informe de la ONU revela las carencias de los venezolanos
El borrador de un informe interno de la ONU que se filtró y fue publicado por el diario The New York Times, revela dramáticos números sobre la situación que vive el país suramericano. El borrador indica que el 94% de los venezolanos en la pobreza, 3,4 millones han abandonado el país y se espera que casi dos millones más han lo propia durante el 2019.
Por Yilber Vega, CNN Español Publicado a las 10:07 ET (14:07 GMT) 2 abril, 2019
https://cnnespanol.cnn.com/video/apagones-venezuela-mecanismo-control-incapacidad-resolver-racionamiento-electricidad-jorge-alejandro-rodriguez-entrevista-serbia-dinero/
Más apagones en Venezuela, ¿mecanismo de control o incapacidad para resolver?
El Gobierno de Venezuela extendió la suspensión de actividades laborales y escolares. Además, estableció un plan de racionamiento de electricidad por 30 días. La discusión con Jorge Alejandro Rodríguez, ingeniero electricista y exvicepresidente de generación y transmisión de energía en la empresa venezolana Cadafe.
Por Xavier Serbiá, CNN Publicado a las 22:21 ET (02:21 GMT) 1 abril, 2019
https://cnnespanol.cnn.com/video/venezuela-juan-guaido-inmunidad-lkl-osmary-hernandez/
Venezuela: El oficialismo cierra el cerco en torno a Juan Guaidó
Mientras el Tribunal Supremo de Justicia de Venezuela instruyó a la Asamblea Nacional Constituyente para que retire la inmunidad parlamentaria a Juan Guaidó, quien se declaró presidente interino del país, este asegura que todo forma parte de una persecución política. En tanto, para algunos juristas, la disposición contra Guaidó es ilegítima porque la Asamblea Nacional Constituyente no está autorizada para ejecutar el mandato del alto tribunal de justicia.
Por Osmary Hernández, CNN Publicado a las 06:46 ET (10:46 GMT) Martes, 2 abril, 2019
https://cnnespanol.cnn.com/video/juan-guaido-inmunidad-venezuela-nicolas-maduro-tribunal-camilo-sot/
¿Por qué quieren quitarle la inmunidad al presidente de la Asamblea Nacional de Venezuela?
Orlando Viera Blanco, embajador de Juan Guaidó en Canadá, expresa que el tribunal supremo de Venezuela, al tratar de quitarle la inmunidad al presidente de la Asamblea Nacional, lo que está haciendo es un acto de provocación para tratar de detener lo que a su juicio es incontenible, el cese de la usurpación.
Por Camilo Egaña, CNN Publicado a las 00:10 ET (04:10 GMT) Martes, 2 abril, 2019
https://cnnespanol.cnn.com/video/juan-guaido-fabiana-rosales-entrevista-fernando-del-rincon-conclusiones/
Fabiana Rosales: “Nunca he imaginado a Juan encarcelado”
Fabiana Rosales, esposa de Juan Guaidó, presidente de la Asamblea Nacional y reconocido como presidente interino de Venezuela por más de 50 países, le responde a Fernando del Rincón si se ha imaginado a su esposo detenido. Del Rincón recuerda los casos de los opositores Leopoldo López, Daniel Cevallos y Enzo Scarano.
Por Fernando del Rincón, CNN Publicado a las 23:23 ET (03:23 GMT) 1 abril, 2019
https://cnnespanol.cnn.com/video/venezuela-precariedad-hospitales-sin-electricidad-pkg-osmary-hernandez/
Venezuela: precariedad en los hospitales por las fallas en el servicio eléctrico
Una serie de videos que circulan por las redes sociales muestra el estado de precariedad de decenas de pacientes en el hospital Luis Gómez López en Barquisimeto, Venezuela, afectados por los apagones de electricidad. Se trata de imágenes sensibles, que CNN no ha podido aún confirmar de forma independiente. En algunos videos se relatan las duras condiciones que enfrentan los profesionales de la salud para atender a los pacientes. CNN ha intentado comunicarse con el hospital Luis Gómez López sin éxito. Este miércoles Osmary Hernández visitó un centro de diálisis que no está prestando servicio debido a la interrupción del servicio eléctrico.
Por Osmary Hernández, CNN Publicado a las 15:51 ET (19:51 GMT) 27 marzo, 2019...
#ElHechoDelDía: Relato que retrata la crisis de Venezuela, sin luz y sin medicamentos
“Murió porque no había asistencia en el hospital, porque no tenían medicamentos, por eso murió la mujer de mi vida”, estas fueron las palabras de un hombre durante las manifestaciones por falta de luz en Venezuela. Mientras tanto, el gobierno del cuestionado presidente Nicolás Maduro anunció un plan de 30 días para racionar la energía.
Por Juan Pablo Varsky, CNN Radio Argentina Publicado a las 21:15 ET (01:15 GMT) 1 abril, 2019
https://cnnespanol.cnn.com/video/ninos-venezuela-emergencia-pediatrica-medicamentos-paula-newton/
Niños sufren en los hospitales de Venezuela por falta de medicamentos y electricidad
Los apagones en Venezuela han causado que las guardias de emergencia pediátrica estén sobrecargadas y sin medicamentos. Los tratamientos son rudimentarios por donde uno mire y cada niño cuenta una historia desgarradora. Con el informe, Paula Newton.
Por Paula Newton, CNN Publicado a las 17:02 ET (21:02 GMT) 1 abril, 2019
https://cnnespanol.cnn.com/video/venezuela-ayuda-humanitaria-entrega-cruz-roja-camilo-sot/
¿Cómo entregará la Cruz Roja la ayuda humanitaria a Venezuela?
Lester Toledo, coordinador de ayuda humanitaria para Venezuela, nombrado por el presidente de la Asamblea Nacional de Venezuela, Juan Guaidó, afirmó que al permitir el régimen del cuestionado presidente Nicolás Maduro el ingreso de ayuda a Venezuela, están reconociendo que esta hace falta. Dijo que la entrega no será politizada, ni la gente necesitará un carnet del gobierno para recibirla.
Por Camilo Egaña, CNN Publicado a las 00:09 ET (04:09 GMT) 2 abril, 2019
https://cnnespanol.cnn.com/video/situacion-caracas-venezuela-kay-guerrero-conclusiones/
Así operan los colectivos armados en Venezuela
Venezuela vive su tercer apagón generalizado en menos de un mes. Tampoco hay agua. La frustración se siente en la calle donde cientos de manifestantes demandan soluciones y exigen la renuncia del asediado presidente Nicolás Maduro. Sin embargo, los venezolanos pagan un alto precio por manifestar el descontento. Grupos armados progobierno, conocidos como “colectivos”, rodean varias ciudades del país con armas largas para interrumpir las protestas. Maduro, lejos de condenar la violencia, les ha pedido a los colectivos que den la batalla en la calle en busca de la paz.
Por Kay Guerrero, CNN Español Publicado a las 23:28 ET (03:28 GMT) 1 abril, 2019
https://cnnespanol.cnn.com/video/fabiana-rosales-secuestro-2012-entrevista-fernando-del-rincon-conclusiones/
Fabiana Rosales: “En el 2012, yo fui secuestrada”
Fabiana Rosales, esposa de Juan Guaidó, presidente de la Asamblea Nacional, reconocido como presidente encargado de Venezuela por más de 50 países, le confiesa a Fernando del Rincón cómo su familia ha vivido de cerca la crisis humanitaria en Venezuela. Cuenta cómo en 2012, fue secuestrada en Zulia y su papá tuvo que rescatarla. Detalla, además, en las condiciones en las que se crió y educó.
Por Fernando del Rincón, CNN Publicado a las 23:31 ET (03:31 GMT) 1 abril, 2019
https://cnnespanol.cnn.com/video/venezuela-onu-ayuda-humanitaria-nicolas-maduro-cafe-live-yilber-vega/
Borrador filtrado de un informe de la ONU revela las carencias de los venezolanos
El borrador de un informe interno de la ONU que se filtró y fue publicado por el diario The New York Times, revela dramáticos números sobre la situación que vive el país suramericano. El borrador indica que el 94% de los venezolanos en la pobreza, 3,4 millones han abandonado el país y se espera que casi dos millones más han lo propia durante el 2019.
Por Yilber Vega, CNN Español Publicado a las 10:07 ET (14:07 GMT) 2 abril, 2019
https://cnnespanol.cnn.com/video/apagones-venezuela-mecanismo-control-incapacidad-resolver-racionamiento-electricidad-jorge-alejandro-rodriguez-entrevista-serbia-dinero/
Más apagones en Venezuela, ¿mecanismo de control o incapacidad para resolver?
El Gobierno de Venezuela extendió la suspensión de actividades laborales y escolares. Además, estableció un plan de racionamiento de electricidad por 30 días. La discusión con Jorge Alejandro Rodríguez, ingeniero electricista y exvicepresidente de generación y transmisión de energía en la empresa venezolana Cadafe.
Por Xavier Serbiá, CNN Publicado a las 22:21 ET (02:21 GMT) 1 abril, 2019
https://cnnespanol.cnn.com/video/venezuela-juan-guaido-inmunidad-lkl-osmary-hernandez/
Venezuela: El oficialismo cierra el cerco en torno a Juan Guaidó
Mientras el Tribunal Supremo de Justicia de Venezuela instruyó a la Asamblea Nacional Constituyente para que retire la inmunidad parlamentaria a Juan Guaidó, quien se declaró presidente interino del país, este asegura que todo forma parte de una persecución política. En tanto, para algunos juristas, la disposición contra Guaidó es ilegítima porque la Asamblea Nacional Constituyente no está autorizada para ejecutar el mandato del alto tribunal de justicia.
Por Osmary Hernández, CNN Publicado a las 06:46 ET (10:46 GMT) Martes, 2 abril, 2019
https://cnnespanol.cnn.com/video/juan-guaido-inmunidad-venezuela-nicolas-maduro-tribunal-camilo-sot/
¿Por qué quieren quitarle la inmunidad al presidente de la Asamblea Nacional de Venezuela?
Orlando Viera Blanco, embajador de Juan Guaidó en Canadá, expresa que el tribunal supremo de Venezuela, al tratar de quitarle la inmunidad al presidente de la Asamblea Nacional, lo que está haciendo es un acto de provocación para tratar de detener lo que a su juicio es incontenible, el cese de la usurpación.
Por Camilo Egaña, CNN Publicado a las 00:10 ET (04:10 GMT) Martes, 2 abril, 2019
https://cnnespanol.cnn.com/video/juan-guaido-fabiana-rosales-entrevista-fernando-del-rincon-conclusiones/
Fabiana Rosales: “Nunca he imaginado a Juan encarcelado”
Fabiana Rosales, esposa de Juan Guaidó, presidente de la Asamblea Nacional y reconocido como presidente interino de Venezuela por más de 50 países, le responde a Fernando del Rincón si se ha imaginado a su esposo detenido. Del Rincón recuerda los casos de los opositores Leopoldo López, Daniel Cevallos y Enzo Scarano.
Por Fernando del Rincón, CNN Publicado a las 23:23 ET (03:23 GMT) 1 abril, 2019
https://cnnespanol.cnn.com/video/venezuela-precariedad-hospitales-sin-electricidad-pkg-osmary-hernandez/
Venezuela: precariedad en los hospitales por las fallas en el servicio eléctrico
Una serie de videos que circulan por las redes sociales muestra el estado de precariedad de decenas de pacientes en el hospital Luis Gómez López en Barquisimeto, Venezuela, afectados por los apagones de electricidad. Se trata de imágenes sensibles, que CNN no ha podido aún confirmar de forma independiente. En algunos videos se relatan las duras condiciones que enfrentan los profesionales de la salud para atender a los pacientes. CNN ha intentado comunicarse con el hospital Luis Gómez López sin éxito. Este miércoles Osmary Hernández visitó un centro de diálisis que no está prestando servicio debido a la interrupción del servicio eléctrico.
Por Osmary Hernández, CNN Publicado a las 15:51 ET (19:51 GMT) 27 marzo, 2019...
Fernando Castro-Chavez shared a memory.
3 Years Ago
Apr 2, 2018, 3:30 PM
Dedico el siguiente escrito a Lidia Ruiz Gomez y famila, por ser mis bienhechores junto a mis padres, de mi próximo libro "Arreolanza": "...retomando la misma escena del gusano que se transforma en mariposa, Arreola nos dice:
“Estoy de acuerdo con la crisálida que resuelve dentro del capullo la aspiración del gusano. ¡Bendita sea la metamorfosis, esa profunda meditación que nos levanta del suelo en las alas efímeras pero resplandecientes de una mariposa!”.
"Creo que la operación enigmática que resuelve un gusano en mariposa, se debe a una reflexión profunda. Esa que todos deberíamos emprender, ensimismándonos. El gusano se arrastra por el suelo, ya sea la superficie de un tallo, de una hoja, de un tronco, o simplemente digamos: el gusano se arrastra a ras de tierra. Pero he aquí que se le ocurre volar. Entonces se ensimisma y se embalsama con su propia sustancia como una momia que se sabe capaz de resurrección. Porque va a brotar de su propio ser material, pero alentado por el espíritu. Como todos nosotros. De allí la meditación profunda. La de Jonás envuelto y luego dado a luz por la ballena, esa masa de nada original que nos devuelve al Todo..."" (Arreola, J. J. Inventario. D.F.: Conaculta, 2002:22, 173)."
Updated Apr 2, 2019, 7:44 AM
Aquí, proféticamente dice Daniel con un corazón quebrantado ante Dios: "(Estamos unidos)... ¡La gloria y la honra, para ti Señor, para ti Dios, rey de los ejércitos!: ¡No hay un ejército que pueda contra ti!: ¡Haz descender tu poder! .... ¡Gracias...!: ¡Gracias Venezuela, y que Dios les bendiga eternamente!" Daniel Habif [Esta es la porción profética y de súplica no traducida por la CNN, y no tomada en cuenta por muchos de esos fariseos cristianos que se sienten destinados a ser como los cangrejos, intentando hundir a su hermano...; las partes con puntos suspensivos son aquellas en las que no alcanzo a entender del todo, como que la conmoción de un espíritu cristiano conmovido hasta las lágrimas hizo que se atragantara en algunas palabras que no me quedaron muy claras...; esta toma incluye las cámaras de los acompañantes de Habif, tales como su esposa y sus colaboradores que llegaron con él... (Se puede apreciar que algunas de las palabras íntimas del profeta, parece que dicen (después de "poder"): "¡Unidos mano a mano!", y otra que no entiendo muy bien pareciera decir: "¡Gracias Gochos!!!"), pero eso, muy breve y cual latido del corazón, ni siquiera se alcanzan a escuchar en esta otra versión...)] |
Aquí, proféticamente dice Daniel con un corazón quebrantado ante Dios: "(Estamos unidos)... ¡La gloria y la honra, para ti Señor, para ti Dios, rey de los ejércitos!: ¡No hay un ejército que pueda contra ti!: ¡Haz descender tu poder! .... ¡Gracias...!: ¡Gracias Venezuela, y que Dios les bendiga eternamente!" Daniel Habif [Esta es la porción profética y de súplica no traducida por la CNN, y no tomada en cuenta por muchos de esos fariseos cristianos que se sienten destinados a ser como los cangrejos, intentando hundir a su hermano...; las partes con puntos suspensivos son aquellas en las que no alcanzo a entender del todo, como que la conmoción de un espíritu cristiano conmovido hasta las lágrimas hizo que se atragantara en algunas palabras que no me quedaron muy claras...; esta toma incluye las cámaras de los acompañantes de Habif, tales como su esposa y sus colaboradores que llegaron con él... (Se puede apreciar que algunas de las palabras íntimas del profeta, parece que dicen (después de "poder"): "¡Unidos mano a mano!", y otra que no entiendo muy bien pareciera decir: "¡Gracias Gochos!!!"), pero eso, muy breve y cual latido del corazón, ni siquiera se alcanzan a escuchar en esta otra versión...)]
Here, I give you my own translation into English of my research book about the reality behind the "Goatsucker", a non "sucker" killer! Hehee: https://fdocc2.wordpress.com/2019/03/24/my-book-trained-canids-formed-the-chupacabras-of-1996-in-mexico-a-journalistic-account-either-in-english-or-spanish-is-here
Updated Mar 24, 2019, 11:45 AM
Después de las tinieblas viene la luz: Una vela se apaga ante las presiones del viento, una linterna alumbra solamente al que la lleva, un foco alumbra de manera estática y artificial, un flashazo es efímero y superficial, pero tú eres cual antorcha resplandeciente en un lugar obscuro, no solamente alumbras para que otros vean: ¡También das calor a las almas desvalidas desde lo alto de tus montañas!: https://www.youtube.com/watch?v=QleBP2xbevQ Daniel Habif exhortando con Cristo a sus hermanos venezolanos, ¡Amén y Amén!; y me pregunto: ¿Alguien más lo está haciendo? Los fariseos cristianos tan sólo azotaron nuestras cabezas con sus pesadas Biblias criticando agriamente nuestro "involucrarnos en la política"; pero no, señores tiranos, no es eso lo que hacemos, es más bien edificar los corazones quebrantados como ustedes jamás lo han hecho: ¡Oh, hombres podridos también en sus altares (como aquel "Nicolás Maduro" de la "capirucha", los que dicen tener el "control" de la verdad, y que dicen solamente ser ellos la "central" de la que procede la revelación; pero: ¡Señoras y señores!, eso más bien: ¡¡Es el diablo metido entre los grupos "cristianos"!!, líderes renacidos pero de un mal obrar ante los grandes ojos de Dios: ¡¡¡De Dios, Quien Está Anhelante de Comunicarse Directamente con todos los Suyos!!!), buscando tan sólo el ser "adorados", pero sin realmente ayudar a otros, sin mover ese "dedote" de su "pesado anillo", al que quisieran que todos los demás nomás se los besaran! Recuerden tiranos renacidos, que lo que se dice en los aposentos, v.gr., en lo secreto de "Mi historia", será también gritado desde las azoteas, y esto lo dice otro renacido con espíritu santo, hastiado de la basura de la religión de los que se dicen no ser una religión, ¡¡¡pero que son y se comportan peores que los más malos líderes políticos!!!
Updated Mar 23, 2019, 1:47 PM
Según los expertos, esta luna llena de hoy (20 de marzo), será la más grande y bella de este año del 2019 (Auuu!!!); dedicado a ella (quien a partir del 30 de Abril del 2019, solamente Dios sabe quien será... pero ha de ser de Él, fuerte y la mejor al cubo para mí, no más, no menos...): https://www.youtube.com/watch?v=oJUGp2cCuu8
AGRADECIMIENTOS
Por Manuel Castro Dávila
Invierno de 1998
Agradezco a las personas
Que disculpan mis
Limitaciones al hablar
Y mi debilidad al caminar.
Agradezco a quienes con una sonrisa
Se detienen a escucharme y platicar
Conmigo deteniendo su prisa.
Agradezco a quienes me permiten
Recordar el pasado para hacerme feliz
Al no sentirme tan solo ni abandonado.
Agradezco a quienes saben
Lo difícil que es para mí encontrar fuerzas
Y sobrellevar mi vida.
Agradezco a quienes con amor me ayudan
Y me alientan a esperar
El final de mi camino.
Por Manuel Castro Dávila
Invierno de 1998
Agradezco a las personas
Que disculpan mis
Limitaciones al hablar
Y mi debilidad al caminar.
Agradezco a quienes con una sonrisa
Se detienen a escucharme y platicar
Conmigo deteniendo su prisa.
Agradezco a quienes me permiten
Recordar el pasado para hacerme feliz
Al no sentirme tan solo ni abandonado.
Agradezco a quienes saben
Lo difícil que es para mí encontrar fuerzas
Y sobrellevar mi vida.
Agradezco a quienes con amor me ayudan
Y me alientan a esperar
El final de mi camino.
Y aquí también, con gran gusto promoviendo el trabajo de mi estimado "Cirilo Cuervo" (pseudónimo), para que lo descarguen gratis: https://web.archive.org/web/20190318141059/https://fdocc.yolasite.com/resources/el%20dia%20cien.pdf (A veces regalar las cosas es mejor que pasar por las pesadillas de la corrupción mexicana al obtener un ISBN, y de esas ratas que jinetean tu dinero, esforzándose por gastárselo en lujos y frivolidades sin devolvértelo a tiempo para tu propia subsistencia, y que no mueven un dedo por ayudar al otro sin que haya lana de por medio, y mucha lana, o de aquellas que incluso te amenazan con meterte "al bote" si publicas cosas basadas en las vidas reales de ellos, etc., cómo en este caso, ¿verdad?; pero lo que es, es, y aquí no es así. Por esto, allí les va esta obra gratis, que es en realidad una de aguda crítica al narco mexicano, de las peores ratas con las que alguien caería: ¡Aaay!). Y aquí, cómo se ven, están mis otras ofertas gratuitas para promover a nuevos valores, lo que en mi propio caso, me ha costado un ojo de la cara, y casi pura gente tranza, ambiciosa, ególatra o convenenciera: https://fdocc.neocities.org/nuevas-voces.htm
Before I had here a re-posted message from the one girl that was and is not, which said: "Lord, You blessed me more than I deserved" (and it was seen the right hand of a male touching with his bent index finger one of those sweet nectar put for the hummingbirds to take, and with a wedding ring in his pinkie) but I decided to replace it with this one that was my last exclusive photo to the woman that decided that to buy a house and to support financially to her parents is more important than her man right now, this is line the 9 of her lines, or so she says, of her termination message given to me on the 30th of April of 2019 in 13 lines: "They are my first priority"; this is what I put on this exclusive photo for her (but no more) this last Sunday 28th of March together with other 7 messages and things: "Sending you and to you only a heartfelt kiss with all that I am for you my Girl!!!", no response was posted by her anymore until her termination letter of the 30th as mentioned (But God has a better one for me, willing to do His will and not the will of men, as God says that the first priority of the couple is her or his partner and NOT her or his earthly parents; so, as I said, I seek for some good christian woman willing to do His will, and He will do!!! So, I am calling on God):📞
Comentarios expertos ante la llegada de Juan Guaidó a Venezuela: https://youtu.be/DzPJb6EXYUA
Updated Mar 4, 2019, 2:18 PM
Aquí está mi estudio más reciente con mi rescate de recortes periodísticos de 1996 acerca de: El mito del "Chupacabras": https://youtu.be/NUtiCSA8KKw
Updated Mar 2, 2019, 9:15 PM
But also, we need to recognize our other brethren believers that have received the suffering from Venezuela in their own houses, with no condition other than the love of Christ, such as my dear brother @[1410933632:2048:Jose Francisco Norambuena Michea] and others, so thanks to @[1422504354:2048:Iona Cheryl Ware] for requesting me to put these bits of a prophetic reality in the eyes of God to the sight of everyone, here the strongest fragments in one, selected by Daniel Habiff himself, prophet of God, of his prophetic message to our dear brethren of Venezuela, to bring peace to their souls, as I request them to speak in tongues over and over!!!: |
But also, we need to recognize our other brethren believers that have received the suffering from Venezuela in their own houses, with no condition other than the love of Christ, such as my dear brother Jose Francisco Norambuena Michea and others, so thanks to Iona Cheryl Ware for requesting me to put these bits of a prophetic reality in the eyes of God to the sight of everyone, here the strongest fragments in one, selected by Daniel Habiff himself, prophet of God, of his prophetic message to our dear brethren of Venezuela, to bring peace to their souls, as I request them to speak in tongues over and over!!!:
So, in this age of the selfish, it is amazing to find hearts as pure to pray in the spirit as the one of @[1422504354:2048:Iona Cheryl Ware], the only one that requested me to put this in bits for the spiritual prayer of the saints, and for the well being of our Christian brethren, in this most needed case of Venezuela, such as @[100001586518633:2048:Ramon Segundo Gimenez Adam], who can tell what went on with his life and the life of his family, to shut the mouths of those desktop cold senseless ideologues, the same @[100000822017172:2048:Nilda Rosa de Arias] and @[1255452814:2048:Amaury Rodriguez] and hundreds more of my friends of Venezuela, suffering of the injustice, the lies, and the intervention of the Cuban para-military bullies, and of terrorists of other countries against the people of Venezuela, and at the service of an usurper (and of his senseless bullies) contrary to the goodness of his people! This is the message of the Christian J. L. R. to the Soldiers of his nation, Venezuela: "Not to shoot with bullets of guns and rifles against their own fellow citizens"!!!: |
So, in this age of the selfish, it is amazing to find hearts as pure to pray in the spirit as the one of Iona Cheryl Ware, the only one that requested me to put this in bits for the spiritual prayer of the saints, and for the well being of our Christian brethren, in this most needed case of Venezuela, such as Ramon Segundo Gimenez Adam, who can tell what went on with his life and the life of his family, to shut the mouths of those desktop cold senseless ideologues, the same Nilda Rosa de Arias and Amaury Rodriguez and hundreds more of my friends of Venezuela, suffering of the injustice, the lies, and the intervention of the Cuban para-military bullies, and of terrorists of other countries against the people of Venezuela, and at the service of an usurper (and of his senseless bullies) contrary to the goodness of his people! This is the message of the Christian J. L. R. to the Soldiers of his nation, Venezuela: "Not to shoot with bullets of guns and rifles against their own fellow citizens"!!!:
Dear @[1422504354:2048:Iona Cheryl Ware], this is the other very present and needed, when our Christian Mexican prophet Daniel Habiff sheds the love of God into the current hearts of the suffering saints of Venezuela, from a prophetic message directly from the Heart of God, where God says that His Love is sufficient!!!: |
Dear Iona Cheryl Ware, this is the other very present and needed, when our Christian Mexican prophet Daniel Habiff sheds the love of God into the current hearts of the suffering saints of Venezuela, from a prophetic message directly from the Heart of God, where God says that His Love is sufficient!!!:
My very dear sister in Christ @[1422504354:2048:Iona Cheryl Ware] loves Venezuela, and asks me to make it easier (than the way the FB does its things), for her to link the briefer than 20 seconds stories that I have been putting thus far, regarding our common love and spiritual support for our dearest believers and brethren of Venezuela; so, here is the most needed one today, where the Christian singer José Luis Rodríguez, "El Puma", asks our brethren in the military from Venezuela: "Not to harm their own blood!!!": After at least seven shouts for freedom of the people, hundreds of thousands living there away from Venezuela, in this case in Colombia, due to the unlawful usurpation of a heartless dictator (God, make the scales in the eyes of the Military of Venezuela to fall; so, open their eyes to help their own!!! I pray this in the powerful name of Christ, and for this I speak in tongues daily until the good deal is done!): |
My very dear sister in Christ Iona Cheryl Ware loves Venezuela, and asks me to make it easier (than the way the FB does its things), for her to link the briefer than 20 seconds stories that I have been putting thus far, regarding our common love and spiritual support for our dearest believers and brethren of Venezuela; so, here is the most needed one today, where the Christian singer José Luis Rodríguez, "El Puma", asks our brethren in the military from Venezuela: "Not to harm their own blood!!!": After at least seven shouts for freedom of the people, hundreds of thousands living there away from Venezuela, in this case in Colombia, due to the unlawful usurpation of a heartless dictator (God, make the scales in the eyes of the Military of Venezuela to fall; so, open their eyes to help their own!!! I pray this in the powerful name of Christ, and for this I speak in tongues daily until the good deal is done!):
And now, finding those nostalgic and hidden songs in the movie "Roma", here is one: https://www.youtube.com/watch?v=LakYAyz2PXU
Updated Feb 26, 2019, 10:23 PM
Aquí tenemos las palabras de nuestro valorado hermano cristiano José Luis Rodríguez, el Puma, en el Venezuela Aid, y una parte mínima de la entrevista que sostuvo un día antes con Patricia Ramos, la de "Realidades en Contexto", de la CNN: https://youtu.be/e1nFPeluxjA Él agradece a Dios por su sanidad, ¡pide a los soldados que sí son de Venezuela que por favor no lastimen más al pueblo que se supone que deberían de proteger!, y pide a Dios el poder ver con sus propios ojos antes de morir, así como lo hacían los grandes profetas de antaño: ¡¡¡La liberación de su pueblo!!!, menciona a Cristo y al poder del santo espíritu, y dice que ahora anhela interactuar más con los que le aprecian, por lo que no estaría mal que le mandaran una línea de afecto y de apoyo cristiano:
Updated Feb 25, 2019, 3:37 PM
Two Mexican movie-director winners of the Oscars walking together, Guillermo del Toro (2018 for "The Shape of Water") and this year Alfonso Cuarón (2019 for "Roma"):
El profeta Daniel Habif profetiza la caída de Nicolás Maduro Moros: https://youtu.be/51qbNr0ujsE
Updated Feb 22, 2019, 9:34 PM
Updated Feb 22, 2019, 5:37 PM
Aquí tenemos a dos reportes televisivos tempranos acerca del "Chupacabras" en Jalisco: Amacueca y Tlajomulco de Zúñiga, los cuales sirven de entrada para la lectura crítica que espero hacer acerca de los artículos que preservé del periódico de aquella época: https://youtu.be/X_3dYlJUs0Q Máxime ahora que una bella Zapotlense está involucrada en este año en la filmación fantástica y entretenida de dicha historia (además de que se está haciendo la segunda parte de la película animada para niños acerca del mismo tema; es decir que aquello sigue dando centavos, ¿verdad?).
Updated Feb 21, 2019, 9:34 PM
And now (Y ahora), that I am recovering old files and memories (que estoy recuperando viejos archivos y memorias), me encuentro con este que me motivó a estudiar las Ciencias Naturales (I found this one that motivated me to study the Natural Sciences) a una edad temprana (at an early age), these are my fragments of a longer very good, but old and somehow deceptive, documentary (éstos son mis fragments de uno más largo, muy bueno, aunque antiguo y algo engañoso, documental), pero espero les impresione como a mí me impresionó cuando era niño (but I hope this impresses you as it did to me when I was a child): https://youtu.be/0AU2WPJgGp0
Juan Luis Guerra, el pez dominicano, nuestro cristiano hermano, se añade al evento por el que estamos orando (y más se van agregando a cada día que pasa): https://web.archive.org/web/20190216142559/https://www.elheraldo.co/mundo/el-22-de-febrero-sera-el-concierto-por-la-libertad-de-venezuela-en-cucuta-597907 Para que salga en paz, pues Dios quiere que se arrepienta el pecador y no que muera, a no ser que el pecador mismo no lo desee y prefiera morir en su mentira (refiriéndonos aquí, a la vida eterna, pues la otra: de cualquier forma tal vez ya esté perdida), ya que como antes se veía: https://web.archive.org/web/20190203010750/https://www.infobae.com/opinion/2019/01/10/la-ilegitimidad-de-maduro/ No se trata, como dicen algunos (incluyendo al farsante mismo)..., de un deseo imperialista por echarlo fuera, sino de un deseo de todos los seres de bien del planeta para que se salga aquello que está podrido y para que quede lo bueno (si no, pregúntenles a los mismos ciudadanos de aquel país de entre aquellos millones que lo han abandonado y que son nuestros hermanos en Cristo, incluyendo a aquellas que se han prostituido para poder sobrevivir en el extranjero 🙁). ¡Ah! Y para que a continuación caiga también "el liderazgo", largo tiempo corrupto, de aquel país malsano que lo está ayudando, y a quien ese cerdo sobrealimentado (me refiero al "nicolaitano" de moros, aquel que le muestra al mundo su total inmadurez con cada palabra, con cada berrinche, y con cada dancilla que él hace) está ayudando también ¡a pura costa de su propio pueblo!
This one was presented to me by...., may my children praise the Lord from their hearts all the days of their lives, no matter what, as I do, and more!: https://www.youtube.com/watch?v=5UNOaxLiHbg
Actualizo aquí la lista con todos los programas: https://www.youtube.com/watch?v=eixw8OPFggM&list=PLqrr904uU50ehpVE8d2jEIZHUUIk3-G3J Uno de los hallazgos que más alegría me han dado es el de encontrarme con éstos cassettes de nuestro primer programa Radiofónico de Aída Cristina Castro Chávez y un servidor Fernando Castro-Chávez, ¡niñas y niños dejo con ustedes nuestro programa radiofónico infantil "Tragedia": https://youtu.be/eixw8OPFggM, antes de que el "Ecocidio" existiera, comencé a transmitir a mis diez años y mi hermanita tenía tan sólo cinco añitos!!! Es por eso que al principio no se le entiende gran cosa... Heheee, pero les aseguro que al paso del tiempo su voz fue aclarándose al punto de ganar todos los concursos anuales de recitación en el Instituto de la Vera-Cruz mientras que yo estudiaba en el Anáhuac cercano.
Updated Feb 7, 2019, 1:22 PM
https://fdocc.neocities.org/nuevas-voces.htm Es el nuevo espacio en mi sito en el que anhelo personalmente promover de forma bilingüe a esos escasos y nuevos valores de la literatura contemporánea que son capaces de sacudir a las almas que les leen con sus vidas y con sus escritos, comenzando con el buen pariente J. Manuel Chávez B., poniendo un fragmento de su obra en inglés y en español:
Updated Feb 4, 2019, 3:23 PM
Fernando Castro-Chavez recommends Mariscos Fili.
Mariscos Fili
Ayer disfrutamos en familia de sus ceviches: Del promocional de la casa, el de pescado, el de marlín y el de camarón, lo cual estuvo delicioso; disfrutamos de la oportunidad de intercambiar de todos estos excelentes sabores, por lo cual, una vez más recomiendo ampliamente a estos "Mariscos Fili" en Zapotlán el Grande, por ser altamente saludables y de muy buena y fresca calidad.
Fernando Castro-Chavez likes a link.
MP3 to MIDI -- Bear Audio online toolhttps://www.bearaudiotool.com/mp3-to-midi
The pleasure to control again what I say and the way I need to say it!!!
Updated Jan 15, 2019, 11:44 PM
"Elegía" ("Elegy"): https://youtu.be/NRWdpzvkojM (para el pasado: for the past) y "Plegaria" ("Orison"): https://youtu.be/gB4jP3J16GM (para el futuro: for the future), para ella, la que sabe que soy para ella (for her, who knows that I am for her). And here again, I am happy to be back to where I can post everything in detail about everything I want as when Geocities was around!: https://fdocc.neocities.org/ Taking control again of all the aspects of my publications online!!!
Recordando en su centenario a otra escritora que fuera mi instructora: https://youtu.be/7DWquyr8qms
Updated Dec 28, 2018, 8:17 AM
The best friend ever!!! He never turns his back on us, he never cuts his friendship towards us from his pages, he never murmurs against us, no matter what, he never puts us down as if we were second or third class humans, or as if we were bad or unworthy people: Where is the forgiveness that most Christians sing on Sundays but forget the rest of their lives when a real opportunity arrives for real and for big?? Well, only our good Christ does that perfectly and timely!!! So, what a real and, most of my times only friend oh Jesus, most blessed friend!!! (When y'all have already forgotten me r cutting me, he stills there loving me with his tender, embracing and open arms to hug me over and over again!!! (Furthermore, he does not cheat you, deceive you, con you, or just talks by chance not feeling or meaning what he says, he is not selfish or egotistic to keep for himself the goods or the resources, no! He shares bountifully and very lovingly with every one of us, and millions and millions more...)
Updated Dec 23, 2018, 11:16 PM
HARA, éste es tu video de apertura: https://www.youtube.com/watch?v=zHwPuvPVzIw
Updated Dec 23, 2018, 10:14 PM
"...fin y paradero de las letras (y no hablo ahora de las divinas, que tienen por blanco llevar y encaminar las almas al cielo, que a un fin tan sin fin como este ninguno otro se le puede igualar: hablo de las letras humanas, que es su fin poner en su punto la justicia distributiva y dar a cada uno lo que es suyo)... la paz, que es el mayor bien que los hombres pueden desear en esta vida. Y, así, las primeras buenas nuevas que tuvo el mundo y tuvieron los hombres fueron las que dieron los ángeles la noche que fue nuestro día, cuando cantaron en los aires: «Gloria sea en las alturas, y paz en la tierra a los hombres de buena voluntad»*; y a la salutación que el mejor maestro de la tierra y del cielo enseñó a sus allegados y favoridos, fue decirles que cuando entrasen en alguna casa dijesen: «Paz sea en esta casa»; y otras muchas veces les dijo: «Mi paz os doy, mi paz os dejo; paz sea con vosotros», bien como joya y prenda dada y dejada de tal mano, joya que sin ella en la tierra ni en el cielo puede haber bien alguno."(* "a los hombres de buena voluntad" en el griego es literal: "para con los hombres buena voluntad": "en anthropois eudokias"; esto lo publicó Miguel de Cervantes Saavedra en 1605, la versión Reina Valera en castellano había salido en 1569, mientras la King James en inglés salió en 1611, con una mejor traducción de esto, diciendo: "buena voluntad para con los hombres", es decir: "good will toward men", lo que está más cercano al griego: ¡La buena voluntad de Dios en Cristo Jesús está sobre todos los seres humanos, no sólo sobre aquellos que son santurrones o buenazos!!! Hehee).
"...Cristo le hablaba y Pablo respondía:
—Este —dijo don Quijote— fue el mayor enemigo que tuvo la Iglesia de Dios Nuestro Señor en su tiempo y el mayor defensor suyo que tendrá jamás: caballero andante por la vida y santo a pie quedo por la muerte, trabajador incansable en la viña del Señor, doctor de las gentes, a quien sirvieron de escuelas los cielos y de catedrático y maestro que le enseñase el mismo Jesucristo... Ellos conquistaron el cielo a fuerza de brazos, porque el cielo padece fuerza, y yo hasta agora no sé lo que conquisto a fuerza de mis trabajos; pero si mi Dulcinea del Toboso saliese de los que padece, mejorándose mi ventura y adobándoseme el juicio, podría ser que encaminase mis pasos por mejor camino del que llevo." Miguel de Cervantes Saavedra (1615, fallecido en 1616; de entre el tan escaso accesso a las cosas de las Escrituras en castellano por aquellos tiempos sin Escrituras debido a aquel decreto "Eclesiástico" diabólico que exigía que se leyesen tan sólo en latín... ¿cuánto más podemos hacer ahora que las tenemos a la mano en nuestro idioma?):
—Este —dijo don Quijote— fue el mayor enemigo que tuvo la Iglesia de Dios Nuestro Señor en su tiempo y el mayor defensor suyo que tendrá jamás: caballero andante por la vida y santo a pie quedo por la muerte, trabajador incansable en la viña del Señor, doctor de las gentes, a quien sirvieron de escuelas los cielos y de catedrático y maestro que le enseñase el mismo Jesucristo... Ellos conquistaron el cielo a fuerza de brazos, porque el cielo padece fuerza, y yo hasta agora no sé lo que conquisto a fuerza de mis trabajos; pero si mi Dulcinea del Toboso saliese de los que padece, mejorándose mi ventura y adobándoseme el juicio, podría ser que encaminase mis pasos por mejor camino del que llevo." Miguel de Cervantes Saavedra (1615, fallecido en 1616; de entre el tan escaso accesso a las cosas de las Escrituras en castellano por aquellos tiempos sin Escrituras debido a aquel decreto "Eclesiástico" diabólico que exigía que se leyesen tan sólo en latín... ¿cuánto más podemos hacer ahora que las tenemos a la mano en nuestro idioma?):
Biblical fun (as private files):
https://www.youtube.com/watch?v=OomNpPFlpKo
https://www.youtube.com/watch?v=2IO3jKziBIY
https://www.youtube.com/watch?v=VY8vCBAff3o
https://www.youtube.com/watch?v=FLhjpUQrNRU
https://www.youtube.com/watch?v=iicjwoJ9XXA
https://www.youtube.com/watch?v=gZjjXuzAD54
https://www.youtube.com/watch?v=gZjjXuzAD54
https://www.youtube.com/watch?v=ClCBbQb92JA
I lost two due to lack of space in my machine (in case someone has them):
Lost: May 2015 Music Festival Friday Evening-mp4
Lost: May 2015 Music Festival Sunday Evening Part 1.mp4
But at least, thank God that we as believers are not lost!
In Christ, Fern.
https://www.youtube.com/watch?v=OomNpPFlpKo
https://www.youtube.com/watch?v=2IO3jKziBIY
https://www.youtube.com/watch?v=VY8vCBAff3o
https://www.youtube.com/watch?v=FLhjpUQrNRU
https://www.youtube.com/watch?v=iicjwoJ9XXA
https://www.youtube.com/watch?v=gZjjXuzAD54
https://www.youtube.com/watch?v=gZjjXuzAD54
https://www.youtube.com/watch?v=ClCBbQb92JA
I lost two due to lack of space in my machine (in case someone has them):
Lost: May 2015 Music Festival Friday Evening-mp4
Lost: May 2015 Music Festival Sunday Evening Part 1.mp4
But at least, thank God that we as believers are not lost!
In Christ, Fern.
Updated Dec 19, 2018, 3:45 PM
Este es mi segundo homenaje a Emma Godoy, escritora y humanista, de 1989; esta versión me gusta bastante ya que alterno sus propias palabras inspiradas, de una conferencia que presentó en Tlaquepaque en 1985 (nos llevó el señor Javier Ochoa Godoy, quien en paz descanse, papá de @[547248063:2048:Miguel Angel Ochoa] a quien Emma Godoy pareciera aludir en uno de sus escritos que aquí se leen, al hablar de aquel sobrino amante empedernido de lo natural y de la naturaleza, allí en el min. 20:43) y que le grabara yo: https://youtu.be/vMeAtFutMiQ Este es el primer homenaje que le hiciéramos en aquella misma semana: https://www.youtube.com/watch?v=EIxfodv7rkY
Updated Dec 14, 2018, 5:25 PM
Y aquí, damas y caballeros, tenemos a otra maravilla histórica: https://youtu.be/lscaUW1vuZk, unos fragmentos selectos del "Homenaje a Arreola" inmediato a su deceso en el 2001 (descubierta por afinidad temática del YT al video otorgado por @[100001113782301:2048:Héctor Ag]), la he editado integrando seis de estos fragmentos: dos en Guanajuato sobre Cervantes y sus caudillos: Don Quijote y Sancho, dos en España acerca de Dulcinea y los molinos de viento y dos en Tabasco, acerca de Pellicer y de la selva, con una bella declamación de uno de sus poemas por Rosenda, espero les guste esta integración que muestra claramente el hablar inspirado espontáneo de Arreola al que yo le llamo: Una "Arreolanza"!!! De nuevo, esperando que no nos lo tumben en el YouTube, y más bien lo valoren como algo educativo y literario debido al Centenario de Arreola, que ya declina...
Updated Dec 13, 2018, 8:28 PM
Pues: ¡aquí está ese gran programa, para ir culminando nuestras celebraciones del Centenario de ese gran escritor y educador que fuera Juan José Arreola, mi preceptor juvenil número uno!: https://youtu.be/jIx4tQcum6Y Esperamos nos dejen retenerlo; @[100001113782301:2048:Héctor Ag], siendo él quien lo grabó inicialmente, ha sido vital en todo este celebrar, lado a lado conmigo a este gran zapotlense: ¡Muchas gracias!
Updated Dec 12, 2018, 9:31 PM
Este ha sido un año, en su mayoría, lleno de bellas personas y de bellos lugares y sobre todo de bellísimas actividades (sin un centavo pero con mucha riqueza interior): ¡Muchas gracias par todas esas personas con un gran corazón: Las que nos ayudan a crecer y a crecer en las cosas que nos son eternas y permanentes, las que no utilizan al prójimo para sus propios fines, las que perdonan cuando cometemos algún error y viceversa, las que nos dan esperanza, comenzando por mis padres, y luego por mis parientes más cercanos, como mis hermanas y los suyos, es decir, todas las personas que son fieles a los suyos y que me enseñan, como yo lo quiero ser cuando los tenga: una buena dama cristiana ¡e hijitos! (Y sigo en contacto con aquella de aquellas islas), y finalmente: ¡Las que nos acercan, como aquel gran educador que celebramos durante todo este año, y que aquí seguimos celebrando, las que nos acercan, pero no las que nos alejan de Dios!!! |
Este ha sido un año, en su mayoría, lleno de bellas personas y de bellos lugares y sobre todo de bellísimas actividades (sin un centavo pero con mucha riqueza interior): ¡Muchas gracias par todas esas personas con un gran corazón: Las que nos ayudan a crecer y a crecer en las cosas que nos son eternas y permanentes, las que no utilizan al prójimo para sus propios fines, las que perdonan cuando cometemos algún error y viceversa, las que nos dan esperanza, comenzando por mis padres, y luego por mis parientes más cercanos, como mis hermanas y los suyos, es decir, todas las personas que son fieles a los suyos y que me enseñan, como yo lo quiero ser cuando los tenga: una buena dama cristiana ¡e hijitos! (Y sigo en contacto con aquella de aquellas islas), y finalmente: ¡Las que nos acercan, como aquel gran educador que celebramos durante todo este año, y que aquí seguimos celebrando, las que nos acercan, pero no las que nos alejan de Dios!!!
You tagged Jose Alejandro Juarez Gonzalez
Otro gran periódico, de buena calidad en su papel, el de Héctor Ag, ha retomado la historia de nuestro evento: Aquí vemos a Say Renrod con Alex Barragán Sánchez, y a Fernando Castro-Chavez, con Carlos Axel Flores Valdovinos y Pedro Mariscal; aquí también vemos a Cayetano Chavez Villalvazo participando activamente en al menos tres eventos...:
Libro: "Memoria y olvido: vida de Juan José Arreola, 1920-1947". AUTOR: Juan José Arreola (ya que él lo dictó, como fue el caso mismo del "Bestiario" que Arreola le dictara a José Emilio Pacheco). Editor: Fernando del Paso (¡y así lo reconoce Del Paso mismo!, como se verá en el siguiente fragmento del excelente video documental de "J.J.A. el Gn. Fab.", video próximo a aparecer aquí en su totalidad para culminar con este centenario, si es que así lo permiten sus editores; además, ese era uno de los que, como el "Bestiario", Arreola tenía el propósito de hacer él mismo, como se observa en las solapas de sus libros rojos de Joaquín Mortiz). Pero entonces, lo mismo sucedería con el siguiente Libro de los: "Apuntes de Arreola en Zapotlán": AUTOR: Juan José Arreola (ya que éste fue quien también dictó todo lo que allí aparece). Editor: Vicente Preciado Zacarías. Es decir, que al final del centenario esto nos llega, ante los balones navideños: ¡Como un gran alfiler!..., ¿qué les parece? [Luego traté de agregar una foto adicional y no pude, por lo que la pongo por debajo de esto como un primer comentario, en mi página del Fb; y es que el Fb, como que te dice: "Si ya no agregaste una foto la primera vez después de tu video, pues ya te...." Hehee.
Entre mis viejos discos de 33 RPM, también me encontré con otro de los grandes de la trova tapatía: Alberto Escobar, compositor de la perenne pieza de "Coincidir": https://www.youtube.com/watch?v=0brjMZzN6D0, quien también tuviera yo el honor de que me dedicara un álbum; aquí está el resto de sus composiciones como aparecen hasta el momento en el YT: https://www.youtube.com/channel/UCjjJJWqu3GCXiJ45B1Jzvjw
Y, en abriendo las cajas de esos viejos discos de 33 RPM que nos quedaron, me encuentro con esta gran y verdadera joya, de que: "¡Nada vale más que la libertad!" de Paco Padilla: https://www.youtube.com/watch?v=LQ0WHOWDlaU Dedicada a toda la familia por el gran Paco Padilla y algunos de sus colaboradores; ¡aquí está el resto de ese bello álbum como todos los que él, artesano de Tlaquepaque, sabe moldear!: https://www.youtube.com/playlist?list=OLAK5uy_nij6iW06A7sFEgYXEU1PvYuZ5ZSi_7Kqs y sus otras bellas composiciones: https://www.youtube.com/channel/UC-UOhJ2KaRpsPn2TWgCy9aA ¡Nunca buscando la fama o el dinero: Siempre buscando el permanecer auténtico a su conciencia; así es el Paco Padilla que yo conocí...!!!
You tagged Cesar Cosio and Cesar Cosio II
Otro rescate extraordinario es de la música de Huéhuetl, de Dn. Isaac Borcegui: https://youtu.be/tn8qEzTCrg0 (musicalización de la "Loa al Divino Narciso" (de 1689), que antecede al de nuestra musa de oro: Da. Sor Juana I. de la C.) , de la que tocaron en aquel concertazo que organicé en "Las Piedrotas" de Tapalpa junto con el gran musicólogo, máster de eventos y DJ Cesar Cosio II y mi hermanita la Ady, en el que además tocaron personalidades tan tremendas como el Paco Padilla, el fallecido músico pre-hispanista Jorge Reyes, Solea con ex-compañeros Blaess y Córdova, ¡hasta el vocalista de Montana andaba por allá así como grandes intérpretes de la música clásica que complementaron los sonidos con sus etéreas atmósferas, además de aquellos enormes "Sky Trackers" del Gleason! Entonces, de ntros. grandes eventos, sierra arriba o p´arriba: Este de "Las Piedrotas" en aquel entonces, literalmente que: ¡se robó la barda!
You tagged Héctor Ag, Cayetano Chavez Villalvazo, Carlos Axel Flores Valdovinos, Ernesto Eufracio Mendoza, Ernesto Mendoza, Say Renrod, Pedro Mariscal, Martín Adalberto Sánchez Huerta and Pablo Baron
Y, ¡gracias muchas a nuestra admirable pianista y cantante Say Renrod (y: ¿cómo olvidar al también gran pianista (y tenor) Ocampo Guisa?), me he enterado de que acaba de salir la reseña de nuestro último proyecto "Arreolanzante" de este bello centenario de Arreola que nos fue el memorable 2018 en Zapotlán!: http://www.periodicoelsur.com/noticias_guzman.aspx?idnoticia=110975: ¡Muchas gracias a todos esos buenos amigos que de buen gusto participaron, incluyendo al señor Guillermo Gómez Vázquez quien nos recitó cosas de Arreola y de Jiménez, así como a nuestros notables asistentes, entre otros: Javier Silva Sánchez, Oscar Aguiar, Alex Barragán Sánchez, mis honorables padres Manolo y Cris, Adriana Cecilia Vargas Alzaga, ah! Y me acabo de acordar de Fausto Avila, etc.!
Otra recuperación maravillosa para mí es la lectura rasa y llana: ¡En una hora: De cinco inefables Epístolas del apóstol Pablo, de cuando yo tenía 20 años! (Otras que yo vaya encontrando las iré poniendo aquí), con todo mi amor para todos aquellos de mis lectores que aman a Cristo con un corazón genuino independiente de toda organización o institución hecha por hombres: https://youtu.be/J_yl9eaUP2o Escuchemos a Efesios, Filipenses, Colosenses y a 1 y 2 de Tesalonicenses en la voz de este otro joven que alguna vez fuera yo mismo!!!:
Updated Dec 9, 2018, 10:34 AM
Y, éste es un rescate más de cassettes de hace 11 años, cuando andaba yo de profesor por Puerto Vallarta: https://youtu.be/KIIXWZXq5ac
Updated Dec 8, 2018, 11:16 AM
Otra recuperación del pasado es esta de Mireya Cabeza de Vaca al piano y voz; con su mamá de soprano en algunas canciones (además de que, como nos dice Conchita: Su perico de cabeza de oro está también cantando en imitación de la soprano!!!), y con mi tío Vicente Castro Dávila cantando: https://youtu.be/mfS7XJUkpdc (el papá de @[100026866131782:2048:Terry Kstro]; y Mireya fue quien también le diera clases al gran poeta del fino cincel @[601357307:2048:Julio César Aguilar])
Updated Dec 7, 2018, 6:37 PM
¡Mi más reciente rescate! A mis 15 años: Mi lectura del "Apocalipsis", y mi perenne tendencia artística de fusionar melodías con la voz: https://youtu.be/4S5mf4fBrqQ
Updated Dec 6, 2018, 4:16 PM
Otra recuperación extraordinaria fue aquella en la que convergieron en mi casa: ¡Bernardo Colunga, compositor de Guadalajara, y Josep-Maria Balanyà, su contraparte de Barcelona!; y aquí están, improvisando a cuatro manos (de cuando juntos tocaron en el mismo piano)!!!: https://youtu.be/8Z-ZUAEyems
Otro hallazgo de oro fue cuando el catalán @[100009658908980:2048:Josep-Maria Balanyà] I'Rossel (a quien agradezco mucho su nueva amistad en el Facebook!!!: Gracias Josep!!!) y yo, @[100001280559168:2048:Fernando Castro-Chavez], improvisamos un jazz piano - verbal en mi casa (1987): https://youtu.be/fEcx7qncUx4, otros miembros de "Los Escribiados" asistieron... pero luego pongo el tremendo dueto a cuatro manos que se aventó Joseph con nuestro mentor musical: ¡Bernardo Colunga!, ¡y la melodía ecológica de Josep que incluye el canto de las ballenas! Por lo pronto, aquí los dejo con la página de Josep, quien sigue igual que cuando yo lo conocí, por allá por la capital del país: http://www.balanya.net/ Esta pieza es "Prehispanía o Nuestras Raíces", que es una "Arreolanza" Fernandiana aunada a un buen jazz Balanyano (la grabadora estaba más cerca del piano que de mi voz, perdón):
Updated Dec 4, 2018, 11:03 PM
Éste es otro de mis rescates de viejos cassettes, mi entrevista a Jacquie Francis, de Colombia, reina de 1983 de la U.A.G., para nuestro ensayo acerca de la juventud, apartado acerca de los: "Jóvenes extranjeros en México": https://www.youtube.com/watch?v=ja8iHTlEqw8 , me acompaña el buen amigo José de Jesús Torres Delgadillo, quien por los negocios de su padre, de estar estudiando ingeniería, se metió a una banda de "mariachi".
Updated Dec 3, 2018, 12:03 PM
Aquí tienen, con mucho cariño (finalmente me tomé el tiempo de hacerla para ustedes; ¡Ah!, y los comentarios a mi "Arreolanza" que se ven abajo, han sido puestos en mi sitio de Amazon (en donde me gustaría trabajar cuando llegue al norte, ¡Dios primero!): https://www.amazon.com/gp/product/172000000X), la versión dos de esa bella entrevista que nos hicieran Didí Sedano y @[100000864140573:2048:Arely Ruiz], a un servidor @[100001280559168:2048:Fernando Castro-Chavez] y a @[1586841892:2048:Say Renrod], cuando fuimos a promover la apertura de la "Cátedra de Literatura y Artes Guillermo Jiménez", yo mediante mi "Arreolanza", ella mediante su canto al difícil "Soneto a Sara" como lo musicalizara Hermilio Hernández ("era él compositor de música clásica, pero no era cantante, por lo que nos la puso muy difícil a nosotros que cantamos", señaló Say con sus palabras después de habérnosla cantado en tiempo real, al vernos desconcertados) y otras piezas de compositores clásicos mexicanos; profusamente ilustrada con valiosos materiales que conservo: https://youtu.be/ClW8pz1VC0M (incluida, para aquellos con ojos para ver, una comparación lado a lado de las 20 adulteraciones de "La feria" entre la versión original de 1963 y la versión roja de 1971, ambas por Joaquín Mortiz, bajo a dirección de Diez-Canedo):
Updated Dec 1, 2018, 8:55 PM
Por aquel entonces César Padilla Padilla, alias "El Condorito" (quien se parecía al joven César Costa, por allá por la U.A.G.), amigo también de la familia, de los hermanos, de @[677633308:2048:Adriana Hernandez Padilla], amiga de la familia, de mi hermanita (a quien también le diera uno o el único famoso de "Cars" que también me gustó), me presentó con un cassette del cantante y que contenía su siguiente canción la que fue mi favorita del mismo: https://www.youtube.com/watch?v=hQz59wxSFJY, cuya letra está aquí: https://www.letras.com/silvio-rodriguez/370040/; por lo que me dio mucho gusto el verlo hoy al lado de su esposa. Ahora, y releyendo, como Arreola nos recomendaba, el bello texto de @[753715328:2048:Carlos Axel Flores Valdovinos] a mi "Arreolanza", redescubro algo que la primera vez me pasó de noche, y es eso de cómo Silvio se apropió de algo que dijo otro: y ¡esto es la cultura!: "Silvio Rodríguez gustaba decir: “Hay hombres que luchan un día y son buenos, hay hombres que luchan un año y son muy buenos, hay hombres que luchan muchos años y son mejores, pero hay quienes luchan toda la vida, esos, esos son los imprescindibles” (Bertolt Brecht)."
Updated Dec 1, 2018, 1:27 PM
A otro gran artista que tuvimos el placer de tener en nuestro programa radiofónico de "Ecocidio" de 1989, es el cantautor de música folk y con un mensaje @[716908166:2048:Paco Padilla], del https://www.facebook.com/pg/PacoPadillaOficial/posts/ quien nos deleita aquí con dos canciones tremendas: "Déjalo que fluya" y "Chapala": https://youtu.be/jHRyPo4Fd_Q y https://youtu.be/K8ptrnTPxfY, en aquel entonces nos acompañaba Jorge Sahagún González en la cabina: ¡Muchas Gracias Gran Paco Padilla, por tu gran corazón y por tu perdón!!!
Updated Nov 29, 2018, 3:08 PM
Más novedades del evento final en el que participé presentando mi libro y solicitando la interpretación del "Soneto a Sara", además del "encore" que fue el de: "Estrellita de lejano cielo", entre otras bellamente interpretadas, como "Duérmete mi niño" con música de Blas Galindo (quien aprendí que era descendiente de nuestras tribus huicholas!!!), me parece, y otra tipo villancico navideño en clásico por otro compositor mexicano, con el canto de Say Renrod, y al piano, alguien quien es también tenor, especializado en Música Sacra, y venido desde Guadalajara: Héctor Miguel Ocampo Guisa, y la honrosa presencia de @[452197281485967:274:Alejandro Barragán], @[753715328:2048:Carlos Axel Flores Valdovinos] y @[100002661245981:2048:Pedro Mariscal], entre otros: ¡Muchas Gracias a todos los que participaron!: https://www.facebook.com/renteriasay/posts/10216320618399880
Updated Nov 29, 2018, 12:27 PM
You tagged Carlos Axel Flores Valdovinos and Pedro Mariscal
Luego, Carlos Axel Flores Valdovinos hace un maravilloso y conmovedor ensayo filosófico literario de 17 grandes hojas en las que analiza capítulo por capítulo de manera clara y penetrante, con frases hermosas como las siguientes (aparte de las innumerables y nuevas palabras que él acuña a partir de Arreola, tales como las siguientes: "Arreolerías", "De arreolística", "arreolecto", "arreolante", "arreolización", etc.): ""La Clase de Arreola" parte desde un método valorativo e interpretativo que permite lograr una:
1) Sistematización científica,
2) Belleza estética literaria, y
3) Preocupación espiritual.
Libro con formato de clase, esto es, con carácter pedagógico... es un estudio pedagógico, moral y religioso dedicado a la investigación literaria para descubrir valores altamente humanos y espirituales a partir de la Biblia como Libro Universal que nos da la llave de entrada al paraíso y al infierno terrenal de Arreola. Por su variedad de géneros, la lectura y exégesis bíblica nos permite contrastar las diferentes fuentes a las que acudió Arreola en busca de salvación y sofrosine: "Arreolanza rima con Bienaventuranza"... Leer para llegar a ser buenas personas. Instruirse moralmente. Leer la Biblia para imitar a los prodigios humanos de esa fauna celestial: santos, ángeles, arcángeles, serafines, hasta llegar a la auténtica imitación de Cristo. La lectura se vuelve lectiofanía o revelación que lleva a la conversión espiritual... Arreola recomendaba leer los mejores libros: La Biblia como miscelánea de géneros literarios nos enseña a descubrir la "varia invención". "El cantar de los cantares" inspiró a muchos hacia una vida espiritual, conversión estética... El palíndroma es una filosofía del quiasma..." (Luego nos entrega Axel siete asombrosos palíndromas como los siguientes (¡y me sorprende, cómo la más frecuente “invertiva” de los siete palíndromas de Axel es la de ARREOLAR “palindromizada” como RALOERRA en alguna de sus variantes!), pongo un ejemplo, el más largo de Axel, de su "Palindromario" (pero omito yo los acentos, al estilo gramatical antiguo, como para extremar la “palindromía” dada):
"ADANNISERARREOLATICOOCITALOERARRESINNADA"
Axel incluso mejora una expresión que yo recordé de Arreola, dándole él una propia extensión artística, al suave decir filosófico de Axel:
"Lo "útil" es una categoría que en el caso del arte no tiene cabida, habría que decir mejor que seleccionar es distinguir y reconocer aquello valioso o afectivo"
¡Excelente!, digo yo con toda humildad, y como Arreola habría aceptado esa corrección, ahora también la acepto yo... (lo mismo señalé y sabiamente Axel notó cuando me esforcé en mi libro por profundizar en el entender del espíritu divino en el hombre de manera bíblica: ¡siendo éste una implantación (para usar una palabra arreolina) sobrenatural dada por Dios al tú recibir a Cristo como tu señor (es el recibir "los genes espirituales")!, colocándolo así por encima de esa idea solamente natural del pensar en ello cómo si fuera tan spolo un talento superior más propio de los varones que de las mujeres, que es lo que a mi parecer parecen concluir tanto Arreola como su discípulo primado de Zapotlán…) Y Axel prosigue diciendo: El "Manual del Caballero Cristiano" es el libro de Erasmo que trajo consigo bajo el hábito franciscano evangelizador de Zapotlán: ¡Francisco de Sayavedra! Luego, sabiamente nos dice Axel: "El valor educativo de la Arreolanza consiste en: Aprender a desaprender para reaprender"... Arreola, nos dice bellamente Axel, fue: "siempre fiel a sus convicciones, creencias y valores, espíritu inquieto por saber, reconoce su ignorancia, es una ignorancia docta... Arreola es uno de los hombres más imprescindibles de la literatura mexicana. Luego cita los dos textos inéditos que me encontré al momento de publicar mi libro, el de "La voz" que en el centro bellamente dice:
"...indecible poesía / ¡Suma de tanta energía! / La palara limpia y suave / En que todo sueño cabe..."
- "Aw", y con un gestito de gatuna bebé diría alguna amiguita americana que ya perdí, ¡al escuchar algo así de bello en inglés!; y del otro de "La luz del sol", que termina tan bellamente como yo deseo terminar este hermoso texto de Axel, ¿y he repetido lo suficiente qué es muy bello y expansible, sus 17 grandes hojas son tan sólo cómo ¡esbozos de cosas más grandes y largas y más profundas!? (y Arreola conocía y se sabía de memoria, nos decía, algo que podía reproducir al estar acostado a punto de dormirse: ¡¡¡cada piedra de la calle que daba a su casa!!!, ¡antes de que "mataran" las piedras del camino que recordaba Arreola, al cubrirlas con cemento!!!):
"...Sobre las oscuras piedras de la calle / Pasa ondulante y turbia la corriente / Sugiriendo rumorosa la pendiente / ¡Que marcan los declives de mi valle!""
¡Muchas Gracias, Axel, por el tan bello y reflexivo texto! Fernando Castro Chávez.
1) Sistematización científica,
2) Belleza estética literaria, y
3) Preocupación espiritual.
Libro con formato de clase, esto es, con carácter pedagógico... es un estudio pedagógico, moral y religioso dedicado a la investigación literaria para descubrir valores altamente humanos y espirituales a partir de la Biblia como Libro Universal que nos da la llave de entrada al paraíso y al infierno terrenal de Arreola. Por su variedad de géneros, la lectura y exégesis bíblica nos permite contrastar las diferentes fuentes a las que acudió Arreola en busca de salvación y sofrosine: "Arreolanza rima con Bienaventuranza"... Leer para llegar a ser buenas personas. Instruirse moralmente. Leer la Biblia para imitar a los prodigios humanos de esa fauna celestial: santos, ángeles, arcángeles, serafines, hasta llegar a la auténtica imitación de Cristo. La lectura se vuelve lectiofanía o revelación que lleva a la conversión espiritual... Arreola recomendaba leer los mejores libros: La Biblia como miscelánea de géneros literarios nos enseña a descubrir la "varia invención". "El cantar de los cantares" inspiró a muchos hacia una vida espiritual, conversión estética... El palíndroma es una filosofía del quiasma..." (Luego nos entrega Axel siete asombrosos palíndromas como los siguientes (¡y me sorprende, cómo la más frecuente “invertiva” de los siete palíndromas de Axel es la de ARREOLAR “palindromizada” como RALOERRA en alguna de sus variantes!), pongo un ejemplo, el más largo de Axel, de su "Palindromario" (pero omito yo los acentos, al estilo gramatical antiguo, como para extremar la “palindromía” dada):
"ADANNISERARREOLATICOOCITALOERARRESINNADA"
Axel incluso mejora una expresión que yo recordé de Arreola, dándole él una propia extensión artística, al suave decir filosófico de Axel:
"Lo "útil" es una categoría que en el caso del arte no tiene cabida, habría que decir mejor que seleccionar es distinguir y reconocer aquello valioso o afectivo"
¡Excelente!, digo yo con toda humildad, y como Arreola habría aceptado esa corrección, ahora también la acepto yo... (lo mismo señalé y sabiamente Axel notó cuando me esforcé en mi libro por profundizar en el entender del espíritu divino en el hombre de manera bíblica: ¡siendo éste una implantación (para usar una palabra arreolina) sobrenatural dada por Dios al tú recibir a Cristo como tu señor (es el recibir "los genes espirituales")!, colocándolo así por encima de esa idea solamente natural del pensar en ello cómo si fuera tan spolo un talento superior más propio de los varones que de las mujeres, que es lo que a mi parecer parecen concluir tanto Arreola como su discípulo primado de Zapotlán…) Y Axel prosigue diciendo: El "Manual del Caballero Cristiano" es el libro de Erasmo que trajo consigo bajo el hábito franciscano evangelizador de Zapotlán: ¡Francisco de Sayavedra! Luego, sabiamente nos dice Axel: "El valor educativo de la Arreolanza consiste en: Aprender a desaprender para reaprender"... Arreola, nos dice bellamente Axel, fue: "siempre fiel a sus convicciones, creencias y valores, espíritu inquieto por saber, reconoce su ignorancia, es una ignorancia docta... Arreola es uno de los hombres más imprescindibles de la literatura mexicana. Luego cita los dos textos inéditos que me encontré al momento de publicar mi libro, el de "La voz" que en el centro bellamente dice:
"...indecible poesía / ¡Suma de tanta energía! / La palara limpia y suave / En que todo sueño cabe..."
- "Aw", y con un gestito de gatuna bebé diría alguna amiguita americana que ya perdí, ¡al escuchar algo así de bello en inglés!; y del otro de "La luz del sol", que termina tan bellamente como yo deseo terminar este hermoso texto de Axel, ¿y he repetido lo suficiente qué es muy bello y expansible, sus 17 grandes hojas son tan sólo cómo ¡esbozos de cosas más grandes y largas y más profundas!? (y Arreola conocía y se sabía de memoria, nos decía, algo que podía reproducir al estar acostado a punto de dormirse: ¡¡¡cada piedra de la calle que daba a su casa!!!, ¡antes de que "mataran" las piedras del camino que recordaba Arreola, al cubrirlas con cemento!!!):
"...Sobre las oscuras piedras de la calle / Pasa ondulante y turbia la corriente / Sugiriendo rumorosa la pendiente / ¡Que marcan los declives de mi valle!""
¡Muchas Gracias, Axel, por el tan bello y reflexivo texto! Fernando Castro Chávez.
You tagged Carlos Axel Flores Valdovinos and Pedro Mariscal
Foto del gran profesor y poeta Pedro Mariscal, cuyo video se ha actualizado aquí: https://youtu.be/TPZ5WPkAZio, y quien nos deleitó con una excelente presentación, con la escritura y dedicatoria de dos poemas (con fecha del 27 de nov., 2018), a la obra de "Arreolanza", y a su autor, su servidor, Fernando Castro-Chavez, los que a saber son los siguientes (una bella décima):
Arreolanza
Por Pedro Mariscal
Es Fernando Castro Chávez
Un hombre propositivo
Que piensa en aumentativo
Las lecciones que una vez
Aprendiera como un pez.
Arreola, arreolar y lanza,
Que se escucha en lontananza
Una tremenda arreolina,
Es la lengua parlanchina...
¡Las lecciones de Arreolanza!
Y un "Soneto a un alumno de Arreola"
Por Pedro Mariscal
Juan José nunca hubiese imaginado
Que un alumno brillante escribiera
Un libro que sus clases reuniera
Para quienes su obra han admirado.
A la distancia del tiempo, hoy aquí,
En esta casa de recuerdos gratos,
Donde recopilo todos los datos
Que pongo en mi Arreolanza para tí.
Este fiel homenaje al centenario
De un natalicio al que brotaran alas
Por la magia de tu verbo literario
Es la múltiple voz...
[Desgraciadamente aquí la tinta de la impresora se acaba y no se ve el resto del último terceto de nuestro estimado Pedro Mariscal; me dijo Pedro, en un correo reciente, que más bien está en proceso; entonces, en cuanto esté completo, aquí lo pongo: ¡Gracias!]
Además de esto, en su análisis, algo que ya no leyó es su propia décima que aparece en su "Decimario Arreolino", la cual dice así:
Juan José Arreola
Por Pedro Mariscal
Publicó “Confabulario”,
“La Palabra Educación”,
Redactó “Varia Invención”,
Y con su libro “Bestiario”
Fue tejiendo su “Inventario”.
Escribir es cosa seria
Y no andar en periferia…
Arreola con “Palíndroma”
No estaba en osas de broma,
Pero a mí… ¡dénme “La feria”!
Y me impresiona tremendamente que, en la selección de Pedro Mariscal, el poeta, éste elige un poema del gran Pellicer, de los varios que éste le dedicara a Arreola, y que incluyo en mi "Arreolanza" y que Orso Arreola Sanchez pusiera en "El último juglar"; humildemente, el ya para entonces consagrado Carlos Pellicer, le dice a Arreola, como todos nosotros, alumnos suyos, le diríamos: "Estoy atento a lo que tú señalas", y luego Pellicer reconoce la belleza del hablar de Arreola, al terminar ese último terceto de ésta, tan bella manera: "...si en un instante la belleza instalas", wow, wow, wow, que un gigante como Pellicer para la poesía reconociera todo esto en Arreola, me maravilla gratamente y me motiva a seguir en un futuro, adelante con mis infinitos estudios y observaciones a la obra interminable de Arreola, en su hablar y en su escribir... Y también, ¡se destaca la tremenda humildad de Arreola!, quien, aunque los grandes le escribieran grandes cosas como éstas, él seguía tan humilde como cualquiera de nosotros!!! ¡Ah-"men"...! (Así hemos de seguirlo siendo todos, sin esas vanidades tontas de aquellos que se creen ser los alumnos únicos del gran Arreola (aquellos de sus alumnos que aprovechándose de algún puesto público, "engrandecieron" por sí mismos su propio nombre y su propia obra, ¡abusando del buen nombre de Arreola!), jejeee).
Arreolanza
Por Pedro Mariscal
Es Fernando Castro Chávez
Un hombre propositivo
Que piensa en aumentativo
Las lecciones que una vez
Aprendiera como un pez.
Arreola, arreolar y lanza,
Que se escucha en lontananza
Una tremenda arreolina,
Es la lengua parlanchina...
¡Las lecciones de Arreolanza!
Y un "Soneto a un alumno de Arreola"
Por Pedro Mariscal
Juan José nunca hubiese imaginado
Que un alumno brillante escribiera
Un libro que sus clases reuniera
Para quienes su obra han admirado.
A la distancia del tiempo, hoy aquí,
En esta casa de recuerdos gratos,
Donde recopilo todos los datos
Que pongo en mi Arreolanza para tí.
Este fiel homenaje al centenario
De un natalicio al que brotaran alas
Por la magia de tu verbo literario
Es la múltiple voz...
[Desgraciadamente aquí la tinta de la impresora se acaba y no se ve el resto del último terceto de nuestro estimado Pedro Mariscal; me dijo Pedro, en un correo reciente, que más bien está en proceso; entonces, en cuanto esté completo, aquí lo pongo: ¡Gracias!]
Además de esto, en su análisis, algo que ya no leyó es su propia décima que aparece en su "Decimario Arreolino", la cual dice así:
Juan José Arreola
Por Pedro Mariscal
Publicó “Confabulario”,
“La Palabra Educación”,
Redactó “Varia Invención”,
Y con su libro “Bestiario”
Fue tejiendo su “Inventario”.
Escribir es cosa seria
Y no andar en periferia…
Arreola con “Palíndroma”
No estaba en osas de broma,
Pero a mí… ¡dénme “La feria”!
Y me impresiona tremendamente que, en la selección de Pedro Mariscal, el poeta, éste elige un poema del gran Pellicer, de los varios que éste le dedicara a Arreola, y que incluyo en mi "Arreolanza" y que Orso Arreola Sanchez pusiera en "El último juglar"; humildemente, el ya para entonces consagrado Carlos Pellicer, le dice a Arreola, como todos nosotros, alumnos suyos, le diríamos: "Estoy atento a lo que tú señalas", y luego Pellicer reconoce la belleza del hablar de Arreola, al terminar ese último terceto de ésta, tan bella manera: "...si en un instante la belleza instalas", wow, wow, wow, que un gigante como Pellicer para la poesía reconociera todo esto en Arreola, me maravilla gratamente y me motiva a seguir en un futuro, adelante con mis infinitos estudios y observaciones a la obra interminable de Arreola, en su hablar y en su escribir... Y también, ¡se destaca la tremenda humildad de Arreola!, quien, aunque los grandes le escribieran grandes cosas como éstas, él seguía tan humilde como cualquiera de nosotros!!! ¡Ah-"men"...! (Así hemos de seguirlo siendo todos, sin esas vanidades tontas de aquellos que se creen ser los alumnos únicos del gran Arreola (aquellos de sus alumnos que aprovechándose de algún puesto público, "engrandecieron" por sí mismos su propio nombre y su propia obra, ¡abusando del buen nombre de Arreola!), jejeee).
Guillermo Gómez Vázquez nos deleitó, en la apertura de la "Cátedra de Literatura y Artes Guillermo Jiménez", con el fragmento del más bello paisaje de "La feria" de Arreola: https://youtu.be/cF0iC1RPDEM: "Si camino paso a paso...", F97 (Nota: En mi caso, voy a ir subiendo poco a poco los videos que grabó mi querida prima @[100000186697386:2048:Adriana Cecilia Vargas Alzaga], de nuevo porque tengo saturada mi Laptop y no le cabe mucho espacio...)
Updated Nov 28, 2018, 4:00 PM
Fernando Castro-Chavez
WOW, ¡Aquí están ya las tremendas porciones transmitidas en vivo por la amable esposa de @[100002661245981:2048:Pedro Mariscal], ¡quien nos hizo el grande honor de acompañarnos!, a pesar de andar algo delicadita de la garganta: ¡Muchas Gracias!, aquí aparecen: @[753715328:2048:Carlos Axel Flores Valdovinos], @[100001285408353:2048:Martín Adalberto Sánchez Huerta], @[1124336937:2048:Cayetano Chavez Villalvazo], @[100001113782301:2048:Héctor Ag], un servidor: @[100001280559168:2048:Fernando Castro-Chavez], y otros : https://www.facebook.com/pedro.mariscal.14/videos/1881851581913532/, https://www.facebook.com/pedro.mariscal.14/videos/1881868878578469/ y
https://www.facebook.com/pedro.mariscal.14/videos/1881875705244453/
https://www.facebook.com/pedro.mariscal.14/videos/1881875705244453/
Updated Nov 28, 2018, 2:37 PM
Quiero también agradecer muy especialmente a Alonso Sánchez de la @[379458532405366:274:Casa Taller Literario Juan José Arreola Oficial] por todo su apoyo al lado de @[100002561415109:2048:Gabriela Rodriguez] y de @[1792443196:2048:Orso Arreola Sanchez], ya que en este Sabático mío en honor a Arreola que está terminando, me fue posible gozar de tres tremendos eventos en ese mismo lugar en el que Arreola me enseñaba (aparte del inicial en la Casa de la Cultura de la que Arreola fuera su primer director, y de la Casa del Arte del nombre de uno de los alumnos locales de Arreola, acompañando y gracias a @[637658944:2048:Juan Manuel Sánchez Ocampo] y a Axel, y del muy grato organizado por @[753715328:2048:Carlos Axel Flores Valdovinos] y por @[685364361:2048:Sergio Fong] en Guadalajara en honor a ese "Arreola de Zapotlán" junto con @[100000528796934:2048:Octavio Ricardo Hernández Hernández] quien nos exploró en "El soñado"), comenzando con mi presentación de la "Otra lectura de "La feria" por sus viñetas" en el "XI Coloquio Arreolino", hasta la de ayer de la presentación de mi "Arreolanza" junto con @[100002661245981:2048:Pedro Mariscal], que a pesar del problema de salud de su esposa: ¡ambos nos acompañaron!, y de Axel, al lado de la Cátedra Gmo. Jmz. y de la premier del "Soneto a Sara" (versión de 1945 a cargo de Sahily Rentería y su acompañante al piano), con @[100001285408353:2048:Martín Adalberto Sánchez Huerta] como el Maestro de ceremonias, pasando por la presentación de "La Gaceta Literaria" en la que hablamos con el corazón @[601357307:2048:Julio César Aguilar] y un servidor acerca de Arreola; aquí, gracias las fotos de Alonso fue posible preservar este momento intermedio previo a la gran final, con @[1124336937:2048:Cayetano Chavez Villalvazo] y @[100001113782301:2048:Héctor Ag] al frente, acompañados de un servidor, @[100001280559168:2048:Fernando Castro-Chavez]: https://www.facebook.com/permalink.php?story_fbid=751073158577233&id=379458532405366 aunado al imperfecto video que pude rescatar de la misma: https://www.youtube.com/watch?v=1RwH_U-whBg&t=5s Hay muchos más nombres por agradecer que a su debido tiempo se mencionarán (cuando abra espacio en mi saturada Laptop para poder subir lo de ayer, jejee, ya que esto no fue lo de ayer sino lo de antier!!!)
Updated Nov 28, 2018, 8:39 AM
Recordándoles de nuevo a todos aquellos amigos que nos deseen acompañar mañana al último evento del Centenario de aquel gran profesor y educador e instructor que tuviera yo y del que sigo aprendiendo, de sus escritos, de sus palabras: ¡Arreola! Allí van a estar todos esos seres estimados y admirados de esta mi estancia de honra sabática: Héctor Ag, el organizador; Cayetano Chavez Villalvazo, el que inaugurará la Cátedra G. Jiménez; Pedro Mariscal y Carlos Axel Flores Valdovinos que harán comentarios pertinentes a esta obra de "Arreolanza" que como toda clase se perfecciona día tras día (y por mi parte espero más bien hablar poco...); luego viene como que el deleite más grande para mí: ¡El escuchar por primera vez ese "Soneto a Sara" de Arreola musicalizado por H. Hernández y que yo anduviera buscando por todos lados durante casi todo el año!, gracias a la gentileza artística de la gran Sahily Rentería y su colega al piano M. A. Navarro (no, ese... se rajó (después de que imprimimos 500 volantes con su... nombre), ya lo acabo de reemplazar de mis copias electrónicas hoy 1ero de dic., el que salió al frente con todo el valor fue el tenor Héctor Miguel Ocampo Guisa, bendiciones a éste), como el dueño del lugar en el que el músico nació, quien señaló en su video, anexado abajo, que ¡tiene su homenaje al lado del de Santana! Agradezco a Oscar Fajardo Velasco y a Gabriela Rodriguez junto con Orso Arreola Sanchez, por hacer posible éste mi sueño de culminar mis labores sabáticas con este bello homenaje: ¡No nos falten, por favor! Y ahorita que está el Héctor aquí conmigo, me acaba de decir que el maestro de ceremonias de nuestro evento, accedió a ser Martín Adalberto Sánchez Huerta: ¡Muchas gracias estimado escritor y artista!
Otro rescate tremendo para mí: Nuestro homenaje a Emma Godoy con la visita al programa de mi entrañable @[1302692969:2048:Mónica Do] y su hermano Héctor: https://youtu.be/EIxfodv7rkY, Con la interface de Emma con José Clemente Orozco, así como aquella entre "La Estampida" de Jorge de la Peña y Luis Alonso Schökel, comentando el evento organizado por Juan Morales de la Garza. Sobrino y amigo de esa gran mujer y mío es @[547248063:2048:Miguel Angel Ochoa], a quien mando un gran saludo ¡desde por acá por el Zapotlán de Arreola! (Cabe señalar que aún la música instrumental de ese programa fue cuidadosamente elegida para darle una atmósfera especial, por allá por los 1989s, me parece que se trata de un Vangelis).
Updated Nov 26, 2018, 5:02 PM
El Apocalíptico "30 Minutos", es otro de mis rescates del exitoso programa "Ecocidio" que dirigí en 1989 (en "Promomedios de Occidente", Guadalajara, MX), y es éste: https://youtu.be/2H-UWQG9pAw, en el que se observa la promoción musical, otro aspecto importante del mismo, y de "Los Escribiados", que eran los invitados principales; aquí tenemos una gran composición e interpretación de @[2135235720096563:274:Gerardo Ochoa Music], acompañado por @[1183464292:2048:Victor Velasco Neri]; otros bellos rescates de los mismos son: https://www.youtube.com/watch?v=wvuwKxecmG0, https://www.youtube.com/watch?v=w0Q_o22efmQ, https://www.youtube.com/watch?v=ywQHYtV3k-0 y https://www.youtube.com/watch?v=MB8eCMMkmGo; la voz que los presenta es la de mi colaborador principal en aquel programa: Juan Morales de la Garza.
Updated Nov 26, 2018, 8:44 AM
Muy emocionado estoy de que finalmente pude rescatar aquel programa dedicado a Juan José Arreola en 1989: https://youtu.be/5fqP6sKwYmM, de mi serie de "Ecocidio", que yo dirigía en el entonces "Radio Ser" (que era la "Triple B": "BBB", de "Promomedios de Occidente"), en un programa tremendo con la participación de mi amada hermana menor, y con la del siempre talentoso filósofo y escritor, entre muchas otras cosas más: Juan Morales de la Garza, a quien desde aquí mando mis más gratos saludos; además de la imponente y gran voz del locutor. Espero que esto les despierte el interés por temas tan bellos y tan profundos como a todos ellos... (Entonces dirigía a toda esa cadena de radio: "Raúl Frías Lucio").
Updated Nov 25, 2018, 4:26 PM
Y, gracias a @[100001113782301:2048:Héctor Ag], quien se contactó con Martha Meza Hernández, sobrina del gran compositor Hermilio Hernández López, y esposa de un tío de Héctor; aquí tenemos: https://youtu.be/MJZVAAxjFos a una primicia mundial de su "Homenaje póstumo" del 2008, éstas "Siluetas", a diez años de su deceso y en vísperas de la otra premier universal, la de la talentosa Say Renrod y de M. A. Navarro al piano tocando el "Soneto a Sara" de Arreola (1943) musicalizado por Hermilio (1987) este martes que viene en la @[379458532405366:274:Casa Taller Literario Juan José Arreola Oficial] gracias a la gentileza de usar este lugar en el que Arreola mismo me enseñara tantas cosas tan perennes, por parte de su hijo @[1792443196:2048:Orso Arreola Sanchez]: Este martes 27 de nov. a las 7:30 PM: ¡los esperamos allí, no falten para ver esta premier musical extraordinaria con muchas otras cosas más!!! Todo esto en el marco de la "Cátedra Guillermo Jiménez" y de la presentación de mi "Arreolanza"... Agradezco también la amistad de @[100001159919230:2048:Oscar Fajardo Velasco], alumno de Hermilio y director de la "Casa de la Cultura" de Zapotlán el Gde. que también fundara Arreola!!!
Updated Nov 25, 2018, 7:57 AM
Fernando Castro-Chavez wrote on a timeline.
Nov 23, 2018, 1:54 PM
Pongo aquí el fragmento clave de mi entrevista con Arreola de 1983: https://youtu.be/nQgduHnKBt0
Updated Nov 22, 2018, 4:47 PM
You tagged Eduardo Azuri Miranda, Victor Velasco Neri, PufleaCorrea Francisco José Zenón and Charly Carlos Vzqz
Buscando otras cosas, me encontré con esto, así como algunas de mis obras que fueran expuestas en aquel entonces, hoy perdidas, aquí desglosadas para no perderlas aún más: http://www.hndm.unam.mx/consulta/resultados/visualizar/558a3b417d1ed64f1703e276 Fernando Castro-Chavez en 1987. En la portada, debajo de nuestros nombres, dice: "El Arte Joven al Servicio de la Comunidad"
You tagged Héctor Ag, Cayetano Chavez Villalvazo, Carlos Axel Flores Valdovinos, Say Renrod and Pedro Mariscal
Rediseñando mi presentación para meterle colores a "Mi Historia", con ese programa de animación a las fotos: Vemos a Pedro Mariscal, a Carlos Axel Flores Valdovinos, a un servidor Fernando Castro-Chavez, a Cayetano Chavez Villalvazo y Héctor Alfonso Rodríguez Aguilar (Héctor Ag), Sahily Rentería (Say Renrod en la voz y a su excelente colaborador: Héctor Miguel Ocampo Guisa, al piano).
From Nov 27, 2018, 7:30 PM to Nov 27, 2018, 10:30 PM
Vayan al evento final de mi Sabático para celebrar a mi mejor profesor: Arreolita!!!: https://www.facebook.com/events/767380310267084/
Updated Nov 19, 2018, 2:24 PM
From Nov 27, 2018, 7:30 PM to Nov 27, 2018, 10:30 PM
Vengan a este último evento antes de mi partida al norte para honrar con nosotros a mi mejor educador: Juan José Arreola Zúñiga:
Updated Nov 19, 2018, 2:20 PM
You tagged Héctor Ag, Jesús Juárez, Cayetano Chavez Villalvazo, Fausto Avila, Julio César Aguilar, Say Renrod and Martín Adalberto Sánchez Huerta
Amados lectores y observadores, parientes y amigos, aquí está mi video: https://youtu.be/1RwH_U-whBg (perdón pero casi todo es del lomo mío) de nuestro magno evento de la presentación de "La Gaceta Literaria" en el "Día Mundial de la Filosofía", organizado por Héctor Ag, del Cefyt Mauricio Beuchot, con la siempre grata presencia de mi pariente Cayetano Chavez Villalvazo, y un servidor, Fernando Castro-Chavez, además de la brillante participación de Jesús Juárez, y de mi conocer a la gran artista Say Renord y su acompañante, que finalmente hará una realidad mi final y magno sueño de presentar por vez primera de su partitura original, este martes 27 desde las 7:30 PM, y de escuchar el "Soneto a Sara" de 1943 de Juan José Arreola, entre otras piezas magistrales, en la Casa Taller Literario Juan José Arreola Oficial, gracias a la gentileza de Orso Arreola Sanchez, de Gabriela Rodriguez, de Alonso Sánchez y de don Fco. de Gorgonio; este sería mi magno y final evento... mucho les encargo, oh seres admirables: ¡A estos seres admirables que han sido mis padres! Mis intenciones antes de eso serían las de acompañar a Didí Sedano en su excelente "Textoservidoras" del viernes 23... Atentamente, Fernando.
Después de un año de andarla buscando, finalmente gracias a Sergio Fong, me fue posible el encontrar la partitura del bello Soneto de 1943 de Arreola (también conocido como el "Soneto a Sara") que le musicalizara Hermilio Hernández López; en caso de que alguien lo pueda interpretar y grabármelo... (¡Sí, milagrosamente hoy, en nuestra presentación de Héctor Ag, de Cayetano Chavez Villalvazo y de un seguro servidor Fernando Castro-Chavez (y sí, en cuanto la tenga en el YT la pongo aquí abajo como comentario para todos ustedes), nuestra admirable y nueva amiga Say Renrod nos dijo que podía interpretarla junto con otro amigo al piano, ¡alabado sea Dios!, por lo que si desean escuchar la primicia universal de este "Soneto" arreolísimo musicalizado y ejecutado, supongo yo que por primera vez en la historia, los esperamos el 27 de este noviembre desde las 7:30 PM en el mismo lugar!!!: Casa Taller Literario Juan José Arreola Oficial, en donde también daremos lanzamiento a nuestra "Cátedra Guillermo Jiménez", con la presentación formal de mi librote "Arreolanza o La Clase de Arreola", con los atinados comentarios críticos y edificantes de Carlos Axel Flores Valdovinos y del honorable educador Pedro Mariscal), para ¡que más alumnos de Arreola seamos capaces de escucharlo...!: https://www.facebook.com/TastersOfTheWord/posts/2169727916382966
You tagged Víctor Manuel Pazarín, Pedro Mariscal and Martín Adalberto Sánchez Huerta
Algunas de las fotos de nuestro viaje a la "IX Feria del Libro Antiguo y Usado", desde Zapotlán, yendo a celebrar al célebre escritor de Zapotlán Arreola, con su escultura en "La rotonda", junto a otros 28 más; y después de un viaje placentero con Pedro Mariscal y con Martín Adalberto Sánchez Huerta, además de Brian, ¡fue muy grato saludar a Víctor Manuel Pazarín!
Updated Nov 12, 2018, 3:20 PM
Amable lector: Realidad ¿o mito?, eso de que Arreola "En alguna ocasión invitó a Guadalajara al adolescente Bobby Fischer" (http://www.wikimexico.com/articulo/el-otro-arreola) ¿por dónde comenzar?... (he pedido ayuda a algunos como Juan Manuel Sánchez Ocampo, Biblioteca Juan Jose Arreola, Orso Arreola Sanchez, etc.; para aproximarnos a resolver este enigma, del que no se dan ni las fechas precisas ni las referencias...), lo que tenemos en la red es lo siguiente, todo anecdótico, sin una referencia periodística o una crónica para Guadalajara: 1) De la UNAM nos dicen: "En sus tiempos como promotor del deporte-ciencia organizó encuentros de trascendencia internacional. Incluso, en los sesenta, trajo a nuestro país a Bobby Fischer, hasta ese momento campeón de Estados Unidos": http://www.dgcs.unam.mx/boletin/bdboletin/2010_722.html 2) Luego una cubana señala, con respecto a Cuba: "Organizó Torneos e invitó a destacados ajedrecistas nacionales y extranjeros, entre ellos, el campeón mundial de ajedrez Tigran Petrosian, el subcampeón Pauel Kerez y Bobby Fischer, entonces campeón de ajedrez de Estados Unidos": http://adligmary.blogspot.com/2013/09/juan-jose-arreoladestacado-escritor-y.html 3) Incluso el Congreso del Estado de Jalisco, como muchos otros sitios, transmite esa información así: "Fue muy aficionado al ajedrez. Esta afición lo llevó a invitar a Guadalajara al adolescente Bobby Fischer, entonces campeón de ajedrez de los Estados Unidos y que después sería campeón mundial", en su serie de Beneméritos, donde dice: Juan José Arreola Zúñiga. Condecoración José María Vigil. Decreto 7051, (al buscar su nombre se viene de golpe un documento en Word): http://congresoweb.congresojal.gob.mx/bibliotecavirtual/legislacion/Benemeritos/Benemeritos.cfm 4) De esos tiempos tenemos el siguiente testimonio: "...cuenta el maestro mexicano Filiberto Terrazas en un artículo publicado en la revista “Jaque Mate”, La Habana, 1966, todo comenzó cuando Fidel y él jugaban tablero por medio. Minutos más tardes a Fidel se unió Tigrán Petrosián de la Unión Soviética, entonces Terrazas pidió ayuda a Fischer que se encontraba cerca. Así se estableció un juego entre 4, por un lado Fidel-Petrosián con blancas y por el otro Terrazas-Bobby. Al final las blancas resultaron las vencedoras": http://www.columnadeportiva.com/2008/11/11/bobby-fischer-en-la-habana/ Por lo pronto, y finalmente, una clave que nos podría aproximar a mi objetivo se encuentra aquí pero no se le pone fecha, uno de mis propósitos investigativos de este viaje que voy a hacer a Guadalajara: 5) Armando Acevedo (¡Y es el único en la red que menciona esto!) dice: “Su presencia era elegante y agradable (en Siegen, Alemania, 1970). Muy diferente a aquella imagen que teníamos de Bobby Fischer cuando vino adolescente a México y que nos fue contada por Raúl Solórzano en una entrevista que le hizo Yolanda Zamora en el Informador de Guadalajara” (¡¡¡pero no nos dice la fecha ni se menciona a Arreola!!!): https://web.archive.org/web/20081012205331/http://aacevedo.galeon.com/AAcevedo/Varios/fischer-70a.htm Es que, como le dije a Orso desde principios del año, yo quisiera que mi último proyecto sabático para celebrar a Arreola, su padre, fuera este de escribir un libro acerca de "Arreola y Fischer", le digo yo: "mi cuarta obra es aún un sueño ajedrecístico acerca de: "Arreola y Fischer"", a lo que Orso nos respondió, e iba yo junto con Héctor Ag a su casa: ¡Que su papá Juan José Arreola estuvo aún en los ochentas en Taxco, Guerrero, entrevistándose y conviviendo con Bobby Fischer, junto con otros comensales en evento privado, durante unos cinco días! ¡WOW! Por mi parte, hasta ahora me he enfocado en preservar los últimos archivos de Bobby Fischer, que he de clasificar y traducir, como parte de mi obra: https://web.archive.org/web/20181111151102/http://fdocc.ucoz.com/index/los_ultimos_archivos_de_bobby_fischer_primer_ajedrecista_mundial/0-143 Así de que Bobby Fischer estuvo cual un chamagoso y grosero adolescente en Guadalajara ¡sí!, ¿pero exactamente cuándo?, ¿y fue a instancias de Arreola?... Atte., Fernando Castro Chávez, post-PhD, escritor, enamorado de MCVR e investigador.
https://www.linkedin.com/feed/update/urn:li:activity:6464492298586640384 ¡Aquí está el programa completo para ese día!: https://www.facebook.com/photo.php?fbid=10158320587185329&set=a.465795645328, cortesía de @[753715328:2048:Carlos Axel Flores Valdovinos]
Updated Nov 3, 2018, 8:27 AM
Fernando Castro-Chavez added 2 new photos to Francisco Cota Mtz's timeline.
You tagged Francisco Cota Mtz and Ana Georgina Romero Cornejo
Van tres del recuerdo para este día, con el gran gusto de haberte saludado a ti y a tu hermosa esposa así como al resto de los colegas y a sus bellas flores; pero esta va dirigida a ese amigo que fue y que siempre ha sido solidario, ya fueran nuestras inquietudes por lo divino, la ayuda al enfermo, o los proyectos terrestres imposibles como éste: "Pet Kotoob", el sueño de salvar a todas esas bestias perdidas (incluyendo a esas bípedas bien..., Jejee), con otra gran amiga y vecina tapatía de toda la vida, la guapa Ana Georgina Romero Cornejo; y no podía faltar una de las que yo cantaba en aquel entonces, que fueran Tejeda y Tulio quienes me la recordaran (y claro, se la canto yo aquí a aquella grata nena filipina de todas mis congojas, Mrs. MCVR): https://www.youtube.com/watch?v=qJlsHyYcWp8 Del amigo Paco Padilla (Siendo esta su versión que más me gusta) ¡Felicidades!
Esta es otra versión: https://youtu.be/1G0E9dZIH3g sobre mi descubrimiento del orden y valor de las viñetas originales de "La feria" de Arreola (incluyendo a dos libros completos, el malo del 95 y el bueno de los 60s), en la entrevista que tuve con el escritor, y ganador de "Los Juegos Florales" de Zapotlán el Grande del 2012 con su sabroso "Tríptico del Cuerpo", @[552591401:2048:Ricardo Sigala], en quien encuentro el orden bidimensional que Arreola usara para un alejamiento de mujeres en "La feria", usado antes por Juan Ramón Jiménez para hablar del alejamiento de un tren (citado por Rivas Sáinz y rescatado por @[753715328:2048:Carlos Axel Flores Valdovinos]), pero esta vez referente, o así lo interpreto yo, a un bello acercamiento tropical que me transporta a mi propio sueño por aquella mujer amada (M.C.V.R.)...; son unos ~8 y 7 espacios hacia la derecha para el inicio de la siguiente línea con respecto al renglón anterior para los últimos dos renglones, respectivamente:
"Vengo al misterio de tus aguas...
Vago errante
^^^^^^^en la caída libre
^^^^^^^^^^^^^hacia tus aguas."
Tomado de: http://www.eslocotidiano.com/articulo/tachas-145/triptico-cuerpo/20160319173738028347.html Poema que después de seis años tuvimos el privilegio de escuchar de su viva voz: https://youtu.be/3oHNGP-aWxw
"Vengo al misterio de tus aguas...
Vago errante
^^^^^^^en la caída libre
^^^^^^^^^^^^^hacia tus aguas."
Tomado de: http://www.eslocotidiano.com/articulo/tachas-145/triptico-cuerpo/20160319173738028347.html Poema que después de seis años tuvimos el privilegio de escuchar de su viva voz: https://youtu.be/3oHNGP-aWxw
Updated Oct 29, 2018, 8:01 AM
En esta montaña rusa, ella ha sido una editora muy paciente, @[100007097824037:2048:Iliana Hijuelos], esposa de uno de mis mejores amigos literarios de la adolescencia, @[566673209:2048:Charly Carlos Vzqz] quien escribe profundos artículos de reflexión para mejorar nuestro país. Sin embargo he suspendido la edición que yo quería de mil tomos a solamente diez más, ya que jamás me llegó el ISBN y yo ya me voy a Filipinas con la mujer que me gusta, estoy por comprar el boleto del vuelo para estar allá en diciembre (al comprarlo un mes antes me sale un poco más barato, y necesito ese dinero que había mandado para el libro para irme con la que quiero que sea mi mujer: MCVR); cualquiera que quiera mi gran librote de "Arreolanza" necesitará comprarlo por Amazon, versión electrónica creo yo (una disculpa por rajarme de este proyecto pero hay prioridades mayores y yo no pude resistir la maldita corrupción y torpeza del manejo de estos asuntos aquí en el país, es por eso que yo ya me voy mucho a la... (¡a la gloria!, eso espero, en otro lugar muy fuera de aquí: Chao, Bye y demás)!): https://www.amazon.com/gp/product/B07H15V6Q2 (Además, cómo dijera personalmente, tampoco desoe dejar nadando a mis papás, que han sido muy valiosos en ayudarme con todo esto, ¡nadando en libros tan gordos!) Y mi versión impresa desde Amazon es esta: https://www.amazon.com/gp/product/172000000X |
En esta montaña rusa, ella ha sido una editora muy paciente, Iliana Hijuelos, esposa de uno de mis mejores amigos literarios de la adolescencia, Charly Carlos Vzqz quien escribe profundos artículos de reflexión para mejorar nuestro país. Sin embargo he suspendido la edición que yo quería de mil tomos a solamente diez más, ya que jamás me llegó el ISBN y yo ya me voy a Filipinas con la mujer que me gusta, estoy por comprar el boleto del vuelo para estar allá en diciembre (al comprarlo un mes antes me sale un poco más barato, y necesito ese dinero que había mandado para el libro para irme con la que quiero que sea mi mujer: MCVR); cualquiera que quiera mi gran librote de "Arreolanza" necesitará comprarlo por Amazon, versión electrónica creo yo (una disculpa por rajarme de este proyecto pero hay prioridades mayores y yo no pude resistir la maldita corrupción y torpeza del manejo de estos asuntos aquí en el país, es por eso que yo ya me voy mucho a la... (¡a la gloria!, eso espero, en otro lugar muy fuera de aquí: Chao, Bye y demás)!): https://www.amazon.com/gp/product/B07H15V6Q2 (Además, cómo dijera personalmente, tampoco desoe dejar nadando a mis papás, que han sido muy valiosos en ayudarme con todo esto, ¡nadando en libros tan gordos!) Y mi versión impresa desde Amazon es esta: https://www.amazon.com/gp/product/172000000X
Aquí está mi más reciente publicación bíblica, dice en la contraportada: "Alguien dijo erróneamente que los ángeles caídos habían quedado atrapados en las aguas que rodean el universo en el que nos encontramos; al explorar cuidadosamente el tema se observa que eso no es cierto, que esos ángeles desobedientes y espíritus encarcelados, lo están bajo las plantas de nuestros pies. ¡Y de allí van a salir en los días del Apocalipsis nueve para infligir juicio sobre la tierra! Éstos se componen de dos grupos: Aquellos que intentaron corromper el genoma humano y aquellos que bajo posesión diabólica intentaron destruir a Noé y a sus hijos. Este libro es un esfuerzo por entender bíblicamente esos hallazgos de calaveras que parecen intermedias entre animales y humanos de los neandertales, H. erectus, australopitecus, etc., pero también nos muestra la realidad de los restos aún visibles de Sodoma y Gomorra en las inmediaciones del "Mar Muerto". Esperamos que esto sea tan sólo el inicio de una búsqueda de la mano de Dios, con el fin de descartar toda esa especulación inútil que es rampante tanto en el mundo religioso como en el científico con respecto a estos temas tan profundos y reales que solamente encuentran su respuesta en las escrituras de la Biblia, y en la consulta directa con Dios. Entonces, no tomen esto como la última palabra, sino solamente como la primera en el tema, por favor, y sigan explorando directamente las maravillas de Dios." En Libro: https://www.amazon.com/dp/1729118631 En Kindle: https://www.amazon.com/dp/B07JM3QGGX El resto de mis libros: https://www.amazon.com/Fernando-Castro-Chavez/e/B07GL44ZYN
You tagged Orso Arreola Sanchez
Aquí estamos en animada conversación el día de mi presentación Orso Arreola Sanchez en la Casa Taller Literario Juan José Arreola, y yo; pero para mí, y dada la importancia de dicha presentación, aquí están algunos de los nexos de la misma, con cinco de sus variaciones y modificaciones (al estilo arreolino; pero aún trabajo en su versión transcrita, y por allí tengo una grabación de práctica que se corta): https://youtu.be/YBfdqg83yVY (éste nexo anterior corresponde a la más completa edición, que incorpora las transparencias con claridad, para ponerles pausa y poder leerlas), https://youtu.be/D1IzC4wZys4 (éstas son mis transparencias solamente con el ritmo romántico de "Bésame mucho" en "sax"), https://youtu.be/ETJtoTdqtc4 (el tremendo trabajo de filmación logrado por Rilj Herschel complementado con video adicional capturado por mí), https://www.youtube.com/watch?v=MCt06SJZLW0 (ésta es mi captura original con "Tablet", apoyada en uno de mis librotes de "Arreolanza", por lo que ese librote ya me fue útil para algo, jejee) y https://www.youtube.com/watch?v=peOw85wX1W0 (éstas son las puras viñetas de Vicente Rojo Almazán en el orden que aparecen en el texto, e incluyendo contiguas a las cinco que aparecen en la portada, con música de "La Bikina" y del "Huapango"); en la segunda foto se observa a la izquierda el perfil de Efrén Rodríguez, quien sería el siguiente presentador después de mí esa noche (del 5 de oct. del 2018, en los "Coloquios Arreolinos"), y la silueta posterior de Gilberto Moreno, químico y escritor, quien me alentara a preparar esta presentación para dichos coloquios desde marzo del presente, es icónica esta segunda foto porque en la pantalla se ve el rostro del autor de las viñetas (Vicente Rojo A.) de "La feria" de Arreola, y a nuestras espaldas la foto de Arreola mismo, el escritor (tomada por Conchita Torres, hija del escritor y fotógrafo Félix Torres Milanés), en fin, como decía Arreola: ¡Sea por Dios!... (y agradezco a Gabriela Rodriguez, y al Sr. Sánchez, porque sin ella y sin ellos ¡yo no hubiera tenido proyector!).
You tagged Carlos Axel Flores Valdovinos and Juan Manuel Sánchez Ocampo
Aquí está la nota de nuestra colaboración para "Las poligrafías de Arreola", gracias al texto y fotografía de nuestra admirable Ariana García, al lado de dos grandes estudiosos de Arreola: https://web.archive.org/web/20181014175834/http://www.cusur.udg.mx/es/noticia/actividades-por-el-centenario-de-arreola-continuan-en-casa-del-arte
From where I dream to go very soon!!!: https://www.facebook.com/flyingkyxz/posts/10216588952732229 The fulfillment of all of those frequent dreams of a personal flight!!!
Updated Oct 14, 2018, 11:24 AM
You tagged Héctor Ag and Vicente Castro
Mi estimado colega Héctor Ag ha publicado uno de mis artículos que describe algo divertido de mi infancia que vivimos mi primo Vicente Castro Samperio y yo, Fernando Castro-Chavez, su servidor, en la grata compañía del gran escritor y educador Juan José Arreola, de quien celebramos su centenario en este año; aquí se encuentra en su totalidad esa historia de niños en PDF: http://fdocc.ucoz.com/7/fdocc_mi_articulo_sotavento_2018.pdf (Acompaño esta historia con "La Pastora" blanca, como se veía ayer por la mañana desde mi azotea).
Este es otro libro conciso que he publicado con mis estudios e interlineal directamente del griego al español del Libro de Filemón, el cual nos muestra en la práctica lo que es el andar en amor entre cristianos que se comunican las cosas espirituales, primeramente para bendecir los unos a los otros, como Pablo le dijo a Filemón: Acepta a Onésimo, ya no como tu esclavo sino ahora como tu hermano; esto era totalmente revolucionario en una sociedad en la que 1/3 de toda la población eran esclavos; Pablo incluso se ofrece a pagar cualquier cantidad que Onésimo le hubiese tomado a Filemón, a quien le pide que refresque sus entrañas, que era, tanto la acción más humilde que un esclavo "doulos" pudiera ofrecer, como el figurativamente consolar y el confortar emocionalmente al hermano, en este caso mediante la aceptación incondicional, primero de Onésimo, y luego de Pablo de vuelta en Colosas, ya que éste estaba convencido de su próxima liberación de su primer encarcelamiento en Roma, lo que sí sucedió... Termino mi libro recordando a la bella canción de "Gracia sublime". Aquí están los libros que he publicado hasta el momento, esperando sacar pronto el de uno de mis estudios favoritos, el de: "Las aguas de arriba", en Cristo: https://www.amazon.com/Fernando-Castro-Chavez/e/B07GL44ZYN
Otro libro que finalmente he podido agregar es el imprimible en español con algunas de mis investigaciones científicas patrocinadas por el NIH de los E.U., originalmente publicadas en inglés: https://www.ncbi.nlm.nih.gov/pubmed?term=%22Castro-Chavez+F%22 (casi todas aquí gratis), traducidas por mí al español (la versión "electrónica" la puse allí desde el 2013...), y si existe interés del amable lector, a su tiempo también he de traducir la otra mitad que me falta para un segundo libro científico, tal vez titulado: "El Yin y el Yang del Código Genético", Dios y los lectores dirán...
"Ecos de nuestras cenizas" es la primera novela de Fernando Castro-Chavez, un romance que se ubica en un ambiente prehispánico, rodeado de quenas, quipus, pirámides y volcanes; aquí está cómo se ve en la edición electrónica y la portada de la edición impresa (con nuestro volcán de fuego haciendo erupción)...
Atmósferas sugeridas para leer esta obra: https://www.youtube.com/watch?v=lT17TGGYMII&list=RDazCHSLIOBHI&index=4 y https://www.youtube.com/watch?v=jqYU5crv8f4&list=RDjqYU5crv8f4&t=19
Atmósferas sugeridas para leer esta obra: https://www.youtube.com/watch?v=lT17TGGYMII&list=RDazCHSLIOBHI&index=4 y https://www.youtube.com/watch?v=jqYU5crv8f4&list=RDjqYU5crv8f4&t=19
¡ARREOLANZA! ¡Finalmente pude darme tiempo para compartir esto https://youtu.be/6JAMa5IJHNc con ustedes!, ahora, a un mes del centenario de mi profesor favorito, es la conferencia que presenté en la Casa de la Cultura que él mismo fundara aquí: ¡en su querido Zapotlán el G.! Esto no hubiera sido posible sin la ayuda de personas tan distinguidas en este lugar como Mariana Pineda e hija, Jud Rodríguez, Didí Sedano y Ricardo Sigala (quienes me entrevistaron), Carlos Axel Flores Valdovinos (quien cantó composiciones de Juan Octavio Espinoza Arreola, "El Pato"), Arcano Onart de la Rosa y esposa, mi prima materna Adriana Cecilia Vargas Alzaga y fam., mi sobrina paterna Marisely Castro y esposo, Jazmiin Rodriguez y sus amigos así como Fausto Avila (quienes grabaron el evento), Victor Ricardo Cabeza (quien nos acompañó como de ráfaga y me invitó a dar clases de inglés en EDUCEM: ¡gracias!), mis papás, Vania Damián Rodríguez y su mamá, el charal Eduardo Moreno y colaboradores, tales como César Octavio Andrade Orozco, José Luis Zaragoza Hernández distribuidor exclusivo local de mi futuro libro con su familia, Sor Josefina del Hospital San Vicente, Luchita la que nos ayuda, etc., etc., (¡si es que sale! Pues esos del ISBN ya me lo han retenido, creo yo de manera innecesaria e inexplicable, durante tres meses según mis editores, ¿será posible semejante retraso? Por lo pronto, espero meter a concurso al Amazon alguna de sus ediciones que reposan en mi Laptop así como algunas otras cosas... ¡Dios mediante!, y luego Héctor Ag me ha pedido un reporte para su edición periodística especial de Arreola en el que trabajo ahora... y mi estimado Orso Arreola Sanchez quien tuvo a bien promover mi presentación en la "Casa-Taller Literario Juan José Arreola": ¡Muchas Gracias! Última nota: favor de usar audífonos pues el sonido, aunque completo, está malísimo... una sentida disculpa).
Santos Amados: Aquí les presento mi lectura de hoy de Hechos del 1 al 4 del griego: https://youtu.be/kzd4w8f1f6I, en donde se aprecia que es la continuación de las labores de Cristo Jesús, pero ahora él desde el cielo, instruyendo a los suyos, quienes al ser su Cuerpo continúan con su obra. Se observa la gran ventaja espiritual y el poder edificador que nos es el hablar en lenguas, así como el poder que tenemos para salvar y para sanar con el poder de Dios como si nosotros mismos fuéramos Cristo, ¡y eso precisamente significa hacer las cosas en el nombre de Jesucristo: cómo si él mismo las estuviera haciendo, nosotros actuando con su autoridad y poder! También se observa que la vida comunitaria fue algo temporal específico de los judíos cristianos que aprovecharon la reunión internacional de Pentecostés, para continuar aprendiendo al pie de los Apóstoles por unos días más, y eso fue todo (una probadita de la armonía del Milenio con Cristo como el Rey de reyes y Señor de señores). En Cristo, Fernando.
Fernando Castro-Chavez answered a question.
My greatest passions in life are...
God, His Living Message, His Creation... (and if possible: To have a godly wife able to bear our beloved children!!!)
God, His Living Message, His Creation... (and if possible: To have a godly wife able to bear our beloved children!!!)
Comenzando mi próxima lectura de la maravillosa y majestuosa Biblia, me encuentro con la palabra "automate", que llegó a nosotros como "automatos", "autómata", "automáticamente" y todo lo que tiene movimiento autónomo, dice el verso en cuestión: "...llegaron a la puerta la de hierro, la que lleva a la ciudad, la cual automáticamente se les abrió..." Hch. 12:10b; nosotros que nos consideramos tan tecnológicamente avanzados, vemos que hay un poder espiritual sobrenatural capaz de controlar por completo a la materia, aquí hablando de cuando el ángel libertó a Pedro de la cárcel, ¡justo cuando estaba a punto de ser decapitado! Y esto debido a las fervientes oraciones de los creyentes que moraban en Jerusalén, reunidos en casa del futuro Evangelista Marcos.
Tengo gran gozo de presentarles mi estudio del griego de Filemón: https://youtu.be/YK5Z8gXqXSw, que consiste en tan sólo 25 versículos que tratan de manera práctica del amor (Agape) cristiano: Pablo ruega el buen trato para un esclavo: Onésimo (Provechoso), que huyó de Filemón (Lleno de Fileo), su dueño, y que se hizo cristiano en Roma, el cual ahora desea regresar a servir de corazón. El trato como hermanos entre el más alto y el más bajo estrato de la sociedad romana era y es algo totalmente revolucionario, sobrenatural y contrario a la condición natural humana tendiente al egoísmo!
Here, we have an additional and miscellaneous blend of these three intense dream-days of vacations through Zapotlan el Grande, Jal., MX, with an audio of David Garrett, other of the "virtuoso" favorites of my sister: I hope you like it!: https://www.youtube.com/watch?v=SZ-lhLOpnpo
Y... para el deleite musical, altamente recomendado por mi hermana: https://www.youtube.com/watch?v=72wEcFjj188, https://www.youtube.com/watch?v=0Bvm9yG4cvs, https://www.youtube.com/watch?v=dfwe5LiSBe0, https://www.youtube.com/watch?v=mBnkvdM56XQ, etc., etc., etc...
Updated Jul 24, 2018, 8:19 PM
Fernando Castro-Chavez added a new photo to Mariscos Fili's timeline.
Fernando Castro-Chavez recommends Mariscos Fili.
Hoy comimos aquí, llegando de San Antonio, TX, y recomendamos ampliamente a este restaurante, especialmente: el ceviche de camarones y el de marlin, con una cerveza bien helada del "Indio" (verde): https://www.facebook.com/fernando.castrochavez.90/posts/2054349951284337?comment_id=2054473597938639&comment_tracking=%7B%22tn%22%3A%22R%22%7D Gracias familia y empleados de Fili por esta tan grata experiencia! Familia Castro Chávez
De visita en "Las Peñas": Ejercicio corporal mientras uno aprecia las bellezas de "La Creación" y platica con Dios, practicando su "Eusebeia": La Comunicación Diaria: Viva, Vital y Verdadera Con Dios y Con Su Amado Hijo Jesucristo!!! (Y me dice mi hermana que si hiciera esto a diario tendría una condición física aún mejor!!! Aaaghhh!!!)
You tagged Vicente Castro
Mi incansable paisano Héctor Ag me ha pedido escribir una cuartilla sobre algo curioso e inédito que yo recuerde de Arreola, para uno de sus múltiples periódicos; esto es algo que viví con mi próspero y trabajador primo Vicente Castro en Zapotlán cuando éramos niños, hoy él viviendo también en el norte, cómo yo, a ver qué les parece (también se lo paso a Orso Arreola Sanchez, a ver cuando me deja ir a tomarme algunas fotos al lugar en donde conserva algunas de éstas históricas sillas de metal que aquí menciono, Jejee; en las fotos, de esos "parecitos" que agrupa "Google Photos" como si fueran familia, hijo y padre, o algo así, y luego con mi primo Vicente, y con mi ex-esposa Tracy... Acompañada de una buena canción juvenil: https://www.youtube.com/watch?v=9AEoUa0Hlso y de la misma talentosa, una más grave: https://www.youtube.com/watch?v=FGT0A2Hz-uk):
"De cuando subí con mi primo al mirador de Arreola
Por Fernando Castro-Chavez
22 de Julio del 2018, Zapotlán el Grande, Jalisco, MX
Era una mañana sabatina con un sol radiante.
Acabábamos de llegar de Guadalajara a la casa de Mireya Cabeza de Vaca.
El imitador enjaulado hablaba con la misma voz del fallecido padre de la pianista, diciendo: “Señora”.
Mi primo y su hermana se encontraban entonces en visita con ellas, madre e hija.
Salimos corriendo al escuchar una moto que pasaba.
Gritamos: - ¡Maestro, maestro!
Entonces, se detuvo brevemente y nos dijo: - Voy de prisa pero los espero en mi casa en media hora.
Se siguió derecho, pero nosotros de todos modos nos encaminamos a esperarlo a su casa de altura.
Del puro gusto de que nos recibiría corríamos sin importarnos el tiempo y ya llegábamos al empedrado.
Al poco rato llegó él, traía su capa negra, amablemente nos pasó y nos sentó frente al pueblo, y se fue...
Después de un buen rato, regresó con una bebida rosada y con un par de vasos con agua en una charola.
Luego, se envolvió con su capa negra que le quedó por detrás del respaldo, todo parecía como un sueño.
Nosotros estábamos boquiabiertos, así se nos figuraba como un gran cuervo o aún como un murciélago.
Inclinado él mirando hacia el suelo, observábamos su grata boina de la cual brotaba su blanco cauce.
Dijo estar deprimido…; le presenté a mi primo, él le preguntó que de dónde era: - ¡de la sierra!, escuchó.
Mientras apuraba su copa le preguntó su nombre, mi primo sorprendido respondió: - ¡Atemajac!
Arreola se sonrió con gusto, y luego con voz reposada le dijo que se refería a su nombre personal.
- ¡Vicente! - Respondió mi primo, y dijo: - ¡mi papá, que en paz descanse, fue su presidente municipal!
Arreola se sonrió de nuevo, mientras le daba otro sorbo a su bebida, resultó que él lo había conocido.
Después de unos intercambios divertidos y espontáneos, Arreola salió contento golpeteando la charola.
Nosotros, exploramos un poco el lugar y miramos desde allá al pueblo y sus volcanes, y decidimos salir…
Sobre la mesa y sus sillas de metal que usamos, posaba una copa vacía con dos vasos llenos de agua."
"De cuando subí con mi primo al mirador de Arreola
Por Fernando Castro-Chavez
22 de Julio del 2018, Zapotlán el Grande, Jalisco, MX
Era una mañana sabatina con un sol radiante.
Acabábamos de llegar de Guadalajara a la casa de Mireya Cabeza de Vaca.
El imitador enjaulado hablaba con la misma voz del fallecido padre de la pianista, diciendo: “Señora”.
Mi primo y su hermana se encontraban entonces en visita con ellas, madre e hija.
Salimos corriendo al escuchar una moto que pasaba.
Gritamos: - ¡Maestro, maestro!
Entonces, se detuvo brevemente y nos dijo: - Voy de prisa pero los espero en mi casa en media hora.
Se siguió derecho, pero nosotros de todos modos nos encaminamos a esperarlo a su casa de altura.
Del puro gusto de que nos recibiría corríamos sin importarnos el tiempo y ya llegábamos al empedrado.
Al poco rato llegó él, traía su capa negra, amablemente nos pasó y nos sentó frente al pueblo, y se fue...
Después de un buen rato, regresó con una bebida rosada y con un par de vasos con agua en una charola.
Luego, se envolvió con su capa negra que le quedó por detrás del respaldo, todo parecía como un sueño.
Nosotros estábamos boquiabiertos, así se nos figuraba como un gran cuervo o aún como un murciélago.
Inclinado él mirando hacia el suelo, observábamos su grata boina de la cual brotaba su blanco cauce.
Dijo estar deprimido…; le presenté a mi primo, él le preguntó que de dónde era: - ¡de la sierra!, escuchó.
Mientras apuraba su copa le preguntó su nombre, mi primo sorprendido respondió: - ¡Atemajac!
Arreola se sonrió con gusto, y luego con voz reposada le dijo que se refería a su nombre personal.
- ¡Vicente! - Respondió mi primo, y dijo: - ¡mi papá, que en paz descanse, fue su presidente municipal!
Arreola se sonrió de nuevo, mientras le daba otro sorbo a su bebida, resultó que él lo había conocido.
Después de unos intercambios divertidos y espontáneos, Arreola salió contento golpeteando la charola.
Nosotros, exploramos un poco el lugar y miramos desde allá al pueblo y sus volcanes, y decidimos salir…
Sobre la mesa y sus sillas de metal que usamos, posaba una copa vacía con dos vasos llenos de agua."
Aquí les presento con un gran gusto mi lectura del griego de 2 Tim.: P1: https://youtu.be/pMMi6YNxLXs y P2: https://youtu.be/Zx-f86SL-UU, en él vemos el último escrito de Pablo, escrito a su más fiel colaborador, quien participara en toda la trayectoria epistolar de Pablo, también vemos a Lucas y a Marcos, colaboradores de Pablo, quienes fueran los primeros en escribir sus registros inspirados de la vida de Jesús a instancias de él, quien dice que incorporó a su propio Buen Mensaje (Evangelio) escenas de la vida de Jesús desde su nacimiento del linaje de David hasta su resurrección por parte de Dios. Vemos también los nombres de los que traicionaron a Cristo y a Pablo, tales como Demas, Figelo y Hermógenes, Fileto e Himeneo, y Alejandro (éstos dos fueron de mal en peor y entre todos éstos habían seducido a las iglesias de Asia en contra de Pablo y de Cristo), Pablo, inspirado, desecha la idea para Asia Menor de obispos, presbíteros y diáconos especiales, que tan sólo sirvió para el envanecimiento de los así designados, y dice él que es suficiente con encontrar "Doulos": servidores voluntarios de Cristo y de su Padre, que sean creyentes y fieles para enseñar a otros en la práctica cómo vivir la "Palabra sanadora" de cuerpos y mentes, para realmente preservar la "Eusebeia": que es la relación viva, vital y verdadera constante con Dios y con Su hijo entre los creyentes, cosa que se habían olvidado por completo de practicar los líderes corruptos (en el cristianismo contemporáneo se da lo mismo, se ha perdido esa “Eusebeia” y por ende ese poder práctico que existió como la norma de la Iglesia temprana, el cual aún en vida, Pablo tristemente vio desvanecerse bajo las garras: ¡de lobos disfrazados de pastores!…: ¡pero, que es posible recuperar de nuevo siguiendo lo que Pablo aquí nos indica inspirado por Dios!)
One dear sister in Christ: https://rocioanker.com/ did sent me a sweet reminder of the practical power of prayer here and now: from within and from without!!! https://web.archive.org/web/20180720101926/https://www.bbc.co.uk/news/world-asia-44791998 Thank you!!!
Ya completando mi estudio doctoral próximo, veo que cuando se habla ¡ocho veces! de las 'palabras sanas' en las Epístolas Pastorales (1 y 2 Tim. y Tito), ¡una mejor traducción ha de ser: "Palabras Sanadoras", es decir: Las que son literalmente capaces de impartir sanidad tanto mental como física al estarlas creyendo, ya sea por escucharlas o por leerlas!!! Esto resuena con las ¡ocho veces! también que en Proverbios leemos de la salud (MARPE en heb., y eso aparte de las otras dos palabras relacionadas en Pr. que se ven en la foto): una salud literal que imparte la buena palabra!!! Va un ejemplo de cada caso: De 2 Tim. 1:13: "Retén la forma de las sanas palabras (es: DE LAS PALABRAS SANADORAS: "hugiainonton") que de mí oíste, en la fe y amor que es en Cristo Jesús" y Pr. 16:24 "Panal de miel son los dichos suaves, suavidad para el alma y MEDICINA ("marpe": SALUD) para los huesos." WOW!!! Oh maravilla de maravillas el diseño divino y perfecto de la Palabra SANADORA de Dios!!!
Hey! And talking about it: Check this great site by my dear and valuable sister in Christ Diana Moreno!: https://renewthismind.wordpress.com/
Pues, aquí trabajando duro en las "clínicas divinas" para mis amados hermanos de habla hispana, en la siguiente excelente escritura en su contexto: "2 Tim. 3:16 Toda Escritura exhalada por Dios (Theopneustos) es útil para enseñar, para redargüir, para corregir, para instruir en justicia, 17 a fin de que el hombre de Dios sea perfecto (artios), enteramente perfeccionado (exertismenos) para toda buena obra." [Pidiéndole a mi Dios ¡el poder tener esto listo y completo dentro de la siguiente semana! (Entre tanto, me acabo de dar cuenta que a mis espaldas, un "Quijote" intenta "estocar" a un ventilador casero!!! Jejee)]
Updated Jul 13, 2018, 8:00 AM
Tito, Tito...!: https://youtu.be/GGovSn7NJh0 Aquí Pablo le indica cómo poner orden en Creta (del trabajo de Pablo después de su primera encarcelación, después de Hch. 28, y antes de la segunda y su sacrificio póstumo), estableciendo "Presbíteros" (Ancianos, "Elders", lo que incluía a las mujeres y los esclavos) en las Iglesias de todas sus ciudades, y "Obispos" (mujeres incluidas, así como esclavos), dice que los de ese país eran, como Epiménides lo dijo: unos mentirosos, maliciosos, glotones y holgazanes, pero que al aceptar a Cristo, ya eran salvos y que era posible que enderezaran su andar para recibir sus recompensas (de allí el énfasis en que hicieran el bien). Pablo se iba a encontrar con Tito en la cercana Nicópolis (una "Ciudad Victoria", de varias que había por allá), y como que a Tito le gustó más aquel lugar que Creta (que significa "La Carnal"), porque lo vemos (en 2 Tim.) "escaparse" a "Dalmacia" (que es en "Ilírico" cerca de Nicópolis, pero bueno, eso lo veremos después).... Fernando.
Es con un muy tremendo gozo el poder presentar para ustedes mi estudio de 1 Timoteo del griego: https://youtu.be/PtYYfehuVDE en el que Pablo inspirado por Dios lo exhorta "a enderezar el barco" de los creyentes de Éfeso que se les estaba hundiendo (como tantas veces nuestras propias vidas), y la solución es muy fácil: acudir directamente al Dios, que es presentado como nuestro Salvador varias veces en esta Epístola dirigida a nosotros los servidores: ¡Oh Gran Dios, conforta nuestros corazones para confiar única y completamente en Ti, y seguirte sirviendo como te lo mereces, pero en ningún ser humano, sea éste hombre o mujercita!
Dear Faithful Saints in Christ!: In 1 Tim. 3:16 Both: The Head and the Body of Christ are proclaimed!:
"And confessedly great is the, of the, of godliness revealed secret: Which: 1] Was revealed in flesh; 2] Was justified in spirit; 3] Was seen by angels; 4] Was proclaimed among gentiles; 5] Was believed on in cosmos; 6] Was taken up in glory (to the heavens of heavens)".
E. W. Búllinger saw here what almost nobody else has seen:
We have what is true of Christ personally, of course; but we have more; we include what is true of the members as well, if we take it as referring to the Body of Christ – the Head and the members.
What is it?
1. "MANIFESTED IN FLESH.” True of the members, and true of the Head (Rom. 1:3).
2. "JUSTIFIED IN SPIRIT.” True of Head, and members as set forth in Rom. 5:12-8:39.
3. "APPEARED TO ANGELS.” This is explained by Eph. 3:10, where we are told that now unto principalities and powers in the heavenlies, God is making known His manifold wisdom by means of the Church.
4. "PROCLAIMED AMONG THE GENTILES,” not merely Christ personal, but the Body of Christ, is now proclaimed, "made known to all nations” (Rom. 16:26), "made known among the Gentiles” (Col. 1:27), preached "among the Gentiles” (Eph. 3:8).
5. "BELIEVED IN THE WORLD.” It is made known "for the obedience of faith” (Rom. 16:26) [i.e., faith-obedience].
6. "RECEIVED UP IN GLORY.” If so be that we suffer with Him, that we may be glorified together, also with Him” (Rom. 8:17). "For whom He justified, them HE also glorified” (Rom. 8:30).
This then is the end of the Body of Christ, as it was of Christ personal. The members are waiting to be "Received up in Glory,” as the Head was. This is our hope, our "blessed hope.”
http://fdocc.ucoz.com/index/the_mystery_2/0-51
(Büllinger, E. W. The Mystery. 5th Paper, Things to Come, Dec. 1896, 2(6):104-105)
And in the original: https://archive.org/stream/ThingsToComeVol1-2/Things%20to%20Come%20Vol%201-2%20--#page/n351/mode/2up/search/116
This is in preparation of my upcoming reading, research, study on First of Timothy, pray in the spirit for the light to fly through the universe of our good God!!! Your Fernando.
"And confessedly great is the, of the, of godliness revealed secret: Which: 1] Was revealed in flesh; 2] Was justified in spirit; 3] Was seen by angels; 4] Was proclaimed among gentiles; 5] Was believed on in cosmos; 6] Was taken up in glory (to the heavens of heavens)".
E. W. Búllinger saw here what almost nobody else has seen:
We have what is true of Christ personally, of course; but we have more; we include what is true of the members as well, if we take it as referring to the Body of Christ – the Head and the members.
What is it?
1. "MANIFESTED IN FLESH.” True of the members, and true of the Head (Rom. 1:3).
2. "JUSTIFIED IN SPIRIT.” True of Head, and members as set forth in Rom. 5:12-8:39.
3. "APPEARED TO ANGELS.” This is explained by Eph. 3:10, where we are told that now unto principalities and powers in the heavenlies, God is making known His manifold wisdom by means of the Church.
4. "PROCLAIMED AMONG THE GENTILES,” not merely Christ personal, but the Body of Christ, is now proclaimed, "made known to all nations” (Rom. 16:26), "made known among the Gentiles” (Col. 1:27), preached "among the Gentiles” (Eph. 3:8).
5. "BELIEVED IN THE WORLD.” It is made known "for the obedience of faith” (Rom. 16:26) [i.e., faith-obedience].
6. "RECEIVED UP IN GLORY.” If so be that we suffer with Him, that we may be glorified together, also with Him” (Rom. 8:17). "For whom He justified, them HE also glorified” (Rom. 8:30).
This then is the end of the Body of Christ, as it was of Christ personal. The members are waiting to be "Received up in Glory,” as the Head was. This is our hope, our "blessed hope.”
http://fdocc.ucoz.com/index/the_mystery_2/0-51
(Büllinger, E. W. The Mystery. 5th Paper, Things to Come, Dec. 1896, 2(6):104-105)
And in the original: https://archive.org/stream/ThingsToComeVol1-2/Things%20to%20Come%20Vol%201-2%20--#page/n351/mode/2up/search/116
This is in preparation of my upcoming reading, research, study on First of Timothy, pray in the spirit for the light to fly through the universe of our good God!!! Your Fernando.
Mary Cris, This is to the girl that I love with all my heart, future mother of my own, now that we are starting our tenth solid month of overcoming every and any single obstacle that has been thrown at us from day one by the adversary and by his willing or unwilling servants (Ah! And sometimes being ourselves those ones, but coming out from there as soon as we together realize that we have been wrong!!!): "Me and you: The brick and the flower: The strength and the tenderness, the solid resolve and the scent of your biological life! Ours will be a marriage fusing the work of the man plus the work of God!!!: Me, as you have said, I am: Godliness, responsibility, authenticity and consistency... You, as I say every single day: You are the love for God, you are intelligence, you are a beauty, and your song and your guitar are the symphony of it all!..." Fernando!
Yesterday with my only uncle left by the side of my grandmother Eva, Mr. Jose Luis Arroyo Acosta, from Mexicali, B.C. Nte., MX. Learning and Teaching About God, Life, and Those Days Ahead!!! Thanks to Juan P. Chávez for taking such an excellent photo (cropped from a video clip that he took, with better color and quality that a simple photo!)
Updated Jun 24, 2018, 7:25 AM
Con el gran gozo de ser un hijo amado de Dios, es con una incomparable alegría el completar con esto mi incursión en las Epístolas a la Iglesia, de Pablo: Aquí está la introducción: https://youtu.be/sYzdpsYAAYY y el resto: https://youtu.be/nLgwXBLYDak (al que tuve que editar removiendo algunas cosas personales por petición de parte)... Vemos cómo las listas iniciales se aplican también a creyentes renacidos (las llamadas "listas de infamia") ya que en ellos sí hace la diferencia el actuar bien para recompensas; en cambio, para el no renacido, mientras que éste rechace a Cristo, está tan muerto, ya sea que haga poco o mucho mal. Luego vemos el glorioso final con la alabanza a Dios por habernos revelado un Gran Secreto Divino, así como diversos aspectos del mismo.
Updated Jun 17, 2018, 10:23 PM
Updated Jun 17, 2018, 9:11 AM
This was the End of the English Class, the last song was: "Don't Be Cruel", by The Elvis: "...The future looks bright ahead / Don't be cruel to a heart that's true / I don't want no other love / Baby it's just you I'm thinking of / Don't stop thinking of me... / ...Why should we be apart? / ...And let us say I do / Then you'll know you'll have me / And I'll know that I'll have you...": https://www.youtube.com/watch?v=_ebEIzcf0Dk
Es con gran alegría que aquí les presento mi lectura del griego de 1 Cor. 1 - 4: https://youtu.be/rJpC_EPreVU (c 1-3)
https://www.youtube.com/watch?v=9ksmsirxJP0 (c 4: Debido a que se me saturó la Laptop, gracias a Dios de nuevo se puede hacer transmisión directa): Aquí se ve que el centro del mensaje actual de Dios es que Cristo dio su vida en la cruz para pagar por todos tus pecados, y que cuando lo aceptas como tu Señor viviente tienes la conexión directa para que él te guíe y te consuele en TODO, por lo tanto esto nos enseña que: ¡Nosotros servimos a Cristo y NO a los hombres! (Además él es el único que nos puede consolar de todas las cosas que el hombre, o la mujercita, nos puedan hacer, en el caso de Pablo lo menospreciaban...) Las fotos son de el Lago de Chapultepec y de un costado de La Casa del Lago que fundara mi profesor favorito: Arreola, en la CD. de MX. De hecho, esto es lo único que en realidad me mantiene vivo, a flote y motivado a seguir adelante (lo demás es tan sólo un volantín para volverse locos): Mi trabajo en Cristo con Dios y para Dios. ¡Amén!
https://www.youtube.com/watch?v=9ksmsirxJP0 (c 4: Debido a que se me saturó la Laptop, gracias a Dios de nuevo se puede hacer transmisión directa): Aquí se ve que el centro del mensaje actual de Dios es que Cristo dio su vida en la cruz para pagar por todos tus pecados, y que cuando lo aceptas como tu Señor viviente tienes la conexión directa para que él te guíe y te consuele en TODO, por lo tanto esto nos enseña que: ¡Nosotros servimos a Cristo y NO a los hombres! (Además él es el único que nos puede consolar de todas las cosas que el hombre, o la mujercita, nos puedan hacer, en el caso de Pablo lo menospreciaban...) Las fotos son de el Lago de Chapultepec y de un costado de La Casa del Lago que fundara mi profesor favorito: Arreola, en la CD. de MX. De hecho, esto es lo único que en realidad me mantiene vivo, a flote y motivado a seguir adelante (lo demás es tan sólo un volantín para volverse locos): Mi trabajo en Cristo con Dios y para Dios. ¡Amén!
Two Mexican fruits: The pitaya and the yellow plum (Hoy, le mostré a mi alma dos frutas mexicanas: pitaya y ciruela amarilla; quiero acompañar esto con el mejor album de folk tapatío de "Tierra Mojada", espero que les guste como a mí: https://www.youtube.com/watch?v=3VeNA74mv9w&list=PLVwy9GH5FdJTlmScirnmsEAH6ido47NGR&index=4, aquí tocaban nuestros viejos amigos Paco Padilla, Escobar y Rodríguez, entre otros)
Aquí está mi lectura del griego de "2 Cor. del 10 al 13 y más": https://youtu.be/qrluUDZ7JD0 "Derrumbando argumentos contra Cristo": Así como celebro este cumpleaños (el 30)... así también Pablo celebró la salvación por gracia de los creyentes de Corinto primero, para luego exhortarlos a que como vírgenes puras, ¡se definieran por un solo hombre! (pues eran cortejados por los labiosos y falsos apóstoles, curiosamente también procedentes de los judíos), la Epístola era un pedido divino: ¡para que se definieran por Cristo, y que por siempre anduvieran bajo su guía directa! Comienzo leyendo: "no os unáis en yugo desigual con los incrédulos..." (En las fotos me encuentro frente a la fundada por Arreola, en Chapultepec: "Casa del Lago"... And also, celebrating yesterday with my dearly beloved parents (while reminiscing my whole life with them)!!!
Metro: With all the universe around me, but still lonely without you: my love! (Note: ...just the distances in time and space seem to be insurmountable, but as she advised to me: Claim with all your voice to God and to His Kingdom, they are the real ones that know and rejoice about our hearts for each other!!!)
Celebrando pura madre!!! En "Ilustre", donde la dueña Esmeraldita nos acompañó, brindando con tres deliciosas cortesías de mezcal!!! ¡En la madre recayó el salmón, y pulpo para el papi y yo con un tiramisú final y las Pacífico que no faltaron!, y aqui, el papi y yo vamos por el camino de las bugambilias en flor (diría ese tal de Proust).
You tagged Silvia Preciado
Seems like yesterday!!! But seven, such as in perfection: |
Fernando and Silvia are celebrating 7 years of friendship on Facebook!
Seems like yesterday!!! But seven, such as in perfection:
Aquí está el Fer saliendo de la pared, el lado izquierdo es el pasado, el lado derecho es el futuro... ¡con Dios de verdad, nada ni nadie será capaz de entristecer el corazón de sus hijos! El Fer.
Fernando Castro-Chavez shared a memory.
5 Years Ago
Fernando Castro-Chavez updated his status.
Apr 26, 2016, 9:02 AM
Mi Amada en Cristo Breege Corrigan comparte lo que aquí traduzco: "¿Y entonces, en qué consiste una conexión viviente con Dios? Simplemente, en mantener las líneas de comunicación abiertas entre los dos. Significa el moverte en tus diarias actividades de forma tal que siempre estés disponible para escuchar lo que procede del cielo. Piensa tan sólo, ¡que la clave verdadera a una consistente victoria es una cosa solamente! No tienes porqué memorizar una lista de cosas por hacer y cosas por no hacer. Todo lo que necesitas hacer es el mantener ese flujo de continuo contacto con Dios. ¡Él está continuamente hablando Sus Palabras a nuestros corazones mediante Su don de espíritu santo que mora dentro nuestro!"
Lo que vale la pena sigue siendo de valor dígalo quien lo diga, ¿edá?
Updated Apr 26, 2018, 7:54 AM
Para mi nuevo libro, aplicando los principios de mi "Arreolanza": "...“Depende de los elegidos de Dios el encontrar un método para aplastar a la serpiente”, y yo agregaría: “…bajo Su dirección”; pero la mejor respuesta, creo que es la que George Sand nos presenta en aquel libro que Arreola me regaló, ya que ella nos dice:
“En el silencio de las cosas inertes, en el mutismo de lo que nunca miente…nos encontramos como suspendidos entre cielo y tierra, en una región de ideas en la que no pueden existir más que Dios o nada; sentimos que no somos nada, que ni siquiera existimos, porque nada puede prescindir de su razón de ser. El misterio es impenetrable cuando se pretende someterle a los cálculos de la experiencia. Escapa a la más sabia lógica; pero la existencia de Dios se prueba precisamente en la falta de pruebas a nuestro alcance. No sería nada superior a nosotros si cayera bajo el criterio de nuestras demostraciones. La noción que tenemos de él reside en una esfera a la que no tenemos acceso más que a condición de sentirnos superiores a nosotros mismos, donde la fe es una valentía del corazón, una sobreexcitación del espíritu, una hipótesis del genio; es el ideal del sentimiento y allí todo razonamiento se resume en dos palabras: Dios existe porque yo le percibo.” (p. 41, Jorge Sand, “Último Amor”, Leyenda, México, 1945: 201 p.; traduce Federico Melchor, (excepto la última palabra, que es mía: “percibo”, ya que él la traduce como “concibo” (que se prestaría a cierta confusión como para pensar que es un producto de nuestra imaginación), mientras que el final de este C. XII, tr. por J.A.R., para Salvatella, Barcelona, 348 p. (sin fecha) lo traduce como “siento” (que también se prestaría a confusión como para pensar que es un simple sentimiento)),)"
“En el silencio de las cosas inertes, en el mutismo de lo que nunca miente…nos encontramos como suspendidos entre cielo y tierra, en una región de ideas en la que no pueden existir más que Dios o nada; sentimos que no somos nada, que ni siquiera existimos, porque nada puede prescindir de su razón de ser. El misterio es impenetrable cuando se pretende someterle a los cálculos de la experiencia. Escapa a la más sabia lógica; pero la existencia de Dios se prueba precisamente en la falta de pruebas a nuestro alcance. No sería nada superior a nosotros si cayera bajo el criterio de nuestras demostraciones. La noción que tenemos de él reside en una esfera a la que no tenemos acceso más que a condición de sentirnos superiores a nosotros mismos, donde la fe es una valentía del corazón, una sobreexcitación del espíritu, una hipótesis del genio; es el ideal del sentimiento y allí todo razonamiento se resume en dos palabras: Dios existe porque yo le percibo.” (p. 41, Jorge Sand, “Último Amor”, Leyenda, México, 1945: 201 p.; traduce Federico Melchor, (excepto la última palabra, que es mía: “percibo”, ya que él la traduce como “concibo” (que se prestaría a cierta confusión como para pensar que es un producto de nuestra imaginación), mientras que el final de este C. XII, tr. por J.A.R., para Salvatella, Barcelona, 348 p. (sin fecha) lo traduce como “siento” (que también se prestaría a confusión como para pensar que es un simple sentimiento)),)"
You tagged Jorge Souza
Pedro Mariscal, Jorge Souza y Fernando Castro-Chavez. Mariscal comienza con un bello epígrafe de Arreola para su “Primer destino", y dice así: “Jóvenes y maestras: sálganse del programa y den un poco de lección de humanidad” (en “La palabra educación”, de Juan José Arreola), y luego comienza diciendo: "Tu mirada se dirige a un cielo lleno de estrellas en esa madrugada… hasta tu rostro llega la brisa de la última lluvia. La luna se asoma por entre las ramas de los altos mezquitales que bordean la sorpresiva brecha…” ("Un sol que llena tus pupilas", 2017); Souza luego dice: "Lo que ocurría en la clase de Arreola... tomaba la palabra para hilar interminables textos que a todos nos dejaban boquiabiertos... Nos convertíamos, entonces, en espectadores insólitos de un mundo que se abría y se desplegaba con nuevas y múltiples formas..." ("Arreola a La Rotonda", 2014); y Fernando Castro-Chavez finalmente dice: "Arreola me enseñó que: “Lo importante de un escrito es la mariposa de la inspiración que sale del capullo del corazón, para que puedas tu decir cosas que, aunque inspiradas por tu vida y por tus lecturas, que seas capaz de decirlas de una manera original, única, imposible de imitar, que solamente tú las puedas decir de esa forma" ("Arreolanza", 2018)". Foto cortesía de Sofía Gutiérrez Arias.
Updated Apr 17, 2018, 8:32 PM
Fernando Castro-Chavez answered a question.
My superhero name would be…
Jesus Christ first, the heavenly one!!!
Jesus Christ first, the heavenly one!!!
Fernando Castro-Chavez shared a memory.
10 Years Ago
Fernando Castro-Chavez added a new photo.
Apr 7, 2011, 9:18 AM
Valuable observations by Edwin D. Blumberg, Central N.J. Cardiol., and our Vijay Nambi, B.C.M, Houston, TX. Talked to Cristina Rolandi and mentor, U. of Amsterdam (w/"Dr. Jazz" as background); Sonia Mitra, U. Arkansas; Shoukang Zhu, U. Miami, Martin K. Reriani, Mayo Clinic, MN, and colleague. Here, thumbs-up to Martin's work!
Like in a dream... at New Orleans, presenting and evaluating research on cardiology... one of the two best trips we did with my beloved ex-wife @[1218645485:2048:Tracy Duncan], who took the picture, the other was at Universal Studios; this was the abstract of my presentation there: http://www.onlinejacc.org/content/accj/57/14_Supplement/E1548.full.pdf
Updated Apr 7, 2018, 7:21 AM
In English: "The important thing of a writing is the butterfly of inspiration that comes out of the cocoon of your heart, so that you can say things that, although inspired by your life and by your readings, you are able to say them in an original, unique, impossible way to imitate, something that only you can say in such way" (Juan José Arreola when talking to me).
"Bisaya Cebuano: "Ngadto sa akong asawa nga si Mary Cris: "Ang importante nga butang sa usa ka pagsulat mao ang alibangbang sa inspirasyon nga nga mogawas gikan sa cocoon sa kasingkasing, aron makasulti ka sa mga butang nga, bisan tuod dinasig sa imong kinabuhi ug pinaagi sa imong pagbasa, mahimo nimo kini isulti sa orihinal nga paagi talagsaon, imposible nga paagi sa pagsundog, nga ikaw lamang ang makasulti imong..." Arreola. Ang imong Fernando nga tinuod nga nahigugma kanimo, ang Dios ang akong saksi!"
Filipino: "Sa aking asawa, si Mary Cris:
"Ang mahalagang bagay sa pamamagitan ng pagsulat ay ang pagtaas ng inspirasyon na nagmumula sa cocoon ng puso, upang masabi mo ang mga bagay na, bagaman inspirasyon ng iyong buhay at ng iyong pagbabasa, maaari mong sabihin ang mga ito sa isang orihinal na paraan, isang natatanging at imposibleng paraan upang tularan, na tanging maaari mong sabihin ito na paraan..." (Arreola).
Ang iyong Fernando na talagang nagmamahal sa iyo, ang Diyos ang aking saksi!"
And the way I put it in my "Tasters of the Word": https://www.facebook.com/TastersOfTheWord/photos/a.1295006403855126.1073741828.1294972103858556/1871677812854646/?type=3&theater
"Bisaya Cebuano: "Ngadto sa akong asawa nga si Mary Cris: "Ang importante nga butang sa usa ka pagsulat mao ang alibangbang sa inspirasyon nga nga mogawas gikan sa cocoon sa kasingkasing, aron makasulti ka sa mga butang nga, bisan tuod dinasig sa imong kinabuhi ug pinaagi sa imong pagbasa, mahimo nimo kini isulti sa orihinal nga paagi talagsaon, imposible nga paagi sa pagsundog, nga ikaw lamang ang makasulti imong..." Arreola. Ang imong Fernando nga tinuod nga nahigugma kanimo, ang Dios ang akong saksi!"
Filipino: "Sa aking asawa, si Mary Cris:
"Ang mahalagang bagay sa pamamagitan ng pagsulat ay ang pagtaas ng inspirasyon na nagmumula sa cocoon ng puso, upang masabi mo ang mga bagay na, bagaman inspirasyon ng iyong buhay at ng iyong pagbabasa, maaari mong sabihin ang mga ito sa isang orihinal na paraan, isang natatanging at imposibleng paraan upang tularan, na tanging maaari mong sabihin ito na paraan..." (Arreola).
Ang iyong Fernando na talagang nagmamahal sa iyo, ang Diyos ang aking saksi!"
And the way I put it in my "Tasters of the Word": https://www.facebook.com/TastersOfTheWord/photos/a.1295006403855126.1073741828.1294972103858556/1871677812854646/?type=3&theater
Fernando Castro-Chavez shared a memory.
5 Years Ago
Fernando Castro-Chavez updated his cover photo.
Apr 5, 2016, 7:59 PM
Remembering those days when I equated the 20 amino acids with the vigesimal system of the Mayan Civilization for programming purposes:
Updated Apr 5, 2018, 8:30 AM
La más alta transformación posible se lleva a cabo por la gracia de Dios al tener nosotros de Su espíritu santo y usarlo!!!! Esa es Su obra exclusiva al comprobar nosotros que Su voluntad es ¡¡¡BUENA, AGRADABLE y PERFECTA!!! Y como decía mi mejor maestro terrenal que he tenido, algo que también incluyo en mi libro sobre "Arreolanza": "En otra entrevista, Arreola mismo habló de (y representó verbalmente a,) una metamorfosis de la crisálida y su mariposa para referirse a su propia obra; esto es lo que él dijo: “Volviendo a lo esencial, yo sólo me perdono las frases que todavía considero reveladoras, las que aún me proponen un misterio a mí mismo. Las otras, haz de cuenta que quedan como capullos vacíos; ya se fue la mariposa, y aunque el capullo sea de seda, lo que importa es la criatura viviente que estaba ahí…” (Simpson, M. Juan José Arreola: Sólo sirve la página viva, la que se queda parada en la mesa. Buenos Aires: Crisis, octubre de 1974: año 2, núm. 18)." Atentamente, tu Fernand. P.D. My babe M. C. V. R., the second one represents me, you, and our baby!!!, the real deal for the consummation of our love and relation!!! Muah! XOXOXO...
En otra ocasión, retomando esta escena de la transformación, Arreola señaló ante un evento de puras mujeres: "“Imagínense ustedes que nos encontramos a uno de esos gusanos que se caen del árbol, se quedan en la banqueta expuestos a ser aplastados por el primer transeúnte distraído o malévolo.” “Nos enfrentamos al gusano y le decimos: ¿quieres ser mariposa? El gusano se reirá de nosotros indudablemente. Apegado con todo el cuerpo a la superficie de la tierra, la proposición de volar le ha de parecer francamente irrisoria y, sin embargo, mediante un acto de meditación profunda modifica además de su estructura celular toda la masa de su materia original y la hace ‘evolucionar’ de esa sustancia casi viscosa, líquida, hasta la perfección del tejuelo, de la astilla de color y de luz que se vuelve en el doble alero de las alas el resplandor de la mariposa” (Arreola, J. J. La implantación del espíritu. (En: Obras). D.F.: FCE, 2014:656-657)", lo que también incluyo en el libro de mi "Arreolanza".
Dedico el siguiente escrito a Lidia Ruiz Gomez y famila, por ser mis bienhechores junto a mis padres, de mi próximo libro "Arreolanza": "...retomando la misma escena del gusano que se transforma en mariposa, Arreola nos dice:
“Estoy de acuerdo con la crisálida que resuelve dentro del capullo la aspiración del gusano. ¡Bendita sea la metamorfosis, esa profunda meditación que nos levanta del suelo en las alas efímeras pero resplandecientes de una mariposa!”.
"Creo que la operación enigmática que resuelve un gusano en mariposa, se debe a una reflexión profunda. Esa que todos deberíamos emprender, ensimismándonos. El gusano se arrastra por el suelo, ya sea la superficie de un tallo, de una hoja, de un tronco, o simplemente digamos: el gusano se arrastra a ras de tierra. Pero he aquí que se le ocurre volar. Entonces se ensimisma y se embalsama con su propia sustancia como una momia que se sabe capaz de resurrección. Porque va a brotar de su propio ser material, pero alentado por el espíritu. Como todos nosotros. De allí la meditación profunda. La de Jonás envuelto y luego dado a luz por la ballena, esa masa de nada original que nos devuelve al Todo..."" (Arreola, J. J. Inventario. D.F.: Conaculta, 2002:22, 173)."
“Estoy de acuerdo con la crisálida que resuelve dentro del capullo la aspiración del gusano. ¡Bendita sea la metamorfosis, esa profunda meditación que nos levanta del suelo en las alas efímeras pero resplandecientes de una mariposa!”.
"Creo que la operación enigmática que resuelve un gusano en mariposa, se debe a una reflexión profunda. Esa que todos deberíamos emprender, ensimismándonos. El gusano se arrastra por el suelo, ya sea la superficie de un tallo, de una hoja, de un tronco, o simplemente digamos: el gusano se arrastra a ras de tierra. Pero he aquí que se le ocurre volar. Entonces se ensimisma y se embalsama con su propia sustancia como una momia que se sabe capaz de resurrección. Porque va a brotar de su propio ser material, pero alentado por el espíritu. Como todos nosotros. De allí la meditación profunda. La de Jonás envuelto y luego dado a luz por la ballena, esa masa de nada original que nos devuelve al Todo..."" (Arreola, J. J. Inventario. D.F.: Conaculta, 2002:22, 173)."
Y, conforme el primer día de la Resurrección de Cristo termina, quiero aquí recordar lo que decía el mejor escritor del "Siglo de Oro Español", al refinado gusto de Arreola, frases que incluyo en "Arreolanza": “Morimos para nacer á segunda vida. Mejor séquito tiene el morir que el nacer: á la vida sigue la muerte; á la muerte la resurrección…“…El compuesto… falleció, que es el hombre, se suspende hasta la cierta resurrección. Es depósito breve, no divorcio perpetuo… Obras de siembra tiene el entierro”. Francisco de Quevedo y Villegas. (En la foto se observa nuestra mariposa Monarca, ya que la metamorfosis es una metáfora de la resurrección).
And, today I am celebrating the beginning of Spring, and the Salvation/Resurrection day for Christ! (compared by my dearly beloved professor Arreola as "the transformation from an ugly caterpillar (me) to a gorgeous golden butterfly (me in 'That Day')) That started from Saturday evening, all day long to Sunday evening, and I dedicate this to my girl: https://youtu.be/QPotJTiKS28 as well as the statement, from my "Arreolanza" book, coming soon: “The triumph of the spirit... to be compared to one born to life out of the center of death, being thus equivalent to the resurrection from the death!” Jakob Böhme (shown in the photo).
En este sábado de resurrección hay que recordar que lo más importante es que: ¡tenemos y tendremos por siempre a Cristo! Y aún cuando no tenga yo una compañera (y en realidad no tengo a nadie real, sino una ilusión en la que tan sólo yo estoy creyendo), ni casi nada en la vida: ¡Tengo a Cristo por siempre! (La eclosión: "¡Es la metáfora de nuestra salvación y resurrección!", decía Arreola, lo que pongo en "Arreolanza", que escribo para poder comer). Dios levantó a Jesús en un sábado al atardecer: http://cgi.org/three-days/
"Lo que le gustaba a Arreola de Kant eran sus metáforas animales: 1) Los racionalistas son como las arañas que tejen su tela a partir de lo que llevan dentro, y quedan atrapados en sus propios razonamientos; 2) Los empiristas son como las hormigas que solamente valoran lo que pueden cargar externo a ellas, hasta quedarse bajo tierra sin poder remontarse a las alturas; 3a) El conocimiento verdadero se asemeja: tanto a la abeja, que toma el néctar de las flores (algo externo, como hormiga: experiencia), pero que luego lo procesa en su interior para producir miel (algo interno, como araña: razón), y a 3b) La paloma que para remontarse en su vuelo (razón) depende de la resistencia del aire (experiencia), y si no la tuviera, caería de inmediato por encontrarse al vacío (y Kant afirmaba que eso le sucedió a Platón; notas para "Arreolanza", 2da. Ed.)." Su Fernand.
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Mar 18, 2015, 8:36 PM
Jesus Christ prophesied that not even stone upon stone will be left of the Temple in Jerusalem. The Romans executed to the letter such prophecy. The actual Temple was located 1000 ft south of the current Dome of the Rock as Dr. Ernest L Martin discovered.
Un recuerdo de aquellos días en los que investigué que el famoso "Muro de los lamentos" no es en lo absoluto parte del "Templo de Jerusalén", como lo creen los judíos que aún rechazan a Cristo, si lo fuera las palabras de Jesús serian totalmente nulas y sin efecto alguno, pues él dijo que del Templo no quedaría ni siquiera "piedra sobre piedra", por lo que ese "Muro" es la parte externa de la romana "Fortaleza Antonia", en donde estaba la morada de Pilato y su Pretorio:
Updated Mar 24, 2018, 10:48 PM
Aquí está mi versión de mi programa con @[100007097824037:2048:Iliana Hijuelos] "El valor de las palabras y su belleza": https://youtu.be/IBK87AnB4x4 por Notisistemas, Guadalajara, en el que presento mi libro por salir "Arreolanza o la clase de Arreola"; en el video se incluyen los libros de "Juan José Arreola para jóvenes", "Lectura en voz alta" e "Inventario" (Comentario discreto: Estoy por ir a la Cd. de México a tramitar mi ISSN, ISBN, código de barras y derecho de autor, por si existiera alguien quien, viviendo en aquel lugar, milagrosamente leyera esto y me pudiera recibir; si nadie, algo probable, ya que se acerque la fecha, pues tendré que dirigirme con mi petición a alguien en especial, ¡gracias!).
Updated Mar 21, 2018, 10:19 AM
Fernando Castro-Chavez was 🎉 celebrating friendship.
Fernando made 20 friends on Facebook in March
Nuevos amigos que, como un gran paisaje en el horizonte están algunos cercanos y otros lejanos, y es un desplazarse voluntario, a veces en auto, a veces a pie pero las más de las veces, un desplazarse en el alma...
Lector, uno de mis últimos agregados al libro que ya está por entrar en las impresoras, gracias a la infinita paciencia de Iliana Hijuelos, de la "Guía espiritual" (1675), fragmentos que me impactaron por completo en mi adolescencia, haciéndome un cristiano comprometido primeramente en amar a Dios, y segundo en escucharlo directamente a él ¡y a nadie más! Arreola nos enseñó esto: “…el padre del molinosismo (también llamado en español: ‘quietismo’), Miguel de Molinos (era un clérigo que,) sostenía que la gracia era suficiente para llegar a Dios. Naturalmente, fue procesado por la Inquisición” (‘Apuntes’ de Preciado: 2014:59, 62, oct. 1983 – feb. 1984; 30, may. – jun. 1983; su “Guía espiritual” en “El converso”). En base a ello escribió su texto que incluyo en mi obra: "Mi sola capacidad era el pensamiento, siempre más desbordado y potente. En la soledad tuve tiempo de andar y desandar numerosos caminos; reconstruí pieza por pieza edificios imaginarios; me extravié en mi propio laberinto, y sólo hallé la salida cuando la voz de Dios vino a buscarme. Millones de ideas se pusieron en fuga, y sentí que mi cabeza era la cuenca de un océano que de pronto se vaciaba" (Arreola, J. J. “El converso”. (En: Obras). D.F.: FCE, 2014:135-136). Y señalo: "la historia de los verdaderos “Alonso de Cedillo”, explorado en “El Converso” y del ya nombrado “Francisco de Sayavedra...” Quien era un tipazo: Simpatizante de Erasmo de Rotterdam, ajeno a determinadas oraciones, “hombre más amigo de rogar a Dios que a sus santos, incrédulo en materia de indulgencias… mal cumplidor de los preceptos de oír misa” (esto último dicho por un testigo), etc. [Bataillon, M. Erasmo y España. D.F.: FCE, 1950. pp. 811-813]." Arreola nos leía en el mirador de su casa el capítulo tres de esa "Guía espiritual" de M. de Molinos, de la que extraigo los dos fragmentos que me hicieron un buen cristiano (a pesar de todas las imperfecciones de dicho texto y de las mías), hombre salvo por pura gracia divina y no por obras, pues eso sería un desastre: 1) "El verdadero celo de las almas que has de procurar ha de ser el amor puro a tu Dios" y 2) "No te adelantes con fatiga, que cuando sea el tiempo oportuno y puedas ser de algún provecho para tu prójimo, Dios te sacará y pondrá en el empleo que más te convenga; a él sólo toca el cuidado y a ti estarte en tu quietud"; y me percato que la verdad de Cristo ya estaba también allí: "envió el Padre Eterno a su hijo Jesucristo al mundo" para que nosotros podamos servirle mejor!!! Amén. Fernand.
Aquí les dejo mi versión ilustrada con dos libros "imposibles" de conseguir de Arreola de la magistral entrevista que el Prof. @[552591401:2048:Ricardo Sigala] nos hiciera a Camelia T. Torres Sánchez de ocho años y a mí (apenas recuperada ayer, e ilustrada hoy): https://youtu.be/UqbLaTG8Yz4 Los dos libros que se leerán en su totalidad en las transparencias son, de Arreola: "Y ahora la mujer..." y "La palabra educación", cortesía de Virginia Arreola Zúñiga, autora del Prefacio a mi obra de "Arreolanza" a salir, primero Dios, el próximo mes, pues la acción del capítulo uno comienza en primavera: en abril... (trazar en mi comentario del video los ocho tiempos clave de la misma, cuyo impacto acaba de llegar hasta Italia!!! ¡Oh maravillas de la tecnología moderna cuando es usada para el bien!):
Updated Mar 17, 2018, 7:19 AM
Y de cómo es que, por ejemplo, "El Lay de Aristóteles", muy poético e
inteligentísimo texto de Juan José Arreola (aquí narrado con su voz): https://youtu.be/779KrXxu9Lc Ha dado origen a libros enteros de investigación analítica, como los siguientes de ejemplo: http://www.redalyc.org/pdf/602/60221023008.pdf, https://www.librosmexico.mx/libros/76272 y http://tesiuami.izt.uam.mx/uam/aspuam/presentatesis.php?recno=5737&docs=UAM5737.PDF, entre muchos otros...
inteligentísimo texto de Juan José Arreola (aquí narrado con su voz): https://youtu.be/779KrXxu9Lc Ha dado origen a libros enteros de investigación analítica, como los siguientes de ejemplo: http://www.redalyc.org/pdf/602/60221023008.pdf, https://www.librosmexico.mx/libros/76272 y http://tesiuami.izt.uam.mx/uam/aspuam/presentatesis.php?recno=5737&docs=UAM5737.PDF, entre muchos otros...
Updated Mar 11, 2018, 10:46 PM
En mis, de hoy, agregados tempranos a mi libro "Arreolanza", hago una evocación y traducción de uno de los textos más queridos que Arreola nos leía y que nos traducía de su idioma original... espero que esto sea de su apreciación y entender (pero nomás no puedo terminar con el libro, memorias llueven a diario sin saber cuándo van a parar... así como de mis ojos...)
[Mi traducción del mismo es:
"El recuerdo de un libro
Por Marcel Schwob
El recuerdo de la primera vez que leímos un libro amado se mezcla con el recuerdo del lugar y con el recuerdo de la hora y de la iluminación. Hoy como entonces, la página se me presenta a través de una bruma reverdecida de diciembre, o resplandeciente bajo el sol de junio, y, cerca de ella, las figuras de queridos objetos y muebles que ya no están. Es como si, después de haber mirado durante largo tiempo una ventana, recordamos, al cerrar los ojos, su espectro transparente con mosqueteros negros, así la hoja traspasada por sus líneas se ilumina, en la memoria, con su arcana claridad. El olor también es evocador. El primer libro del que tengo memoria me lo trajo de Inglaterra mi ama de llaves. Tenía yo cuatro años. Recuerdo nítidamente su actitud y los pliegues de su vestido, a una mesa de trabajo colocada frente a la ventana, el libro tenía un forro rojo, nuevo, brillante, y el penetrante olor que exhalaban sus páginas: un olor acre de creosota y de tinta fresca que los libros en inglés recientemente impresos preservan durante mucho tiempo. De ese libro hablaré más adelante: con él aprendí a leer. Pero su olor me provoca aún hoy la emoción de un mundo nuevo vislumbrado, y el hambre de la inteligencia. Aún ahora no recibo de Inglaterra un libro nuevo sin sumergir mi figura entre sus páginas hasta el hilo que lo encuaderna, para inhalar su bruma y sus vapores, y aspirar todo aquello que pueda quedar de la alegría de mi infancia."]
[Mi traducción del mismo es:
"El recuerdo de un libro
Por Marcel Schwob
El recuerdo de la primera vez que leímos un libro amado se mezcla con el recuerdo del lugar y con el recuerdo de la hora y de la iluminación. Hoy como entonces, la página se me presenta a través de una bruma reverdecida de diciembre, o resplandeciente bajo el sol de junio, y, cerca de ella, las figuras de queridos objetos y muebles que ya no están. Es como si, después de haber mirado durante largo tiempo una ventana, recordamos, al cerrar los ojos, su espectro transparente con mosqueteros negros, así la hoja traspasada por sus líneas se ilumina, en la memoria, con su arcana claridad. El olor también es evocador. El primer libro del que tengo memoria me lo trajo de Inglaterra mi ama de llaves. Tenía yo cuatro años. Recuerdo nítidamente su actitud y los pliegues de su vestido, a una mesa de trabajo colocada frente a la ventana, el libro tenía un forro rojo, nuevo, brillante, y el penetrante olor que exhalaban sus páginas: un olor acre de creosota y de tinta fresca que los libros en inglés recientemente impresos preservan durante mucho tiempo. De ese libro hablaré más adelante: con él aprendí a leer. Pero su olor me provoca aún hoy la emoción de un mundo nuevo vislumbrado, y el hambre de la inteligencia. Aún ahora no recibo de Inglaterra un libro nuevo sin sumergir mi figura entre sus páginas hasta el hilo que lo encuaderna, para inhalar su bruma y sus vapores, y aspirar todo aquello que pueda quedar de la alegría de mi infancia."]
You tagged Charly Carlos Vzqz
Y, mi agregado de hoy para mi versión final de "Arreolanza" es (y de nuevo, espero que les guste): "Éste “Charly” es mi colega de adolescencia, escritor, escultor, pintor e ingeniero, columnista editorial para el "Mural", quien escribió el bello aforismo del “Recorrido: Recorrí tu distancia y me acerqué a nosotros.” Así como su magnífico “Destellos: Escasas asoman / las verdes miradas / en el otoño de los cerros // Las hojas son pupilas de bosque / coquetas miradas al sol / destellos de clorofila / con la luz tatuada / en el parpadeo”, y las memorables líneas de “Descalza: Recorre descalza mis palabras. / Siéntelas arder bajo tus plantas. / Písalas, hazlas polvo: / que ni así impedirás que broten / raudas, silvestres y ciertas” (además de: "Oculta: Nunca lo dijiste, pero ahí estabas, sarcástica, viéndome buscarte, vida"; y “Un día el amor callejero" (fragm.): Un día, el amor callejero / caerá homogéneo / entre fracasos y medallas / en quienes ganan y en quienes nunca; / en los rotos y en los sobrados / en la pericia, en la ignorancia y sobre la apatía. / Abrazará a los que arriban / a los andantes / y a los que aún no parten”; éstas dos, elegidas por él); Carlos aún recuerda cuando Arreola, al estilo de Simmel con “El asa”, dedicó toda una sesión para nuestro grupo de “Los Escribiados”, coordinados por Eduardo Azuri Miranda (Azouri), hablando de “El lápiz” desde todos los puntos de vista que se le pudieron ocurrir, desde el fondo de la tierra para su carbón, hasta los bosques en neblina para su envoltura; ¡y luego para el borrador!: “un borrador que muy frecuentemente nos falla, manchando nuestras obras con un triste remordimiento...” (Arreola)". [En la foto, Charly Carlos Vzqz lee de su libro "Soplos...": http://www.dialogomu.com/carlos-vasquez-segura/]
Fernando Castro-Chavez was 🎉 celebrating friendship.
Fernando made 50 friends on Facebook this year
Muchos saludos a mis valiosos y nuevos amigos obtenidos durante este año del 2018, esperando que duren toda la vida, pues una amistad, es como una plantita que se va regando y fertilizando con el esfuerzo de ambos para que germine y crezca, ¡Dios bendiga a todos ustedes en Cristo! (Ya nomás me quedan 10 para llegar a 5 mil, ¿quiénes llegarán a ser ellos...?)
Algún fragmento de una de nuestras canciones favoritas de antaño; desde Italia con amor... en su original: https://youtu.be/o5SXq4xjkoI, así también, otra buenísima que puse abajo, aquí en su original: https://youtu.be/BP1MrzirtEo, más una que nunca cantamos; una que era favorita de mi ex-esposa Tracy Duncan, del "cool down" del excelente ejercicio de pesas "Body Pump": https://youtu.be/hOlEizLFM7Q |
Algún fragmento de una de nuestras canciones favoritas de antaño; desde Italia con amor... en su original: https://youtu.be/o5SXq4xjkoI, así también, otra buenísima que puse abajo, aquí en su original: https://youtu.be/BP1MrzirtEo, más una que nunca cantamos; una que era favorita de mi ex-esposa Tracy Duncan, del "cool down" del excelente ejercicio de pesas "Body Pump": https://youtu.be/hOlEizLFM7Q
Buscando redondear mi propia obra de "Arreolanza", para poder entregársela a Iliana Hijuelos a más tardar el martes por la mañana, me encuentro con esta gran obra de otra alumna de Arreola, de la que extraigo los siguientes y excelentes fragmentos, espero que les guste tanto como a mí, para también promover las obras poco conocidas de nuestras queridas paisanas: "Quien en bello libro, con una prosa y nueve poemas, nos recuerda también a su maestro Arreola, al decir entrañablemente en su ensayo “De Ofelia y el agua”: “…bajo la refracción de una canica – aquellas que llamábamos aquamarinas -; o a la luz de otros "prodigiosos miligramos", como aquel remiendo de celosía amarilla… que a ciertas horas de la ducha transfiguraba los cuerpos bajo el oro y la ambrosía que los ungían.” Así como la infinidad de referencias gratas procedentes del “ordo amoris” del maestro: “…el agua de pronto calla: al verla en la fronda estremecida de una cabellera “se la escucha temblar” (citando a Bachelard)”, “…Aquél cuyo primer milagro – según el Evangelio de San Juan – fue la conversión del agua en vino”, “El parentesco entre el agua y el cielo se remonta al segundo día de la creación del universo cuando Dios dijo: “Haya firmamento en medio de las aguas…”” (Gén. 1:6) “…Y seguramente pronunciaremos los milagros revelados en el Origen de todos los días que “la tierra estaba confusa… pero el espíritu de Dios se cernía sobre la superficie de las aguas”” (Gén. 1:2); “Edith y los girasoles: Para llegar ahí, Para llegar adonde estás, Para salir desde donde no estás…” (T. S. Eliot)... te estaré mirando en las rojeces que en férvido amor resucitas / ahí, donde henchida y madura en las estaciones periféricas / las flores se completan en sus giros”; “Dríades: Ineluctable modalidad de lo visible. / Cierra los ojos y ve... (James Joyce)… me alejaré como una duda que no necesitaba respuesta / Dejando tras de mí la ráfaga súbita / De todos los mundos momentáneos / Contenidos en la fuga de las gotas”; “Egon en Edith: “…Ella iba… suelta como larga cabellera / y entregada como lluvia que cae, / y repartida…” (Rilke)… no hay tiempo robado / A mi espalda, sí, la vida reiterada en el eco que te nombra / Egon, date cuenta, las cosas habitadas se desbordan / De tarde en tarde…”; “Voluntad de psiquis: “…Si relámpago fuiste en algún sueño, / relámpagos se olvidan, apagados” (Alberti)… no hay Color, Amor, Ciego De ti / que siempre me esperabas llegar venir Y yo / entonces me senté a tu lado (y yo te amaba) para Verte esperarme llegar venir / Y yo, que nunca llegaba”; “Ío: “Lentamente, con los ojos cerrados y las pestañas temblorosas / las comisuras de los labios agitadas por una sonrisa nerviosa, / la niña ofreció voluptuosamente el vello de su nuca, su cuello / y sus hombros…” (Schwob)… Dónde comienzas, Ah Mar / Que no cesas Las dunas de mi cuerpo / Vastas y estremecidas inminencias de mi espalda / Que no he visto y eso Basta”…" (Preciado, M. C. Dríades. Zapotlán el Grande: Centro Universitario del Sur, 2007:71 p. URL: https://ia801302.us.archive.org/19/items/DriadesVersionDefinitivaYUltima/dríades-versión%20definitiva%20y%20última.pdf y https://www.scribd.com/document/362938073/DRIADes-Maria-Cristina-Preciado)
More of the heartfelt moments of yesterday's all day long amazing birthday of Iliana Hijuelos:
Celebrando a nuestra muy estimada Iliana Hijuelos, recordando amistades comunes de antaño: del "Anáhuac", de "la Renovación", de "la Peña", de Tlaquepaque, del "Colegio de Ingenieros", y de muchas otras esquinas y rincones del orbe tapatío: |
Celebrando a nuestra muy estimada Iliana Hijuelos, recordando amistades comunes de antaño: del "Anáhuac", de "la Renovación", de "la Peña", de Tlaquepaque, del "Colegio de Ingenieros", y de muchas otras esquinas y rincones del orbe tapatío:
You tagged Charly Carlos Vzqz
Fotos de las cuatro esculturas de jirafas realizadas por mi colega de la infancia Charly Carlos Vzqz para la Escuela "Don Bosco" en Guadalajara, lo que me recuerda un sabroso fragmento que puse en mi libro de "Arreolanza" acerca de la jirafa (en una de las fotos, aparece su prima, la que da clases en la misma): “Fragmentos de “La jirafa”
Por Juan José Arreola”
“Al darse cuenta de que había puesto demasiado altos los frutos de un árbol predilecto, Dios no tuvo más remedio que alargar el cuello de la jirafa.”
“…las jirafas quisieron ir por encima de su realidad corporal y entraron resueltamente al reino de los desproporcionados. Hubo que resolver para ellas algunos problemas biológicos que más parecen de ingeniería y de mecánica: un circuito nervioso de doce metros de largo; una sangre que se eleva contra la ley de la gravedad mediante un corazón que funciona como bomba de pozo profundo; y todavía, a esas alturas, una lengua eyéctil que va más arriba, sobrepasando con veinte centímetros el alcance de los belfos para roer los pimpollos como una lima de acero.”
“Con todos sus derroches de técnica, que complican extraordinariamente su galope y sus amores, la jirafa representa mejor que nadie los devaneos del espíritu: busca en las alturas lo que otro encuentran al ras del suelo.”
“Pero como finalmente tiene que inclinarse de vez en cuando para beber el agua común, se ve obligada a desarrollar su acrobacia al revés. Y se pone entonces al nivel de los burros.”
(Arreola, J. J. “La jirafa”. (En Obras). D.F.: FCE, 2014:368).
Por Juan José Arreola”
“Al darse cuenta de que había puesto demasiado altos los frutos de un árbol predilecto, Dios no tuvo más remedio que alargar el cuello de la jirafa.”
“…las jirafas quisieron ir por encima de su realidad corporal y entraron resueltamente al reino de los desproporcionados. Hubo que resolver para ellas algunos problemas biológicos que más parecen de ingeniería y de mecánica: un circuito nervioso de doce metros de largo; una sangre que se eleva contra la ley de la gravedad mediante un corazón que funciona como bomba de pozo profundo; y todavía, a esas alturas, una lengua eyéctil que va más arriba, sobrepasando con veinte centímetros el alcance de los belfos para roer los pimpollos como una lima de acero.”
“Con todos sus derroches de técnica, que complican extraordinariamente su galope y sus amores, la jirafa representa mejor que nadie los devaneos del espíritu: busca en las alturas lo que otro encuentran al ras del suelo.”
“Pero como finalmente tiene que inclinarse de vez en cuando para beber el agua común, se ve obligada a desarrollar su acrobacia al revés. Y se pone entonces al nivel de los burros.”
(Arreola, J. J. “La jirafa”. (En Obras). D.F.: FCE, 2014:368).
Updated Mar 7, 2018, 1:18 AM
Estimados lectores, si quieren escucharnos a las tres de la tarde, con mi editora de "Arreolanza" @[100007097824037:2048:Iliana Hijuelos]: https://web.facebook.com/tuvidatienevalor/posts/1604120939622989
Updated Mar 5, 2018, 2:44 PM
Aquí estamos tomando el taller acerca del escribir textos con suspenso, impartida por mi tocayo Fernando de León; en: https://www.facebook.com/Casa-Taller-Literario-Juan-José-Arreola-Oficial-379458532405366/?ref=br_rs Fernando de León (Guadalajara, Jalisco, 1971). Narrador y ensayista, autor de los libros de cuentos: La estatua sensible (Premio Nacional de Cuento de los XX Juegos Florales de San Román, Campeche, 1995), La oscuridad terrenal, Cárceles de invención, La sana teoría, Apuntes para una novísima arquitectura (Premio Nacional de Cuento Agustín Yáñez, 2004), Mudo espío e Historia de lo fijo y lo volátil. Es fundador de Arqueología del Recuerdo, espacio dedicado a talleres y asesoría en la escritura de biografías y memorias, y miembro del Sistema Nacional de Creadores de Arte.
Fernando Castro-Chavez shared a memory.
5 Years Ago
Feb 25, 2016, 2:18 PM
Agradezco a mis amados santos por sus oraciones incondicionales, lo que ha hecho posible el presentar la segunda parte de mi estudio "...Y los ángeles de abajo", relacionada con el origen de los Neandertales y seres semejantes según la Biblia: https://youtu.be/cBpVuTgrOdA Este servicio es en Amor al Cuerpo de Cristo, cumpliendo fielmente con la función para la que he sido colocado en él por Cristo. ¡Qué nadie imponga a otro hermano cosa alguna sino el amarnos en Cristo los unos a los otros! Y eso de "en Cristo", es bajo su guía divina, ayudándonos unos a otros, y no señoreándonos unos de otros. Fernando. P.D. Y desde luego, es un tema para audiencias adultas.
Uno más de mis estudios bíblicos que por gracia divina me ha sido concedido hacer para ustedes:
Updated Mar 3, 2018, 7:08 AM
You tagged Carlos Axel Flores Valdovinos
Transparencias que se presentaron: http://fdocc.ucoz.com/7/fernando_castro_clase_zapotlan_a.pdf y http://fdocc.ucoz.com/7/fernando_castro_clase_zapotlan_b.pdf ¡Hoy! E invitando a más de mis amigos Zapotlenses ilustres que ayer el FB no me dejó: Jud Rodríguez Didí Sedano Anna Chenal Lili Casillas, Armando Casillas Sánchez, Marijo Melo Martinez, Carlos Antillon, Alejandro Espinoza, Martin Hernandez Torres, Ariana Licea, Alondra Hernandez Bernardo Baltazar Gonzales, Hilda Angelica Zepeda, Emmanuel Romero, Samantha Divella, Mago Liz Perez, Iroel Perez, Silvia Gabriela Becerra Bautista, Gabriela Isordia Alvarado, Jazmin Velasco, Rorro Pirrorro, Claudia Benito Abrica, Gina Varela Meza, Adrian Figueroa, Victor Ricardo Cabeza, Daniela Yazmín, Aaron Hernandez, Ma Lidia Chavoya, Ana Delacruz, Arturo Ramirez, Monsee de la Cruz, Meldami Ar, Abril Cortes Mejia, Zandrah Rodriguez, Viridiana Romero, Cristy Vega, Elizabeth Belmares, Martha Leticia Garcia Villegas, Karina Tortoledo Ceja, Suhall Martinez, Tere Avendaño-Calvo, Diianiitha Melo, Arizbe Garcia Avalos, Bertha Acosta, Rogelio Alejandro Vargas Alzaga, Randall Emmanuel Villa Gomez, Horacio Contreras, Felipe Angulo, Libros Ciudad Guzmán... y a todo aquel que le puedan recomendar ir, muchas gracias a mi amada hermana en Cristo Jazmiin Rodriguez por su apoyo moral y espiritual y logístico!!!
Fernando Castro-Chavez shared a memory.
9 Years Ago
Mar 1, 2012, 8:00 AM
Resurrection in Budapest, Hungary (2010): http://www.youtube.com/watch?v=SymvsnAOnL0 Remembering that God raised Jesus at the Sabbath's end, a 17th of Nisan, after 72 hours of being on the grave.
The girlfriend of my life Mary Cris sent me this message: "No Nation or people can ever survive or succeed without Jesus Christ", which I combine with an old message of mine about "The Resurrection of our Lord Jesus Christ (which Indeed Happened at the end of a Saturday's sun light (end of the 17th of Nisan, 28 A.D., at its sunset); God His Dad Was Working on Saturday To Raise His Son And To Shut The Mouth of all those Scribes and Pharisees)":
Updated Mar 1, 2018, 7:15 AM
Amigos de Zapotlan Jal, aquí para invitarlos este jueves primero de marzo a sintonizar el programa del Prof. Ricardo Sigala a las 6:00 PM en Radio U. de G. y este viernes 2 de marzo a las 8:00 PM en la Casas de la Cultura de Zapotlán a mi presentación titulada: "Arreolanza", participarán Axel en la guitarra, y la bella Camelia dirá un Soneto de Arreola de 1943: La contraportada de mi libro dice así; espero les guste: "Pocos libros exploran los procesos mentales del artista, la mente del escritor; éste es uno de ellos, ya que felizmente recuerda de manera ordenada los doce principios básicos de “La Clase de Arreola”: Leer, Originales, Comparar, Discernir, Vocalizar, Seleccionar, Recordar, Imitar, Inspirarse, Vivir, Escribir y Enseñar; claves que se ilustran, tanto con sus lecturas favoritas como con porciones de su obra, en donde su “Realismo plástico” brilla con su “Varia invención”, generando una “Elasticidad ramificante”.
Por ejemplo, en “Comparar” se aprecia su interconexión de textos, partiendo de “La feria” y ramificándose hacia sus “Aves acuáticas”, “La vida privada” y “Libertad”…; también se ordenan por continuidad sus dos textos de “El rinoceronte”; reviviendo su pasión por las obras de Pellicer, Claudel, Papini, Duhamel, Kafka, Darío, Quevedo, Aldana, los escritores rusos, Isaías, Job, el Cantar, etc.
Como especial del centenario, se anexan algunas fotos, poemas y escritos tempranos de Fernando, los que coinciden con su aprendizaje de Arreola, así como la lectura de “La feria” a través de sus viñetas; Virginia Arreola Zúñiga, en su Prefacio para este libro concluye: “que el amable lector siga hallando la confianza de leer, escribir y enseñar, de la mano de Juan José Arreola”." Además, y sin buscar ser un latoso "espamero" basuroso (como a Arreola que le gustaba inventar palabras curiosas), aquí pongo los nombres de mis tantos más cuantos amigos zapotlenses en el orden en FB para Zapotlan Jal": Hugo Salcedo, Mariana Pineda, Marisely Castro, Ricardo Sigala, Carlos Axel Flores Valdovinos, Laura Celina Barajas, Jazmiin Rodriguez, Cla Arroyo, Ramon Mendez Alcaraz, Fausto Avila, Marcelo Aminadab Hernandez Hernandez, Phyther Dlc, Michel Black, Óscar Rodríguez Romero, Jose Arroyo Estevez, Monica Bojado, Adriana Ramirez, Lupillo Chavez, Gladys Solis Espinoza, Ezequiel Anaya, Miri Wolff, Cattleya Janeth, Sergio Alejandro Rolon Flores, Yazujaira Moya, Viridiana Lopez, Zuly Moreno Isordia, Berenice Lomely, Adriana Cecilia Vargas Alzaga, Lau Bernal, Nohemi Perez Lopez, Nalleli Hernandez Aldrete, Fernanda Orozco, Karla Hernández, Daniela Elizabeth Sånchez, Judyth Zuñiga Ruiz, Estefany Sánchez, Benita Romero Ventura, Jazmin Santos Silva, Cuca Del Toro C, Carlos Enrique Maciel Garcia, Hilda De Negro A Color, Popus Y Guapos de Guzman, Recomza Construccion, Laura Arroyo, Lucia Concepcion Vargas Alzaga, Lupita Arroyo R, Elba Vargas, Mirtha Karina Cervantes Arias, Ever GutGra y desgraciadamente a todos los que siguen (o los locales que no pusieron su lugar), no los pude "tagear", por si los conocen que por favor les digan: Coordinación de extensión CUSur, Mayra Torres Castrejon, Antonio Jiménez Díaz, Ricardo Calderon, Elizabeth Sandoval, Miguel Angel Munguia, Vicky Solis, Martin Garcia, AdRiana Chávez, Adrian Rodríguez, Bardo Muñiz, Karlita PM, Jose Manuel Hernandez, Karla Fabiola Estrada Fabián, Israel Moreno Salinas, Martha G. Solano, Cristian Hernández Sánchez, Daniel Solorzano, Raúl Piruli Tinajero, Marisela Figueroa Angel, Alejandra Garcia de Leon, Lizeth Anahi Soto Varela, Daniel Torres Gomez, Roberto Perez González, Osiris Rodriguez, Xochitl Ochoa Macias, German Esteban Marcial, Xavier Mercenario Solis Torres, Vaanee Castillo, Jose Santiago, Andrea Vazquez Aguilera, Andrea Contreras, Salvador Sánchez Márquez, Susana Yazmin López Cabezas, Fanny Torres, Arcano Onart de la Rosa, Mau Ortiz, Elam Roo, Rosalina García, Alan Ramos Luis Juan Bernardino, Victoria Castañeda, Kniverli Guzman y porque solamente se permiten 50 "tagueados", tampoco a éstos: Anna Chenal, Lili Casillas, Armando Casillas Sánchez, Marijo Melo Martinez, Carlos Antillon, Alejandro Espinoza, Martin Hernandez Torres, Ariana Licea, Alondra Hernandez, Bernardo Baltazar Gonzales, Hilda Angelica Zepeda, Emmanuel Romero, Samantha Divella, Mago Liz Perez, Iroel Perez, Silvia Gabriela Becerra Bautista, Gabriela Isordia Alvarado, Jazmin Velasco, Rorro Pirrorro, Claudia Benito Abrica, Gina Varela Meza, Adrian Figueroa, Victor Ricardo Cabeza, Daniela Yazmín, Aaron Hernandez, Ma Lidia Chavoya, Ana Delacruz, Arturo Ramirez, Monsee de la Cruz, Meldami Ar, Abril Cortes Mejia, Zandrah Rodriguez, Viridiana Romero, Cristy Vega, Elizabeth Belmares, Martha Leticia Garcia Villegas, Karina Tortoledo Ceja, Suhall Martinez, Tere Avendaño-Calvo, Diianiitha Melo, Arizbe Garcia Avalos, Bertha Acosta, Rogelio Alejandro Vargas Álzaga, Randall Emmanuel Villa Gomez, Horacio Contreras, Felipe Angulo, Libros Ciudad Guzmán, etc.. (Vale! Al cabo que nomás me tomó cuatro horas hacer este ejercicio ;) una, dos tres,"Save", como en "God Save the King!!!".)
Por ejemplo, en “Comparar” se aprecia su interconexión de textos, partiendo de “La feria” y ramificándose hacia sus “Aves acuáticas”, “La vida privada” y “Libertad”…; también se ordenan por continuidad sus dos textos de “El rinoceronte”; reviviendo su pasión por las obras de Pellicer, Claudel, Papini, Duhamel, Kafka, Darío, Quevedo, Aldana, los escritores rusos, Isaías, Job, el Cantar, etc.
Como especial del centenario, se anexan algunas fotos, poemas y escritos tempranos de Fernando, los que coinciden con su aprendizaje de Arreola, así como la lectura de “La feria” a través de sus viñetas; Virginia Arreola Zúñiga, en su Prefacio para este libro concluye: “que el amable lector siga hallando la confianza de leer, escribir y enseñar, de la mano de Juan José Arreola”." Además, y sin buscar ser un latoso "espamero" basuroso (como a Arreola que le gustaba inventar palabras curiosas), aquí pongo los nombres de mis tantos más cuantos amigos zapotlenses en el orden en FB para Zapotlan Jal": Hugo Salcedo, Mariana Pineda, Marisely Castro, Ricardo Sigala, Carlos Axel Flores Valdovinos, Laura Celina Barajas, Jazmiin Rodriguez, Cla Arroyo, Ramon Mendez Alcaraz, Fausto Avila, Marcelo Aminadab Hernandez Hernandez, Phyther Dlc, Michel Black, Óscar Rodríguez Romero, Jose Arroyo Estevez, Monica Bojado, Adriana Ramirez, Lupillo Chavez, Gladys Solis Espinoza, Ezequiel Anaya, Miri Wolff, Cattleya Janeth, Sergio Alejandro Rolon Flores, Yazujaira Moya, Viridiana Lopez, Zuly Moreno Isordia, Berenice Lomely, Adriana Cecilia Vargas Alzaga, Lau Bernal, Nohemi Perez Lopez, Nalleli Hernandez Aldrete, Fernanda Orozco, Karla Hernández, Daniela Elizabeth Sånchez, Judyth Zuñiga Ruiz, Estefany Sánchez, Benita Romero Ventura, Jazmin Santos Silva, Cuca Del Toro C, Carlos Enrique Maciel Garcia, Hilda De Negro A Color, Popus Y Guapos de Guzman, Recomza Construccion, Laura Arroyo, Lucia Concepcion Vargas Alzaga, Lupita Arroyo R, Elba Vargas, Mirtha Karina Cervantes Arias, Ever GutGra y desgraciadamente a todos los que siguen (o los locales que no pusieron su lugar), no los pude "tagear", por si los conocen que por favor les digan: Coordinación de extensión CUSur, Mayra Torres Castrejon, Antonio Jiménez Díaz, Ricardo Calderon, Elizabeth Sandoval, Miguel Angel Munguia, Vicky Solis, Martin Garcia, AdRiana Chávez, Adrian Rodríguez, Bardo Muñiz, Karlita PM, Jose Manuel Hernandez, Karla Fabiola Estrada Fabián, Israel Moreno Salinas, Martha G. Solano, Cristian Hernández Sánchez, Daniel Solorzano, Raúl Piruli Tinajero, Marisela Figueroa Angel, Alejandra Garcia de Leon, Lizeth Anahi Soto Varela, Daniel Torres Gomez, Roberto Perez González, Osiris Rodriguez, Xochitl Ochoa Macias, German Esteban Marcial, Xavier Mercenario Solis Torres, Vaanee Castillo, Jose Santiago, Andrea Vazquez Aguilera, Andrea Contreras, Salvador Sánchez Márquez, Susana Yazmin López Cabezas, Fanny Torres, Arcano Onart de la Rosa, Mau Ortiz, Elam Roo, Rosalina García, Alan Ramos Luis Juan Bernardino, Victoria Castañeda, Kniverli Guzman y porque solamente se permiten 50 "tagueados", tampoco a éstos: Anna Chenal, Lili Casillas, Armando Casillas Sánchez, Marijo Melo Martinez, Carlos Antillon, Alejandro Espinoza, Martin Hernandez Torres, Ariana Licea, Alondra Hernandez, Bernardo Baltazar Gonzales, Hilda Angelica Zepeda, Emmanuel Romero, Samantha Divella, Mago Liz Perez, Iroel Perez, Silvia Gabriela Becerra Bautista, Gabriela Isordia Alvarado, Jazmin Velasco, Rorro Pirrorro, Claudia Benito Abrica, Gina Varela Meza, Adrian Figueroa, Victor Ricardo Cabeza, Daniela Yazmín, Aaron Hernandez, Ma Lidia Chavoya, Ana Delacruz, Arturo Ramirez, Monsee de la Cruz, Meldami Ar, Abril Cortes Mejia, Zandrah Rodriguez, Viridiana Romero, Cristy Vega, Elizabeth Belmares, Martha Leticia Garcia Villegas, Karina Tortoledo Ceja, Suhall Martinez, Tere Avendaño-Calvo, Diianiitha Melo, Arizbe Garcia Avalos, Bertha Acosta, Rogelio Alejandro Vargas Álzaga, Randall Emmanuel Villa Gomez, Horacio Contreras, Felipe Angulo, Libros Ciudad Guzmán, etc.. (Vale! Al cabo que nomás me tomó cuatro horas hacer este ejercicio ;) una, dos tres,"Save", como en "God Save the King!!!".)
Fragmento inicial del primer y gran recorrido teatroturístico de "La feria" de Arreola en Zapotlán el Grande, iniciando en la "Casa Taller Literario Juan José Arreola", ayer (25 de feb., 2018): |
Fragmento inicial del primer y gran recorrido teatroturístico de "La feria" de Arreola en Zapotlán el Grande, iniciando en la "Casa Taller Literario Juan José Arreola", ayer (25 de feb., 2018):
Muy contento y agradecido con las "Textoservidoras" de primera Didí Sedano y @[100000550798344:2048:Jud Rodríguez], por una muy placentera estancia en su programa: https://youtu.be/I6EQZhtJLxw así como con mi pariente Eduardo Moreno Chávez, productor del programa (mi participación en el mismo comienza en el minuto 7:11 de abajo):
Updated Feb 24, 2018, 6:52 AM
Aquí está el programa: Yo presento mi libro "Arreolanza o la clase de Arreola" en una semana, el viernes dos de marzo desde las ocho de la noche; Didí Sedano presenta su charla en torno a Refugio Barragán de Toscano el miércoles 28 de feb. a las 8:00 PM (¡gracias a Jud Rodríguez por el programa!).
Updated Feb 23, 2018, 11:36 AM
Esta es la penúltima versión de la portada de mi libro: "Arreolanza o La Clase de Arreola"; hablo sobre el mismo en la radio U. de G. de Zapotlán el Grande este viernes 23 de febrero a las 7:00 PM gracias a Didí Sedano (en donde, me acabo de enterar, también estará Jud Rodríguez), luego el próximo viernes 2 de marzo a las 8:00 PM en "La Casa de la Cultura" (en compañía de Axel), gracias al dueño de la librería "Alfa y Omega", mi distribuidor exclusivo, don José Luis Zaragoza Hernández. Éste es un proyecto 100% independiente y artesanal, tal y como Arreola nos recomendaba...
Estoy contento de poder compartir nuestro estudio acerca del "Servicio de Reconciliación, tanto para el cristiano caído como para el incrédulo", mi lectura de 2 Cor. del 1 al 6:13 del griego:
https://youtu.be/YHmIvSXkwSg En él se observa que una vez renacidos al aceptar a Cristo como el Señor de nuestra vida, hemos de tener una comunicación diaria con él, recordarlo y reconocerlo en nuestro andar; cada que usamos el don (doma) de espíritu santo, ¡estamos dando un vivo testimonio de que nuestro Cristo está vivo a la diestra de Dios! ya sea para producir su siempre fresco y deleitante Fruto (amor, gozo, paz, longanimidad (que incluye a la paciencia), benignidad, bondad, fe, mansedumbre (que incluye a la humildad), templanza), o para evidenciar una de las nueve operaciones de la gracia de Dios (nueve "charismas": mensaje de sabiduría, mensaje de ciencia; fe, dones de sanidades, obras de milagros, profecía, discernimientos de espíritus; géneros de lenguas, interpretación de lenguas), o para producir los dones (doma) de servicio (apóstoles, profetas, evangelistas, pastores y maestros), así como para llevar a otros a aceptar a Cristo como Señor bajo su certera guía...
https://youtu.be/YHmIvSXkwSg En él se observa que una vez renacidos al aceptar a Cristo como el Señor de nuestra vida, hemos de tener una comunicación diaria con él, recordarlo y reconocerlo en nuestro andar; cada que usamos el don (doma) de espíritu santo, ¡estamos dando un vivo testimonio de que nuestro Cristo está vivo a la diestra de Dios! ya sea para producir su siempre fresco y deleitante Fruto (amor, gozo, paz, longanimidad (que incluye a la paciencia), benignidad, bondad, fe, mansedumbre (que incluye a la humildad), templanza), o para evidenciar una de las nueve operaciones de la gracia de Dios (nueve "charismas": mensaje de sabiduría, mensaje de ciencia; fe, dones de sanidades, obras de milagros, profecía, discernimientos de espíritus; géneros de lenguas, interpretación de lenguas), o para producir los dones (doma) de servicio (apóstoles, profetas, evangelistas, pastores y maestros), así como para llevar a otros a aceptar a Cristo como Señor bajo su certera guía...
Pudimos estar, mi mamá y yo, en la conferencia de la maestra @[728808474:2048:Didí Sedano] acerca de la primera mujer (R. B. de T.) en publicar una novela (L. H. D. B.) en México, y tengo yo el gran honor de poder participar este viernes en el programa que ella dirige: "Textoservidoras" de 19:00 - 20:00 PM: http://udgtv.com/radioudg/zapotlan-el-grande/ para presentar mi libro acerca de "Arreolanza o La Clase de Arreola"
Updated Feb 20, 2018, 5:04 PM
Otro de los jugadores de mi infancia, Raúl “Willy” Gómez Ramírez, por él, el héroe de los cuentos, más que por el jugador mismo, que tampoco se llamaba así, le comencé a decir "Willy" a mi sobrino.
Fernando Castro-Chavez shared a memory.
5 Years Ago
Feb 19, 2016, 6:00 PM
Recordando a los nuevos santos que acaban de aceptar a Cristo a que si lo desean se conecten con nosotros hoy viernes 19 de febrero a las 7 de la tarde por el Skype (fdocc2, Houston, TX), para que con confianza comienzen a manifestar ese tremendo poder espiritual que ya llevan por dentro. Lo voy a poner dentro del grupo "El Cristo Sin Barreras", nos vemos en una hora!
Memories of that day when it was torn the veil that divided the "Outer Court" from the "Holy" place, and this from the "Most Holy" place; now we, the born-again Christians of every flavor under the earth, are building, with ourselves as a Body, the "Most Holy" place for the dwelling of God; we know that outside of the New Jerusalem, both Gentiles and Jews are going to continue having the free will to decide for themselves if they have the desire to be immortal or not!!!
Updated Feb 19, 2018, 2:55 PM
Y, éstas son las dos fotos para las solapas de mi libro: "Foto de la solapa posterior: La foto a Juan José Arreola la tomó Fernando Castro en 1983, en la inauguración de trabajos para el “Foro de Consulta Popular”, en el “Instituto Cultural Cabañas” (Antiguo Hospicio), de Guadalajara, Jalisco."
"Foto de la solapa anterior: La pintura que está detrás de Fernando Castro representa el amanecer en uno de los lugares en los que él ha sido más feliz viviendo: ¡Puerto Vallarta!, producto del gran pintor vallartense de fantasías con corazón de niño, don Javier Niño, quien fuera su maestro de pintura, y quien es esposo de Rosa de Niño, una escritora infantil. La foto la tomó el papá de Fernando, el Sr. Manuel Castro Dávila (mi papito)."
"Foto de la solapa anterior: La pintura que está detrás de Fernando Castro representa el amanecer en uno de los lugares en los que él ha sido más feliz viviendo: ¡Puerto Vallarta!, producto del gran pintor vallartense de fantasías con corazón de niño, don Javier Niño, quien fuera su maestro de pintura, y quien es esposo de Rosa de Niño, una escritora infantil. La foto la tomó el papá de Fernando, el Sr. Manuel Castro Dávila (mi papito)."
Otro de mis dibujos de infancia, de dos más del Campeonísimo de "las Chivas" del Guadalajara, en el prototipo de su jugador "Chivito", el héroe de los desaparecidos cuentos "Chivas Chivas Ra Ra Ra", que eran mis favoritos: Sabás Ponce Labastida y Salvador “Chava” Reyes Monteón (Q.E.P.D.):
Algunas de las portadas sugeridas por la excelente editorial EEL (aún no la final), para el libro de mi "Clase de Arreola", que me parece que primero Dios y lo presento el dos de marzo a las ocho de la noche en la "Casa de la Cultura" del Grande Zapotlan Jal (si andan por acá, ¡¡¡aquí les espero!!!), gracias a mi distribuidora local "Librería Alfa y Omega", al lado del gran cantante especializado en las melodías del sobrino de Arreola (Juan Octavio Espinoza Arreola), con prefacio de Virginia Arreola Zúñiga, hermana del escritor y mamá del fallecido Juan Octavio; en mi libro incluyo un fragmento de una de las obras favoritas de Arreola, el profético poema "Corimbo de Otoño" de Francis Thompson: https://www.poemhunter.com/best-poems/francis-thompson/a-corymbus-for-autumn/ He pedido que a ver si el cantante se sabe el bello "Soneto a Sara", ese que termina diciendo: "Amor dime quien soy, ¡tú me conoces!" y que musicalizara Hermilio Hernández para Juan José Arreola. ¡Esperamos que sea una bella velada literario musical para ustedes, gracias! Ah, ¡me olvidaba! Aquí está una breve reseña al mismo que puse el año pasado: https://es.linkedin.com/pulse/la-clase-de-arreola-fernando-castro-chavez
Dos jugadores más, del "Campeonísimo" equipo de las Chivas Rayadas del Guadalajara: José de Jesús “Chuco” Ponce Labastida y Tomás Balcázar González; mi dibujo es de cuando yo tenía unos siete años de edad; de mis archivos de infancia:
Fernando Castro-Chavez shared a memory.
5 Years Ago
Feb 10, 2016, 7:00 PM
La evidencia científica que demuestra que el Monte Everest estaba presente en los días del diluvio de Noé es la gran cantidad de sedimentos marinos en su cima; mientras que el Monte Ararat (en singular) no existía en ese entonces, siendo de emergencia reciente, y por tanto careciendo de sedimentos marinos. La Biblia dice que el Arca de Noé se asentó en los Montes de Ararat (en plural). Esto lo veremos este viernes en nuestro estudio (YouTube: https://www.youtube.com/c/CatadoresDeLaPalabra1, 7:50 PM).
Transparencia de cuando compartí que e monte Ararat en sí es relativamente reciente en su emerger del suelo, posterior al diluvio de Noé, y que por tanto el arca de Noé estaba en la cadena montañosa llamada Ararat, pero más abajo del actual monte con el mismo nombre, justamente donde ahora el gobierno turco reconoce que se encuentra, y que fuera investigado por Ron Wyatt (tuvo fallas humanas per en esta, hasta donde yo entiendo, le acertó, allí sigue parte del arca para quien quiera verla, la famosa madera "Gopher" que describe la Biblia no es otra cosa según mi entender que madera petrificada, que ya existía en tiempos de Noé, ya que la extinción de los dinosaurios fue previa...)
Updated Feb 10, 2018, 7:35 AM
Recordando a mi infancia, hoy que visito a mis papás, mi papá me inscribió al "Club Guadalajara", y en vez de hacer ejercicio, me puse a dibujar; mi "literatura" favorita de aquel entonces eran los cuentos de "Chivas Chivas Ra Ra Ra", y tenía la colección de los grandes, y de los de tamaño menor; ¡pero los perdí por culpa de un pelón y mal vecino!, pero me quedó, gracias a Dios, lo siguiente, que dibujaba yo cada caricatura, ¡e iba a pedirle su autógrafo a cada uno de los jugadores a los que ese mono representaba (los jugadores se reían, y me firmaban)!; aquí está la del jugador de base: el guardameta o portero, Ignacio "el Pulpito" Calderón (poco a poco iré poniendo a los otros, ya que como el buen Forrest, ¡me parece que yo andaba por todos lados con mi cajita de chocolates, y sigo así!):
Fernando Castro-Chavez shared a memory.
Further evidence of the supernatural wisdom revealed in the most ancient Bible manuscripts; on how God reveals His greatness by grace, not by works, not by how good we are, but just by his grace, to all of them that humble themselves completely under His Mighty Hand!!!:
Updated Feb 8, 2018, 9:34 AM
Fernando Castro-Chavez shared a memory.
7 Years Ago
Fernando Castro-Chavez updated his status.
Feb 7, 2014, 10:25 PM
Para nuestras exploraciones e investigaciones de "La Palabra (de Dios) y la Ciencia", uno de los gráficos que ayudarán a entender la Palabra escrita en los cielos (lo que NO ES astrología) es (del libro de Bullinger): http://www.biblebelievers.org.au/images/planisph.jpg Jesús es representado en el Hércules que le está aplastando la cabeza al dragón cerca del centro, Jesús es el que aplasta al escorpión, sujetando a la serpiente para evitar que alcanze a la Corona (Borealis), Jesús es el León (Leo) que aplasta la cabeza de la serpiente, Jesús es el cordero (Aries) que aplasta la cabeza del monstruo marino, Jesús es el Orión que aplasta la cabeza de una fiera, Jesús es el jinete del caballo que viene a vencer al mal...
Las Maravillas de la Astronomía Bíblica, los Cielos Contando la Gloria del Señor y el Firmamento Anunciando la Obra de Sus Manos, ¡Cuán Grande Eres... Buenos Días Dios, Aquí Estoy; Te Doy Todo lo que Tengo, y Todo lo que Soy!
Updated Feb 7, 2018, 7:42 AM
Yesterday in the evening the sky was all like this (the camera was unable to capture the faint purple and green colors of the clouds at the upper right, towards whose the sun ray pointed), but today at this time (8:00 AM) is completely foggy and clouded! There with you, at your 10:00 PM, it may be clouded too! With LOVE from here! Yours, Fer.
Fernando Castro-Chavez shared a memory.
5 Years Ago
Feb 3, 2016, 8:40 AM
Like Paul could have said it: To me, the most insignificant and wretched sinner, God decided to show through His Scriptures that the Five Gifts of Service are already contained within "every spiritual blessing" that God deposited within us since the day of our new birth! Bad translations have blurred this simple reality; here, preconceived ideas translated the Greek "tous" as "some", when most of the 740 times it is translated: "THE", indicating that all born again believers, willing to serve for the equipping of his fellow saints, and for the building-up of the Body of Christ, can serve in love as needed; it says in Greek that: 'he (Christ) gave the assuredly apostles, the also prophets, the also evangelists, the also shepherds and teachers', and we see in individual committed believers here and then, all of these functions as needed! We saw them all in Jesus, in Paul, in Peter, etc. It´s even absurd to think that for so many years there is not a single group of Christians deliberately activating all of them gifts!, but crafty is the Adversary... to whom we are defeating today in the Body of Christ all over the world, raising up as a sleeping giant to destroy every work of evil!!! In Christ, Fernando.
Recordando aquí las maravillas que aprendía directamente de Dios, en Houston, Texas, las más altas glorias espirituales en las más bajas horas de mi vida, así quiso Dios mostrarme a mí que no depende en lo absoluto de mi, ni de lo bueno ni de lo culto que yo pueda ser, sino de Él, ¡absolutamente todo es por gracia de Él! ¡Y qué bello es poder Reconocerlo a Él por ésto!
Updated Feb 3, 2018, 8:54 AM
Updated Jan 29, 2018, 4:05 PM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Jan 21, 2016, 7:57 AM
Y, Santos muy Amados de toda denominación que aceptan a Jesucristo como su Señor y Salvador Viviente, es decir: Como ¡su único Líder Verdadero!, el descubrir que a nosotros nos toca activar, como grupos del Cuerpo de Cristo, los Cinco Dones del Ministerio de la Reconciliación ¡es algo que proviene directamente de lo Alto, y que ha estado frente a nosotros disponible desde el día de Pentecostés! La arrogancia y vanidad de líderes humanos que anhelan ser el centro y hacerlo todo a "su manera" lo tenía "atorado" hasta hoy, pero gracias al depender directo de Dios en Cristo, ustedes activarán bajo Su guía el poder más enorme que el Universo ha conocido hasta ahora, bajo el consejo de ¡Cristo Jesús, nuestra cabeza única! Fernando. P.D. N.T. Interlineal: http://tinyurl.com/nt-interlin-lacueva
Sigo estudiando 2 Corintios, aprendiendo cada día a entender mejor al Dios del cielo, nuestro creador y papá, quien está rogándonos de rodillas, y Él mismo nos suplica, que por favor, que si queremos, ¡¡¡que nos comuniquemos total y directamente con Él a cada momento!!! Eso es la aplicación práctica de nuestro ¡¡¡ya estar reconciliados con Él!!! Aquí, en la transparencia, debe de decir: "el SERVICIO de la Reconciliación", esto que acabo de escribir arriba es parte de este, ¡¡¡mi SERVICIO para con ustedes!!! Por favor, recíbanlo y síganlo haciendo más y más y más, hasta que llegue a ser algo tan natural como respirar, comer, etc.
Updated Jan 21, 2018, 8:04 AM
Trabajando para mi próxima presentación acerca de 2 Corintios, aquí les dejo un avance del mismo, relacionado con algunas de las cosas ¡que el creyente salvo ya tiene para siempre! (Traté de poner mi PDF como siempre pero el FB ya no me lo permite), por lo que ahora copio y pego la información aquí (disculpen por la longitud de esto):
Cosas que el cristiano recibe al momento de su salvación
Todas estas son cosas hechas por Dios, instantáneas, dadas simultáneamente, basadas únicamente en el mérito de Cristo, y por lo tanto son eternas:
1. Tomamos parte del plan eterno de Dios (conocidos de antemano, elegidos de antemano, seleccionados, escogidos, llamados).
2. Hemos sido redimidos.
3. Hemos sido reconciliados.
4. Tenemos una relación viviente (viva y vital) con Dios (debido al medio, nuestra propiciación: Cristo).
5. Hemos sido perdonados (remisión, carencia de condenación, cancelación de “la Ley”, acceso a una limpia y clara conciencia, ayuda en el tiempo de necesidad).
6. Estamos libres de “la Ley”.
7. ¡Somos un don de Dios para Cristo! (“A los que me diste” dice Cristo siete veces en Jn. 17, cada uno de nosotros siendo como preciosas joyas, cada una valiosa y única, dadas a Jesús por Su padre).
8. Somos hijos de Dios (renacidos, una nueva creación, regenerados, vivificados, los pequeños (children) de Dios, con Dios como nuestro creador y nuestro padre).
9. Estamos tanto bajo Filiación como bajo Adopción (bajo todo lo mejor que el mundo judío y el gentil tenía que ofrecer a todos los que dependían como hijos: elegidos desde antes de la fundación del mundo y para las bendiciones, tratados como adultos merecedores de todo desde el primer día, como herederos completos).
10. Somos aceptables para con Dios (santos y sin mancha: justos, santificados, perfeccionados espiritualmente para siempre, sido hechos aceptables por gracia).
11. Hemos sido justificados (es el acto divino mediante el cual podemos estar frente a Dios siendo ya justos y perdonados, como si jamás hubiésemos pecado, sin ningún sentido de pecado, culpa o condenación).
12. Hemos sido hechos cercanos (ahora nos toca mantenernos cercanos alineándonos más y más a Su Voluntad, y si fallamos, diciéndoselo a Él con el verdadero propósito de no volverlo a hacer).
13. Hemos sido libertados del poder de las tinieblas (y peleando una batalla en su contra con una armadura espiritual invencible).
14. Tenemos la entrada a un nuevo reino (¡y ya estamos morando espiritualmente en el glorioso reino de Cristo en el que tenemos nuestro lugar! Y en el futuro se nos dará una gran bienvenida, mientras que ahora es un privilegio y desafío el expandir dicho reino (mediante el traer nuevas personas a Cristo)).
15. Estamos “en Cristo” (más de 170 veces el N.T. dice que estamos unidos “en Cristo”: en quien somos completos, en quien andamos y estamos ya sentados en los celestiales (con la certeza de nuestro lugar seguro allá arriba)).
16. Estamos sobre la roca: ¡Cristo Jesús!, es decir: tenemos el fundamento más sólido que es posible tener, el único que permanecerá, y sobre cuya base hemos de sobreedificar nuestras vidas: pensamientos, palabras, acciones (logros, carreras, proyectos).
17. ¡Estamos también en Dios, no sólo en Cristo!
18. Nuestra asociación celestial con Cristo cubre al menos siete áreas de interés y de acción común:
a) somos aliados (socios, compañeros de trabajo, copartícipes, acompañantes) de Cristo en la vida: nuestra gloriosa esperanza es él en nosotros, al tenerlo tenemos a ¡la verdadera vida!
b) somos aliados de Cristo en la posición: ¡estamos sentados en donde Cristo está sentado!: A la diestra de Dios.
c) somos aliados de Cristo en el servicio: somos obreros (colaboradores) juntamente con Dios (¡obrero!), y obviamente, juntamente también con Cristo Jesús (¡obrero!).
d) somos aliados de Cristo en el sufrimiento.
e) somos aliados de Cristo en la oración.
f) somos aliados de Cristo (estamos a y de su lado, y aún más: ¡estamos en él!) en los esponsales: somos juntamente con él: ¡el marido!.
g) somos aliados de Cristo en la expectación.
19. Una nación elegida, una nación santa, y un pueblo muy peculiar (somos una generación elegida ya que somos del linaje de Dios, somos su descendencia, y somos peculiares ya que no somos de este mundo, sino que: ¡le pertenecemos a Dios!).
20. Tenemos una Ciudadanía celestial (y nuestros nombres están escritos en ¡los cielos (tois ouranois)!, nuestra Ciudadanía es con Dios, ¡somos conciudadanos de Dios!, y por eso aquí sobre la tierra somos forasteros y peregrinos, por ser Ciudadanos del cielo; por eso nuestra labor aquí en la tierra es la de ser Embajadores para Cristo, ¡y aún hay más!; esto tiene que ver con nuestra relación con el cielo: con todo lo que hay y lo que mora allá, incluyendo a Dios y a todos Sus servidores, que incluye a Sus santos ángeles y querubines).
21. Somos miembros de la familia y de la casa de Dios (¡somos los habitantes de Su hogar!, por eso es que hemos de hacer el bien especialmente a otros miembros de Su familia, recordando que Él conoce a los que son de Su familia; esto tiene que ver con nuestra relación específicamente con Dios).
22. Estamos en la comunidad (fellowship) de los santos (lo que tiene que ver específicamente con nuestra relación con los otros creyentes; y delante de Dios, esta relación como hermanos y hermanas en Cristo conlleva las responsabilidades correspondientes a honrar, edificar unos a los otros, y en síntesis funcionar como si fueran uno solo, una unidad: un Cuerpo: ¡el de Cristo!; cuatro veces Jesús oró en Jn. 17 que nosotros “pudiéramos llegar a ser UNO”, así como él y su padre UNO son: en propósitos, en deseos, en planes, en corazón).
23. Tenemos acceso constante y continuo a Dios: quien nos ayuda en todo tiempo, especialmente en el de necesidad, ¡con todas sus gracias y misericordias específicas para esas circunstancias de necesidad! (¡Y este alto privilegio está a nuestro alcance 24 horas al día los 365 días del año!).
24. Estamos dentro del mucho más que abundante cuidado de Dios ahora que ya hemos sido reconciliados con Dios; y es precisamente este “mucho más” lo que nos hace los objetos especiales de Su amor, de Su gracia, de Su poder, y también de la continua intercesión de Su hijo Jesús por nosotros.
25. Tenemos Toda Su Herencia espiritual que podemos recibir ahora, y Toda la que vamos a recibir después como Sus hijos salvos que ya somos (nuestro cuerpo inmortal y nuestra morada celestial), aparte de las recompensas específicas a las que nos hagamos acreedores que serán el extra de las bendiciones eternas para nosotros; y además: ¡nosotros mismos somos la herencia de Dios (somos de lo poco bueno que esta tierra está actualmente produciendo para Dios, y cuando Jesús sea manifestado de nuevo sobre esta tierra, nosotros también lo seremos con él)!
26. Dios mismo es la herencia de los santos, así como Todo lo que Él otorga, siendo esa nuestra herencia que nunca perece, se estropea, o se esfuma, la cual herencia está siendo protegida o guardada en el cielo para nosotros: ¡Hay promesas de recompensas por llevar a cabo nuestros trabajos más ordinarios de cada día como si fueran trabajos para el Señor!
27. Somos luz en el Señor (por tener en nosotros el espíritu santo de Dios), y hemos de vivir como esa luz que somos: andando en luz, y somos la luz (aunque antes éramos obscuridad), para un mundo de tinieblas, un mundo obscuro.
28. Ya hemos sido circuncidados por y en Cristo (y circuncidados de todo nuestro cuerpo terrenal).
29. Ya hemos sido bendecidos con la garantía o primicias del espíritu de Dios. Varias riquezas del santo espíritu se describen: a) hemos sido nacidos del espíritu, b) hemos sido bautizados en el espíritu, c) hemos sido ungidos con el espíritu, d) hemos sido sellados con el espíritu, e) hemos bebido de ese espíritu, f) estamos llenos del espíritu, g) somos la morada del espíritu, etc.
30. Hemos sido glorificados; una vez salvos, Dios nos ha dado la promesa de nuestra gloria futura, y los problemas del tiempo presente no son comparables con nuestra gloria venidera, y con la gloria venidera al mundo, ¡que somos nosotros mismos! (“la gloria que en nosotros ha de ser revelada”, “apareceremos con él en gloria”).
31. ¡Estamos completos en Cristo! Y Cristo es cabeza de todo principado y potestad, y como formamos parte de su cuerpo: ¡también nosotros estamos completos en él!, y toda la plenitud de la naturaleza divina que mora en él, mora también en nosotros, y por ello es que dice que Su poder divino nos ha dado todo lo que necesitamos para la vida y para la relación diaria, viva, vital y verdadera con Dios.
32. Hemos recibido toda bendición espiritual por parte de Dios gracias a Cristo, unas derramadas desde las regiones celestiales (las que podemos recibir ahora) y otras almacenadas allá arriba (las que no podemos recibir ahora).
33. ¡Somos en Cristo participantes del real y santo sacerdocio! (y lo somos ya que Dios requiere una continuidad de esto sobre la tierra, y ya que Israel fracasó, aún cuando al final restringió Dios esas funciones inicialmente dadas a todo el pueblo a una sola familia: a la de Leví, pero Israel ya ha sido dejado de lado para estas funciones, hasta el milenio; por eso nosotros ahora, en el tiempo presente, somos los intermediarios autorizados por Dios en la era de gracia para reconciliar a Dios con los hombres, que era la función del “sacerdote” hebreo, pero con la diferencia de que ahora no se busca que dependan siempre de nosotros (para ritos muertos e innecesarios, como aún lo hace el falso “sacerdocio” católico), sino que directamente se comuniquen con Él), siendo además nosotros la casa espiritual de Dios.
Fuente: Tomado, reordenado y modificado de la “Teología Sistemática” de Chafer, Vol. 3:234-65; link: https://tinyurl.com/33thingsJC
Cosas que el cristiano recibe al momento de su salvación
Todas estas son cosas hechas por Dios, instantáneas, dadas simultáneamente, basadas únicamente en el mérito de Cristo, y por lo tanto son eternas:
1. Tomamos parte del plan eterno de Dios (conocidos de antemano, elegidos de antemano, seleccionados, escogidos, llamados).
2. Hemos sido redimidos.
3. Hemos sido reconciliados.
4. Tenemos una relación viviente (viva y vital) con Dios (debido al medio, nuestra propiciación: Cristo).
5. Hemos sido perdonados (remisión, carencia de condenación, cancelación de “la Ley”, acceso a una limpia y clara conciencia, ayuda en el tiempo de necesidad).
6. Estamos libres de “la Ley”.
7. ¡Somos un don de Dios para Cristo! (“A los que me diste” dice Cristo siete veces en Jn. 17, cada uno de nosotros siendo como preciosas joyas, cada una valiosa y única, dadas a Jesús por Su padre).
8. Somos hijos de Dios (renacidos, una nueva creación, regenerados, vivificados, los pequeños (children) de Dios, con Dios como nuestro creador y nuestro padre).
9. Estamos tanto bajo Filiación como bajo Adopción (bajo todo lo mejor que el mundo judío y el gentil tenía que ofrecer a todos los que dependían como hijos: elegidos desde antes de la fundación del mundo y para las bendiciones, tratados como adultos merecedores de todo desde el primer día, como herederos completos).
10. Somos aceptables para con Dios (santos y sin mancha: justos, santificados, perfeccionados espiritualmente para siempre, sido hechos aceptables por gracia).
11. Hemos sido justificados (es el acto divino mediante el cual podemos estar frente a Dios siendo ya justos y perdonados, como si jamás hubiésemos pecado, sin ningún sentido de pecado, culpa o condenación).
12. Hemos sido hechos cercanos (ahora nos toca mantenernos cercanos alineándonos más y más a Su Voluntad, y si fallamos, diciéndoselo a Él con el verdadero propósito de no volverlo a hacer).
13. Hemos sido libertados del poder de las tinieblas (y peleando una batalla en su contra con una armadura espiritual invencible).
14. Tenemos la entrada a un nuevo reino (¡y ya estamos morando espiritualmente en el glorioso reino de Cristo en el que tenemos nuestro lugar! Y en el futuro se nos dará una gran bienvenida, mientras que ahora es un privilegio y desafío el expandir dicho reino (mediante el traer nuevas personas a Cristo)).
15. Estamos “en Cristo” (más de 170 veces el N.T. dice que estamos unidos “en Cristo”: en quien somos completos, en quien andamos y estamos ya sentados en los celestiales (con la certeza de nuestro lugar seguro allá arriba)).
16. Estamos sobre la roca: ¡Cristo Jesús!, es decir: tenemos el fundamento más sólido que es posible tener, el único que permanecerá, y sobre cuya base hemos de sobreedificar nuestras vidas: pensamientos, palabras, acciones (logros, carreras, proyectos).
17. ¡Estamos también en Dios, no sólo en Cristo!
18. Nuestra asociación celestial con Cristo cubre al menos siete áreas de interés y de acción común:
a) somos aliados (socios, compañeros de trabajo, copartícipes, acompañantes) de Cristo en la vida: nuestra gloriosa esperanza es él en nosotros, al tenerlo tenemos a ¡la verdadera vida!
b) somos aliados de Cristo en la posición: ¡estamos sentados en donde Cristo está sentado!: A la diestra de Dios.
c) somos aliados de Cristo en el servicio: somos obreros (colaboradores) juntamente con Dios (¡obrero!), y obviamente, juntamente también con Cristo Jesús (¡obrero!).
d) somos aliados de Cristo en el sufrimiento.
e) somos aliados de Cristo en la oración.
f) somos aliados de Cristo (estamos a y de su lado, y aún más: ¡estamos en él!) en los esponsales: somos juntamente con él: ¡el marido!.
g) somos aliados de Cristo en la expectación.
19. Una nación elegida, una nación santa, y un pueblo muy peculiar (somos una generación elegida ya que somos del linaje de Dios, somos su descendencia, y somos peculiares ya que no somos de este mundo, sino que: ¡le pertenecemos a Dios!).
20. Tenemos una Ciudadanía celestial (y nuestros nombres están escritos en ¡los cielos (tois ouranois)!, nuestra Ciudadanía es con Dios, ¡somos conciudadanos de Dios!, y por eso aquí sobre la tierra somos forasteros y peregrinos, por ser Ciudadanos del cielo; por eso nuestra labor aquí en la tierra es la de ser Embajadores para Cristo, ¡y aún hay más!; esto tiene que ver con nuestra relación con el cielo: con todo lo que hay y lo que mora allá, incluyendo a Dios y a todos Sus servidores, que incluye a Sus santos ángeles y querubines).
21. Somos miembros de la familia y de la casa de Dios (¡somos los habitantes de Su hogar!, por eso es que hemos de hacer el bien especialmente a otros miembros de Su familia, recordando que Él conoce a los que son de Su familia; esto tiene que ver con nuestra relación específicamente con Dios).
22. Estamos en la comunidad (fellowship) de los santos (lo que tiene que ver específicamente con nuestra relación con los otros creyentes; y delante de Dios, esta relación como hermanos y hermanas en Cristo conlleva las responsabilidades correspondientes a honrar, edificar unos a los otros, y en síntesis funcionar como si fueran uno solo, una unidad: un Cuerpo: ¡el de Cristo!; cuatro veces Jesús oró en Jn. 17 que nosotros “pudiéramos llegar a ser UNO”, así como él y su padre UNO son: en propósitos, en deseos, en planes, en corazón).
23. Tenemos acceso constante y continuo a Dios: quien nos ayuda en todo tiempo, especialmente en el de necesidad, ¡con todas sus gracias y misericordias específicas para esas circunstancias de necesidad! (¡Y este alto privilegio está a nuestro alcance 24 horas al día los 365 días del año!).
24. Estamos dentro del mucho más que abundante cuidado de Dios ahora que ya hemos sido reconciliados con Dios; y es precisamente este “mucho más” lo que nos hace los objetos especiales de Su amor, de Su gracia, de Su poder, y también de la continua intercesión de Su hijo Jesús por nosotros.
25. Tenemos Toda Su Herencia espiritual que podemos recibir ahora, y Toda la que vamos a recibir después como Sus hijos salvos que ya somos (nuestro cuerpo inmortal y nuestra morada celestial), aparte de las recompensas específicas a las que nos hagamos acreedores que serán el extra de las bendiciones eternas para nosotros; y además: ¡nosotros mismos somos la herencia de Dios (somos de lo poco bueno que esta tierra está actualmente produciendo para Dios, y cuando Jesús sea manifestado de nuevo sobre esta tierra, nosotros también lo seremos con él)!
26. Dios mismo es la herencia de los santos, así como Todo lo que Él otorga, siendo esa nuestra herencia que nunca perece, se estropea, o se esfuma, la cual herencia está siendo protegida o guardada en el cielo para nosotros: ¡Hay promesas de recompensas por llevar a cabo nuestros trabajos más ordinarios de cada día como si fueran trabajos para el Señor!
27. Somos luz en el Señor (por tener en nosotros el espíritu santo de Dios), y hemos de vivir como esa luz que somos: andando en luz, y somos la luz (aunque antes éramos obscuridad), para un mundo de tinieblas, un mundo obscuro.
28. Ya hemos sido circuncidados por y en Cristo (y circuncidados de todo nuestro cuerpo terrenal).
29. Ya hemos sido bendecidos con la garantía o primicias del espíritu de Dios. Varias riquezas del santo espíritu se describen: a) hemos sido nacidos del espíritu, b) hemos sido bautizados en el espíritu, c) hemos sido ungidos con el espíritu, d) hemos sido sellados con el espíritu, e) hemos bebido de ese espíritu, f) estamos llenos del espíritu, g) somos la morada del espíritu, etc.
30. Hemos sido glorificados; una vez salvos, Dios nos ha dado la promesa de nuestra gloria futura, y los problemas del tiempo presente no son comparables con nuestra gloria venidera, y con la gloria venidera al mundo, ¡que somos nosotros mismos! (“la gloria que en nosotros ha de ser revelada”, “apareceremos con él en gloria”).
31. ¡Estamos completos en Cristo! Y Cristo es cabeza de todo principado y potestad, y como formamos parte de su cuerpo: ¡también nosotros estamos completos en él!, y toda la plenitud de la naturaleza divina que mora en él, mora también en nosotros, y por ello es que dice que Su poder divino nos ha dado todo lo que necesitamos para la vida y para la relación diaria, viva, vital y verdadera con Dios.
32. Hemos recibido toda bendición espiritual por parte de Dios gracias a Cristo, unas derramadas desde las regiones celestiales (las que podemos recibir ahora) y otras almacenadas allá arriba (las que no podemos recibir ahora).
33. ¡Somos en Cristo participantes del real y santo sacerdocio! (y lo somos ya que Dios requiere una continuidad de esto sobre la tierra, y ya que Israel fracasó, aún cuando al final restringió Dios esas funciones inicialmente dadas a todo el pueblo a una sola familia: a la de Leví, pero Israel ya ha sido dejado de lado para estas funciones, hasta el milenio; por eso nosotros ahora, en el tiempo presente, somos los intermediarios autorizados por Dios en la era de gracia para reconciliar a Dios con los hombres, que era la función del “sacerdote” hebreo, pero con la diferencia de que ahora no se busca que dependan siempre de nosotros (para ritos muertos e innecesarios, como aún lo hace el falso “sacerdocio” católico), sino que directamente se comuniquen con Él), siendo además nosotros la casa espiritual de Dios.
Fuente: Tomado, reordenado y modificado de la “Teología Sistemática” de Chafer, Vol. 3:234-65; link: https://tinyurl.com/33thingsJC
Updated Jan 16, 2018, 9:58 PM
Fernando Castro-Chavez added Men Are from Mars, Women Are from Venus to books he's read.
Men Are from Mars, Women Are from Venus
Fernando Castro-Chavez added New Greek English Interlinear New Testament-PR-Personal to books he's read.
New Greek English Interlinear New Testament-PR-Personal
Fernando Castro-Chavez added Biblia Interlineal Espanol Hebreo: La Restauracion to books he's read.
Biblia Interlineal Espanol Hebreo: La Restauracion
Fernando Castro-Chavez added Companion Bible-KJV to books he's read.
Companion Bible-KJV
Fernando Castro-Chavez added Interlinear Bible-PR-Hebrew/Greek/KJV to books he's read.
Interlinear Bible-PR-Hebrew/Greek/KJV
More pictures of my vacation (that now is gone, buaah!!!), I am now single, with no wife or girlfriend yet, but wanting one very, very, very much (with divine help, I wish to serve her on my knees), but for now, I am alone and fine, living only with "the Lord" (and back to 2 Cor. 1 to 6 from the Greek: The Ambassadors for the Lord that we always are! Married or single happy or sad, even well-behaving or a little bit miss-behaving, it does not matter, we are still his Ambassadors!!!...), here the first one shows me with my new friend Jasith, a young hard working and playing neighbor there (God, I wish he were my own son!), then with my nephews (God I wish, I wish...)
Fernando Castro-Chavez was celebrating friendship.
Fernando's posts have been liked 13,000 times
Del hacernos como niños al estudiar con toda dedicación y mansedumbre las maravillosas Escrituras de Dios, las cuales apuntan hacia arriba, hacia la fuente directa de todo consuelo, gozo y revelación perfecta para nosotros, a quienes Él nos ama personalmente a cada uno, y con esa atención nos suple nuestras necesidades.
Fernando Castro-Chavez shared a memory.
5 Years Ago
Jan 8, 2016, 12:51 PM
Otra transparencia que veremos esta noche acerca de las "Aguas de Arriba", muestra que es maravilloso que en las Escrituras, "los Cielos de los Cielos" corresponden al Espacio Exterior dentro del Universo, pero "las aguas que están por encima de esos Cielos" son las que rodean al Universo entero, formando "El Círculo sobre la Faz del Abismo"; y más allá de todo esto, es a donde nosotros vamos! Oh maravillas de la Sabiduría de Dios! Comenzamos por YT a las 7:50 PM: https://www.youtube.com/c/CatadoresDeLaPalabra1
La Revelación acerca de la constitución del Universo conforme a las Escrituras: Circunscrito y rodeado por aguas casi infinitas:
Updated Jan 8, 2018, 9:54 AM
Fernando Castro-Chavez added 28 new photos.
Place: Puerto Vallarta Mexico
Fer & nephew in Vallarta
Nosotros aquí hoy 24 de diciembre, en casa y desde el jardín de Zapotlán el Grande, Jal., MX, estoy con mi mamá María Cris y con mi papá Manuel; y aquí mi estudio de hoy: https://youtu.be/evzUTKAbhug acerca del dar el Fruto para Dios y para salvación (es decir, para nuestras recompensas eternas al nosotros andar en ese amor ¡como Cristo nos pide!), ya que la salvación espiritual para vida eterna ya la tenemos gracias a la ofrenda en amor perfecto de nuestro Salvador y Señor Jesucristo, ¡alabado seas mi Señor por nosotros ahora y siempre! También estudio lo que es "el Remanente" de Israel y cómo llevamos por dentro el poder más grande del universo, el de espíritu santo, el mismo que levantó a Cristo de entre los muertos, ¡con el que es posible vencer a toda tentación y pecado por grande que a nosotros nos parezca!
Fernando Castro-Chavez was 🎉 celebrating friendship.
Fernando's posts have been loved 500 times
Studying (estudio), rescate (rescue), sobrino (nephew), family (familia), woman (mujer)
Fernando Castro-Chavez shared a memory.
5 Years Ago
Dec 23, 2015, 8:42 PM
A good piano theme: https://www.youtube.com/watch?v=9P4Wkwu1nTo
Tiernos recuerdos de la infancia, y de Linus que nos recordó las Escrituras (siempre primero el amor y NO el legalismo!!! Mientras me preparo hoy para mi lectura de Romanos, descubriendo cosas de lo Alto como siempre, con ese constante comunicarnos con Dios, la verdadera y viva fuente inagotable de verdad, por lo que a mí me parece totalmente ridículo el depender de una institución humana envanecida que se haga pasar mensamente como "la fuente", compuesta por esa bola de líderes panzones y sangrones, pero "fuente" ¿de qué? (más bien "cisternas rotas"); aquí, cuando ponga el nexo a mi estudio del YouTube mañana, veremos como, por la gracia divina, y no en lo absoluto por mi torpe capacidad personal (como me insinuara uno de ellos): el "Israel de Dios" de Gál. se corresponde con el "Remanente" de Rom., y como "el Fruto del espíritu" de Gál. se corresponde con "el Fruto de justicia para Dios" de Rom., y muchas otras maravillas aún no exploradas que tiene Dios allí para los que "Le Buscan Directamente A Él" (porque, ¿quién soy yo, realmente, sino un pobre pecador como cualquiera de ustedes? Y no me digan, ¡Ay, yo no lo soy!, porque como Romanos lo dice, ¡todos lo somos!). Así de que Gál. explica Rom., y Rom. expande Gál., Rom. nos enseña y Gál. nos corrige, ¡oh maravillas de la sabiduría divina!).
Updated Dec 23, 2017, 7:30 AM
Fernando Castro-Chavez shared a memory.
Aquí estoy con aquel sobrino amado que declamó: https://youtu.be/Dq72xwXmxdU
¿QUIÉN?
por María Elena Walsh
"¿Quién pinta, quién pinta la flor con rocío y el cielo con tinta? ¿A quién se le pierde encima del árbol su pintura verde? ¿Quién mueve, quién mueve la cola del viento y la de la nieve? ¿Quién marcha, quién marcha con gorro de nube, con capa de escarcha?"
¿QUIÉN?
por María Elena Walsh
"¿Quién pinta, quién pinta la flor con rocío y el cielo con tinta? ¿A quién se le pierde encima del árbol su pintura verde? ¿Quién mueve, quién mueve la cola del viento y la de la nieve? ¿Quién marcha, quién marcha con gorro de nube, con capa de escarcha?"
Updated Dec 22, 2017, 7:58 AM
Fernando Castro-Chavez answered a question.
Between sunrises and sunsets, I prefer…
I can tell you that "I prefer sunrises announcing a new day, looking at the ocean vast and immense, asking God the owner of it all, and sending He for me, His beautiful one to me, walking by my side!" Fernando Castro-Chavez. (P.D. Puerto Vallarta's sand, wait, wait, I'm coming too! https://youtu.be/dwkwjOd7MCU)
I can tell you that "I prefer sunrises announcing a new day, looking at the ocean vast and immense, asking God the owner of it all, and sending He for me, His beautiful one to me, walking by my side!" Fernando Castro-Chavez. (P.D. Puerto Vallarta's sand, wait, wait, I'm coming too! https://youtu.be/dwkwjOd7MCU)
Fernando Castro-Chavez shared a memory.
5 Years Ago
Dec 11, 2015, 11:20 AM
Recordando a los santos amados, como puse antes, que hoy a las 7:30 PM comenzamos nuestra reunión por Skype, que continuamos por YouTube con sobremesa después para manifestar espíritu santo y deleitarnos en Dios! En la foto, la batalla espiritual profetizada en los cielos desde la creación de Adán: Sol y Luna en Virgo (concepción virginal), en donde Venus (Cristo), en conjunción con la Spica (el Renuevo humano), está rodeado por Marte (Miguel) a la izquierda, y por Mercurio (Gabriel) a la derecha; En Aries (el Rey y Cordero de Dios), Júpiter (la Justicia de Dios), al centro del evento de la Espada que Desciende del Cielo (el "pescado" de la izquierda), se clava en el corazón de Cetus (el "hombre" de pecado). Por otro lado e intentando usurpar el poder divino, en Leo (el Rey de Reyes) Neptuno (el "espíritu" del Anticristo), en conjunción con Régulo (el Cetro del Rey), está flanqueado por Urano (el "espíritu" del Falso Profeta) a su izquierda, y Saturno (Satanás) a su derecha!
Y... la tremenda batalla espiritual que vemos en Gálatas: https://www.youtube.com/watch?v=TLKV2kINf9g&t=7740s que "casi" le costó la vida al cristianismo y a su Pablo, es tan sólo un "inesperado" episodio de lo que desde el principio, el adversario y los suyos "planeaban cuidadosamente" para intentar usurpar a todo y a todos los que serían de Dios, aquí se ve parte de esa batalla como la narraron los cielos al momento mismo de la creación del hombre (Adán, nuestro abuelo); intentando usurpar a Leo y su Régulo, vemos ya al espíritu del Anticristo (representado en Neptuno), rodeado de su falso profeta (Urano) por un lado, y de Satán, el adversario mismo, por el otro, mientras que Venus en línea con Spica en Virgo (representando al futuro prototipo de ser humano perfecto: ¡Jesús!) estaba flanqueado por sus dos más cercanos servidores celestiales futuros: Mercurio (Gabriel) y Marte (Miguel), ¡con el Sol y la Luna!, mientras que Júpiter, representando la Justicia de Dios blandía la espada para traspasar al maligno (representado en Cetus); Adán cayó, ¡Jesús jamás!; esto nos muestra que, por más que quiera, el adversario lleva todas las de perder, y no se puede "dar a basto" estando en todos los lugares él mismo al mismo tiempo, como quisiera, lo que sí lo puede hacer el espíritu santo de Dios en nosotros hoy, y es por eso que hoy hablamos sin cesar ¡¡¡íntimos secretos con Dios constantemente en nuestro hablar en lenguas como Cuerpo de Cristo, secretos de los que el diablo no tiene ni la menor idea ("y trina él de coraje al no saber qué es lo que decimos y lo que recibimos en mensajes constantes de Dios")!!! !Oh infinita la Sabiduría de nuestro Gran Padre y Gran Dios!
Updated Dec 11, 2017, 9:53 AM
Gálatas del griego! https://youtu.be/TLKV2kINf9g Aquí estamos, dando el Fruto del espíritu santo, que es totalmente independiente del don, el cual depende totalmente de nuestra voluntad, y que ya está completamente maduro y perfecto desde el instante mismo en que renacemos al aceptar a Cristo como nuestro Señor, a quien seguimos unidos hasta el fin, y si queremos, aún en cruz con él hacia el mundo, en servicio. Todas las fuerzas del mal no pudieron ante ese fruto, y personas como Pedro y Juan Marcos fueron plenamente restauradas a la gracia, dejando a toda institución y grupo que en vez de ayudarlos a crecer, los tenía paralizados y estancados, y en ese entonces se trataba de los malvados legalistas... (en la foto, yo vuelo en el aire con el Fruto del espíritu, haciendo mi ejercicio abdominal "para mi simiente", representando a Pablito que se puso "su uniforme" para confrontar a los Gálatas, con todo el Fruto, y especialmente, ¡un enérgico, o energético Amor!).
Fernando Castro-Chavez shared a memory.
5 Years Ago
Dec 7, 2015, 10:13 PM
Amados santos, primeramente Dios vamos a ver el tremendo tema de la Simiente Prometida en las Constelaciones para este viernes 11 de diciembre, comenzando a las 7:50 PM: https://www.youtube.com/c/catadoresdelapalabra1 con el ir manifestando espíritu santo después del tema, y con oraciones y salutaciones comenzando desde las 7:30 PM mediante Skype; las transparencias son: http://fdocc.ucoz.com/3/08_simiente_constelaciones.pdf En Cristo, Fernando.
Las Maravillas de la Revelación de Dios durante un largo lapso se podían ver tan sólo en el cielo, hasta que llegó el hombre más manso de la tierra de aquel entonces (el esclavo Moisés), y de allí en delante se difundió la Revelación en Palabra Escrita; pero tuvo que llegar el hijo, quien dio su vida por todos nosotros, y gracias al cual ahora recibimos la Revelación en mensaje directo del cielo procedente de Dios y de Su ungido, quien vive con Dios, siendo Jesús el único mortal que está vivo hoy, gracias a quien recibimos el don de espíritu santo para comunicarnos con ambos, y la Verdadera Revelación Directa no contradice a la Revelación Escrita la cual no contradice a la Revelación Celestial, sino que todas ellas se complementan en un bello entramado de Dios.
Updated Dec 7, 2017, 7:36 AM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Dec 6, 2015, 6:04 PM
Here we see how Jesus himself is carrying our load today with his declaration that the "eye for an eye" statement is something that "has been said" by somebody but not by God! Jesus puts that statement in the same category of the most erroneous "hate thine enemy"! Contrasting these two with Giving and with Loving!, respectively.
And... when believers devour and destroy believers (Gal. 5:15), we still remember that the standard of LOVE that Jesus gave us goes even beyond the limited setting of our "family"! It goes to love the enemies!!! Do you love your enemy? But first, why do you make me your enemy??? Is it because I am an independent christian, such as Paul, willing to depend only on the living and direct voice of God, and not to depend at all in men? (As most of the leaders I know, for a financial, social, or self-pride emotional benefit, transform themselves into unloving and selfish Christian Pharisees that instead of helping you to grow and to do your part in the body, ignore you, criticize you, or even bump you...)
Updated Dec 6, 2017, 8:00 AM
Fernando Castro-Chavez shared a memory.
Dear saint and reader, Well, November 2017 is Gone! The stellar discovery was that of "The Cup of Blessing", then the healing bread, and "The Cup of Hope" to remember that I have been forgiven and that I have Hope in his return for us who believe in him! And that my video about "The Body" in Spanish that I put last Friday Nov. the 24th is going to 100 views breaking every previous record: https://www.youtube.com/watch?v=ARWHzqfeTE8 as well as the one published on Friday Nov. the 10th about God being the ONE that renews our brain as we "taste and see", by ("eis") 'dokimadzein' = 'evaluating and approving' the Will of God: https://www.youtube.com/watch?v=m80pS_Z51WU These two are thus far the biggest discoveries of my life! And currently, I am working in the big Province of "Galatians"! Where we see the Fruit of the spirit in the midst of the worst imaginable adversities and human mistakes!!! So, happy December 2017, which starts right now! In Christ, Fernando. P.D. Como regalo a mis amados creyentes hispanos, los que le dan valor y aprecio a todos estos mis estudios bíbicos, aquí les va un extra con todo mi amor acerca del más grande descubrimiento hecho en noviembre, no por mi sino por él, mi Señor Jesús: http://fdocc.ucoz.com/7/eis_Rom.12_2_Dec_1_2017.pdf |
Fernando's November Moments
Dear saint and reader, Well, November 2017 is Gone! The stellar discovery was that of "The Cup of Blessing", then the healing bread, and "The Cup of Hope" to remember that I have been forgiven and that I have Hope in his return for us who believe in him! And that my video about "The Body" in Spanish that I put last Friday Nov. the 24th is going to 100 views breaking every previous record: https://www.youtube.com/watch?v=ARWHzqfeTE8 as well as the one published on Friday Nov. the 10th about God being the ONE that renews our brain as we "taste and see", by ("eis") 'dokimadzein' = 'evaluating and approving' the Will of God: https://www.youtube.com/watch?v=m80pS_Z51WU These two are thus far the biggest discoveries of my life! And currently, I am working in the big Province of "Galatians"! Where we see the Fruit of the spirit in the midst of the worst imaginable adversities and human mistakes!!! So, happy December 2017, which starts right now! In Christ, Fernando. P.D. Como regalo a mis amados creyentes hispanos, los que le dan valor y aprecio a todos estos mis estudios bíbicos, aquí les va un extra con todo mi amor acerca del más grande descubrimiento hecho en noviembre, no por mi sino por él, mi Señor Jesús: http://fdocc.ucoz.com/7/eis_Rom.12_2_Dec_1_2017.pdf
Fernando tiene el gran gusto de compartir con ustedes ¡El Cuerpo! Mujer y sexo; creyentes y pan: https://youtu.be/ARWHzqfeTE8, en donde se tocan cinco aspectos bíblicos del cuerpo: el del Cristo mismo en la cruz, el nuestro usado para su gloria, la mujer que es el cuerpo del varón, los creyentes que juntos forman el Cuerpo de Cristo mismo y a los que les pide él andar en amor, y la comida sólida que representa la entrega de su cuerpo para nuestra sanidad física, así como la bebida líquida que representa su vida derramada para lavarnos, para nuestro perdón de todo pecado y error, además de otros temas como el del incestuoso perdonado al arrepentirse de corazón y el no poner tropiezos a nuestros hermanos por el abuso de nuestra libertad, el rechazo a la idolatría que es en realidad el dirigirse a los demonios, etc. Siendo esto mi lectura de 1 Cor. 5, 7-8, 10-11, y partes del 3 y del 6 así como de 2 Cor. 2 y 7.
In Corinth, as today myself, they needed to ask first for forgiveness to God and to their fellow believers (that's the third cup: "The Cup of Blessing", that was taken before eating the bread! (1 Cor. 10:16); then, after eating the healing bread, as per Jesus, "The Cup of The New Covenant" was the one that was taken (1 Cor. 11:25-26), when God Himself responds, giving us the complete forgiveness of sins, time after time as we remember to ask Him to do that! [So the 5th Cup, or the "Cup of The Living Grace (us) & Glory (him)", will be taken by Jesus when he enters as "King of Kings and Lord of Lords" in his future Millennial Kingdom on earth! Oh wonders of the infinite wisdom of God!!!]
Aquí estoy, estudiando hoy acerca del evaluar la voluntad divina, para que todos ustedes también evalúen esto, y Dios les transforme el pensar: https://youtu.be/m80pS_Z51WU Para poder comprobar que ella (Su Voluntad) es buena, agradable y perfecta, amando a todo creyente cristiano venga de donde venga, piense como piense, y aún haga lo que haga, y tratando con respeto a todo no creyente, incluyendo a los funcionarios públicos, y aún a los que nos rechazan; al ocuparnos en comprobar las virtudes de esto, Dios, nuestro Padre, se compromete: ¡A Transformarnos Renovando Él Mismo Nuestra Mente! Solamente el poder de Su santo espíritu dentro nuestro puede lograr semejante milagro, más !no nosotros por nosotros mismos (lo único que se logra al intentar hacerlo por nuestras propias fuerzas, y esto se ha visto siempre que el hombre con sus cinco sentidos intenta hacer por su cuenta lo que le toca a Dios, es el adquirir aquella detestable vanidad)!
Fernando Castro-Chavez shared a memory.
5 Years Ago
Nov 9, 2015, 2:27 PM
En preparación a este viernes que viene (el 13 de Nov. del 2015), en el que tendremos una dulce charla con Sangat Bains, y para más allá, los siguientes episodios de mi ir "Estudiando las Escrituras": https://www.youtube.com/watch?v=3VTJK4aLFcw , https://www.youtube.com/watch?v=pu8Kp9frf1w , y https://www.youtube.com/watch?v=MYjVEw4Ilf0
Pero, aún cuando todo cambia externamente, hay una cosa que permanece fiel y firme: Y es la Voluntad de Dios, la cual es Buena, Agradable y Perfecta (como mi mujercita para mí); pero papá Dios nos dice que a nosotros nos toca probar, poner a prueba, y evaluar hasta llegar a aceptar que lo que tenemos en Su Escritura es 100% Confiable, eso no lo va a hacer Dios por nosotros, nos toca hacerlo a nosotros, y de aquí nació el nombre de "Catadores de la Palabra" para mi servicio a Ustedes; y al hacerlo, ¡automáticamente el santo espíritu de Dios dentro de cada creyente renacido (por haber aceptado a Jesucristo como el Señor único de su vida), !va obrando la transformación de nuestro entendimiento, así como la no conformidad a la inercia emocional de este mundo!! (Eso le toca hacerlo a Dios en Cristo en nosotros, no a nosotros mismos (ya que cuando el hombre trata de hacerlo por sí mismo, lo único que "se gana" (que en realidad es pérdida al conocer ustedes a esos lidercillos sin valor espiritual alguno) es la vanidad y la necedad humanas), como ustedes y yo lo veremos, primero Dios mañana, al estudiar, entre otras cosas Romanos 10, 8, y 12 al 15:13, donde se desglosa como comenzar con ese ser "catadores" de Su Revelación Divina):
Updated Nov 9, 2017, 7:54 AM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Michael Lindsey added a new photo — with Diana Moreno and Fernando Castro-Chavez.
My Beloved Saints, Here is the Book of Acts!!!: https://youtu.be/tRXNp6K5-JI & here the Gospel of the same writer, Luke: https://youtu.be/2PHPLApTt7Y (the really important deals on this posting! The actual movie starts at 1:25). Then, I am at "Camp Texas", sharing with my very dear sisters in Christ from Texas! We were talking about the awesome wisdom of God reflected in all of His good creation, from the universe and beyond. So, no matter what, if we continue devoted 100% to God serving Him and only Him first, and second His own, and if we continue non-stop our speaking in tongues, we will continue having our inner joy and peace and spiritual love on fire! No matter what! We may get sad from time to time, because of the long distances in space, time, and communication with fellow saints, but one good day we all shall be together in our beautiful and perfect spiritual bodies, with no more "earthly needs", that is our hope; and that then, every hidden thing of our hearts will be known and we will be vindicated by the gracious mercy of our personal Lord and Savior Jesus Christ!!! In him, your slave doulos, Fernando. P.S. Credits of the picture, taken by my dear and awesome ex-wife Tracy Duncan (for approximately year and a half now, having signed my divorce papers since the middle of February of 2016 I think, because I really, really really, really want to have my own little sons and daughters since the very beginning... sorry to everybody that was hurt, removing me form their friends" lists (including her), but the beauty of speaking in tongues and of our hope is that within them all those things are surpassed, so God bless y'all my dear Texans and beyond...); or was it... (oh well, that's the same).
Updated Nov 3, 2017, 7:57 AM
Con una muy grande alegría, aquí les comparto mi estudio acerca de la 'Generosidad': https://youtu.be/Mr1dv0Uqzec (1 Cor. 9 y 16, 2 Cor. 8 y 9, Fil. 4:10-20, etc.) La clave de todo esto es dar, dar de corazón, dar con gusto, dar para satisfacer las necesidades de otros, creyentes o servidores, Apóstoles o el más pequeño de los cristianos; las recompensas de hacerlo, son eternas, ¡y alegran al corazón mismo de Dios!
Here, I present in English "Arreola's Class", remembering all those things that the best teacher of my childhood/adolescence taught me, Juan Jose Arreola, a Mexican educator and writer: https://youtu.be/0bJ3TX3RKlM His 12 principles followed in his life were: 1. Read, 2. Originals, 3. Compare, 4. Discern, 5. Vocalize, 6. Select, 7. Remember, 8. Imitate, 9. Inspire, 10. Live, 11. Write, and 12. Teach.
Fernando Castro-Chavez shared a memory.
4 Years Ago
Oct 12, 2016, 9:39 AM
Here's the detail with my best friend, my father, the only real friend that I have on this earth right now, from last Thursday's evening (10/06/16; photo by J.R.R.B, from http://www.zapotlangrafico.com/)
My father and I, an enduring and permanent relation :) Solidified by genetics and by example, and by communication! Thank you dad, for all your love!
Updated Oct 12, 2017, 8:38 PM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Oct 3, 2015, 1:05 PM
Today at Seven PM the Witness of the Stars 2, here is the set of slides: http://fdocc.ucoz.com/3/WS_3_02_witness_of_the_stars_2015.pdf In the image the superhighway (the Ecliptic of the sun, moon and planets)!
The greatness of our God, and of His Wisdom, goes beyond everything that we can think or imagine or study about Him, but, He is our dear Father!!!
Updated Oct 9, 2017, 8:51 AM
Aquí dejo 1 Corintios del Griego Capítulos del 12 al 15: https://youtu.be/16IK8rRNuMY, en donde se ve el poder de la creencia, el del amor, y el de la esperanza que tenemos, ilusrando mi visita de hoy al bello paseo de "Las Peñas", en Zapotlan Jal
Fernando Castro-Chavez shared a memory.
5 Years Ago
Sep 25, 2015, 7:56 PM
Continúna el estudio de las Escrituras de la Biblia en el trabajo de nuestro amado hermano en Cristo Houk Hitchcock, aquí traducido al español:
Estudiando Las Escrituras:
https://www.youtube.com/watch?v=vREp2w-7UBM
¡Escudriñad las Escrituras!
https://www.youtube.com/watch?v=y-k55XwXii4
Las Promesas de Dios
Primera Parte
https://www.youtube.com/watch?v=xUCJp_S-7yw
Segunda Parte
https://www.youtube.com/watch?v=xPqFc1Ii3qU
Estudio e Investigación Bíblica
Primera Parte
https://www.youtube.com/watch?v=8u0Wx7B2cTo
Segunda Parte
https://www.youtube.com/watch?v=YWRbVcy3V94
Tercera Parte
https://www.youtube.com/watch?v=cVikPH3s7Y0
Y aún hay más....!!!!
Recordando el estudio de las Escrituras:
Updated Oct 2, 2017, 5:20 PM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Sep 24, 2015, 3:25 PM
Hoy que tanta falsedad y dolor rondan por el mundo, ¡la luz del Cristo alumbra entendiminetos y sana corazones!:
Jesucristo Nuestro Redentor:
https://www.youtube.com/watch?v=oc7z0rIQ00k
La Concepción de la Simiente Prometida:
https://www.youtube.com/watch?v=VWhwosjrhto
Jesucristo, el Redentor – El Propósito de Jesucristo:
https://www.youtube.com/watch?v=5uJUV3snpEs
Recordando la obra de nuestro hermano Jesús, nuestro Señor, Salvador y Redentor:
Updated Sep 24, 2017, 5:47 PM
& Please Pray For Mexico, and for me (that when I open my mouth... etc...): https://www.google.com.mx/search?q=7.1+earthquake+Mexico+City+Puebla+Morelos
Updated Sep 19, 2017, 5:35 PM
En la Segunda Epístola a los Tesalonicenses descubrimos que la “Hé Apostasía” se corresponde con “La Partida”, es decir: con “El Rapto” (el “Harpazo”), y con nuestra reunión con Cristo: https://youtu.be/SpXO9jAjQdo Y aquí en la foto está lo que estos creyentes en el Señor han producido, lo que me ha ayudado en mi lectura del griego de la tremenda 2 Tes., algunos de los libros de estudio Bíblico textual (porque ellos estudian las escrituras en detalle, del texto griego original, versículo por versículo); sus autores correspondientes se muestran abajo. Esta ensalada de estudiosos Bíblicos me recuerda a la serie clásica de los 80´s: https://youtu.be/P7PRGiQjbqk, https://youtu.be/Ecmps6Mh5Yg, https://youtu.be/r29QauFlimw. ¡Gracias! En Cristo, Fernando.
Fernando Castro-Chavez wrote on Lidia Ruiz Gomez's timeline.
!Felicidades y muchos más hasta El Retorno!
You tagged Kathya Ramirez
!El Señor Jesús viene a transformar a estos pobres pecadores que le han creído a él! Y aquí mi lectura de 1 Tesalonicenses: https://youtu.be/1Xs4HO2X2LM (En la foto: Schoenheit, y un humilde servidor, Büllinger, Dake, Lacueva, y Constable):
Fernando Castro-Chavez recommends I Love Texas.
I Love Texas
5
Dear "I Love Texas", and now "Pray for Texas", congratulations on the service for the community that you provide, you put together information that is not to be found elsewhere in only one place, and could mean the difference between life and death for the people still in need to be rescued from the Harvey flood, thank you again and: God Bless Texas!!! In Christ, Fernando. P.S. I tried to put the YT video "Little Texas - God Blessed Texas (Live New Years Eve 1994)", I couldn't, but you can!!!
Fernando Castro-Chavez marked himself safe during Hurricane Harvey after a friend asked if he was okay.
Place: Corpus Christi (29.1456, -96.22495)
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Aug 21, 2015, 4:00 PM
So, Enderle starts by saying that 99.9...% of matter is "empty space"! Then, quoting Newton, he indicates that the perspective of God and Science complementing each other is a healthy one: "The most beautiful system of the sun, planets, and comets, could only proceed from the counsel and dominion of an intelligent and powerful Being" (Newton, 1726). He presents next 3 cases reflecting such a Being: 1) Beyond the Laws of Conservation of Energy and of Probability, he asks: From whence the energy originates for an electron to leave an atom? If we don't know and if this is so, why are we so surprised about Miracles? This characteristic, is called by Enderle: "Probability & Omnipotence".
Today that we saw the motions of the moon, earth and sun producing a total eclipse from Salem to Charleston, we can not do better than to recognize once and again the greatness of the creator behind the Universe!
Updated Aug 21, 2017, 8:09 PM
This is how I got the eclipse reflected on my forehead, at 1:00 PM and at 1:05 PM, Ciudad Guzmán, Jalisco, Mexico time (where the sun seemed covered only a 25%), today 08-21-2017.
Explorando el "Parque Ecológico los Ocotillos", en Zapotlán, Jal.
Fernando Castro-Chavez added a new video to Xaie Esyong's timeline.
You tagged Xaie Esyong
Dear Xaie, I wish you the best today and always! Fernando. |
Dear Xaie, I wish you the best today and always! Fernando.
Mi lectura en amor de los Filipenses del griego, vuelve a la vida la Palabra Viva: https://youtu.be/CoFZpNgzQ90 La unidad entre creyentes nos trae la paz de Dios; siendo este el hermoso ejemplo de reprensión en amor de Pablo ante sus proveedores financieros, que tengamos la misma manera de pensar que Cristo tiene ahora, quien en humildad, a pesar de haber sido el único engendrado en su morfología física de manera divina, no se envaneció, sino todo lo contrario, se puso el mandil del esclavo para servir a los suyos hasta lo más humilde del servicio. [Gracias a mi papá Manuel, quien me toma estas fotos, ya que él tiene prisa, dice, de "que yo salga", para que a sus 87 añitos sea capaz de ver a sus nietecitos de mí, :) ]
Fernando Castro-Chavez wrote on Edelmira Aldaco Muñoz's timeline.
¡Feliz cumpleaños estimada amiga de mi infancia!
Aquí estoy, disfrutando abundantemente de mis tres horas de estudio de la Epístola a los Efesios del Griego: https://youtu.be/nBG0UxcM-wQ Es maravilloso el observar en ella las claves para tener familias llenas del poder espiritual de Dios, poseedoras de los cinco dones de servicio activos, usando además la plenitud de la armadura del espíritu para poder derrotar siempre, si usamos esta armadura, al Adversario causante de divisiones y muchos otros daños: el cinturón de la verdad, el calzado militar de las buenas noticias de paz, la coraza de justicia, amor y fe o confianza, el escudo de la fe, el yelmo de la salvación, que incluye a nuestra liberación diaria, y la espada del espíritu, que es la Palabra del Dios viviente, la "Rhema" específica que por revelación se recibe en cada momento y situación según consultamos con Dios, y se le pide al soldado espiritual el constantemente orar en lenguas, tanto por los santos todos, como por los Apóstoles, para que cuando abran su boca, puedan difundir precisa y poderosamente las buenas noticias del Gran Secreto Divino: Que ya no existe división entre judíos y gentiles si éstos aceptan a Jesucristo como su Señor, de inmediato pasan a formar un sólo Cuerpo: ¡El Poderoso Cuerpo de Cristo!
Mi lectura de los Salmos del 69 al 72: https://youtu.be/-N8CM_wGWp0, lo que completa el Segundo Libro de Salmos que corresponde al Éxodo, y la ilustración es un ejemplo visual del tema del Sal. 69: David, like any of us, is drowning in his sins and errors, and he claims to God, asking Him to send his SALVATION: His YESHUAH, His SAVIOR, His JESUS to rescue us from the mire in which we are now for whatever reasons (thanks to Doug Gent and Ashley Oldmixon for picking this image!).
Aquí mi video al Salmo 68: https://youtu.be/zIf3NJvKfpk, de casi 2.5 hs:, y su foto, en la que se observa a Fernando (yo), rodeado de los maravillosos tópicos del extraordinario Salmo 68: Ejércitos de Mujeres, Palomas cautivas de alas plateadas y dorado plumaje, y la profecía del Cristo quien: "Subiendo a lo alto llevó cautiva la cautividad y dio dones a los hombres", los cuales en Efesios se nos dice que corresponden a los dones de servicio por excelencia, los cinco sentidos espirituales del Cuerpo de Cristo sobre la tierra, que según la foto corresponden a los: Apóstoles, Pastores, Profetas, Evangelistas, y Maestros, ¡los artífices del crecimiento genuino del Lugar Santísimo para morada espiritual permanente de Dios!
Aquí estoy hoy, trabajando libremente para el Señor, compartiendo Sus maravillas, lo cual, en realidad, es en sí: ¡más que suficiente como para bendecir la vida! (Cualquier otra cosa que se necesite, ¡vendrá por añadidura!, es decir, sin siquiera mover un dedo): https://youtu.be/F3FCUC0M1I4 Aquí los Salmos por la victoria de Dios en tiempos de Ezequías, sin que él tuviera nada que hacer, excepto creer, orar, y proclamar la grandeza de Dios como El Libertador; así también nosotros... y, acerca del ser profetas: https://youtu.be/RYLcnzJzPfw (mi lectura de los Salmos 51 al 55, con el 14).
Lo que le decimos primero a él... y luego a ella, nuestra pareja morando en Él: https://youtu.be/3tSz1I1XogE?list=RDsSbxzQJXBfs
Updated Jun 19, 2017, 5:31 PM
He querido compartir en amor lo que estoy aprendiendo de los Salmos, esta vez comenzando con los que corresponden al Éxodo: https://youtu.be/9Y30vdA3BQs, es decir, a Israel como grupo, y lo hermoso de nuestro Salvador dentro de esta subdivisión que comienza con el Salmo 42, y llegamos aquí hasta el 45, donde cantan las doncellas, ¡al rey hermoso y a la reina bella! Felicidades Papá Dios,Theos, El, Elohim, Yahweh, Yah, Abba... ¡por ser un Padre muy Padre, Bueno y Amoroso!
Updated Jun 18, 2017, 11:23 AM
Trabajando como obrero voluntario la maravillosa Escritura revelada por Dios, me encuentro en el Sal. 68:18 con la porción citada por Pablo en Ef. 4:8 en relación con los dones de servicio entregados por Jesucristo a los suyos desde el día de Pentecostés, dice así en el hebreo, después de hablar que su padre, Dios, desciende, se dice de Jesús que tú: "subiste a lo alto, llevaste cautiva la cautividad; trajiste dones para los hombres, y también para los rebeldes para que habite allí el Dios fiel (YAH) y el Dios justo (Elohim). Bendito sea el Dios que es fiel (Yahweh) pues día tras día lleva la carga nuestra el Dios Todopoderoso (El) de nuestro Yeshuah (Jesús, Salvador). Sélah" ¡Sorprendente y Hermoso! ¡Buscando se encuentra hasta el nombre preciso de nuestro salvador en el A. T. para aquellos que tienen ojos para ver! ¡Y que el plan salvador era que Dios encontrara Su morada en los que creyeran! ¡Y que aún los rebeldes, si tan sólo creían, serían capaces de recibir lo mismo! (Ah, y recordemos que el hebreo se lee de derecha a izquierda).
Aquí, con mi papá Manuel, y con mi mejor amigo del norte, y hermano cristiano en Cristo, Gabriel Oliver. Y, quiero yo felicitar a mi papá, y recordar su oración que dice antes de irse a dormir:
"Dios, gracias por darme un día más.
Gracias por mi vida y por mis seres queridos:
Por mi esposa, por mis hijos y nietos;
Ayúdalos a llevar a cabo
Los proyectos de su vida,
Para que te conozcan cada día más,
Por el amor que le tienes a tu hijo Jesucristo,"
Amén.
"Dios, gracias por darme un día más.
Gracias por mi vida y por mis seres queridos:
Por mi esposa, por mis hijos y nietos;
Ayúdalos a llevar a cabo
Los proyectos de su vida,
Para que te conozcan cada día más,
Por el amor que le tienes a tu hijo Jesucristo,"
Amén.
Completando la primera subdivisión de los Salmos, del 38 al 41: https://youtu.be/qxdp2_10J9Y para aquella parte que se corresponde con el Génesis, en donde vemos a Jesús profetizado en los detalles de su vida, como sus oraciones, y a aquel que lo traicionó. Se revisitan los Acrósticos de los Salmos 9 y 10, truncados e incompletos por diseño, y se comparan con el perfecto Acróstico del Alefato que habla acerca de la Mujer Fuerte de Pr. 31:10-31.
Updated Jun 6, 2017, 12:23 PM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Jun 4, 2016, 10:28 PM
Otra tremenda verdad poco conocida por la cristiandad en general son los textos antiguos de Jn. 19:18, y que al juntar los cuatro Evangelios, ¡vemos sorprendidos que fueron cuatro los crucificados con Jesús! La importancia de ello es que los cuatro Evangelios son como cuatro piezas complementarias de un mural hermoso, en los que se ve el énfasis dado por cada uno: Por ejemplo en Mateo, los dos ladrones (duo lestai) que él describe, ambos blasfemaban en contra Jesús, y ambos fueron llevados a última hora, aún después de que los soldados ya se habían repartido la túnica de Jesús y habían puesto su letrero "acusatorio" en tres idiomas, mientras que antes, junto con Jesús, Lucas describe que habían llegado al Calvario dos malhechores (duo kakourgoi), de los cuales uno habló en contra de Jesús, mientras que el otro le tapó la boca a éste al decir que ellos sí merecían dicho castigo pero no Jesús, y al decirle a Jesús que se acordara de él: "cuando VINIERA en gloria en su Reino", a lo que Jesús le respondió al estilo de un Rey: En verdad te digo hoy: Estarás conmigo en el Paraíso, que por el contexto es sobre la tierra, restaurado, en los Mil Años del reinado de Jesucristo. Juan corrobora ésto al decir que había: ¡dos crucificados a cada lado de Jesús! Lo que se observa en el interlineal que he preparado para ustedes, de nuevo tomado del Codex Vaticanus del S. IV: http://www.csntm.org/manuscript/View/GA_03?OSIS=John.19.18 (más evidencia dada también por Juan y tomada de este MS UNCIAL se verá más adelante...)
Updated Jun 4, 2017, 3:10 PM
Aquí de nuevo, "llueva o truene" o salga el sol, compartiendo con ustedes la dicha de los Salmos, esta vez del 26 al 37: https://youtu.be/oxsiP4W8Dhs vemos que algunos muestran Acrósticos Incompletos o "Imperfectos" por diseño, como el 34 y uno más "perfecto" por diseño como el 37, notando también que el Sal. 25 y el Sal. 34 ponen a la letra "Vaw" en la misma posición de cercanía a la letra "He", de nuevo terminando con la letra "Pe", que en éstos Salmos se repite dos veces, para terminar formando la palabra: "Redención".
Updated Jun 1, 2017, 12:13 PM
Best Window Cleaning on the Web: http://bestwindowcleaning.ukit.me/
Updated May 29, 2017, 3:23 PM
This is the business of my brother in Christ, Gabriel Oliver, who received me in his house from Feb through Jun, thank you Gabe, you are awesome!!! [And also thanks to your great brethren: Jerry, Caleb and Joshua!!!] With My Best, Fernando Castro-Chavez.
Updated May 27, 2017, 5:51 PM
De nuevo, muy contento de poder llevarles libremente a mis santos hermanos hispanos del planeta mi más reciente estudio de los Salmos del 8 al 15: https://youtu.be/cRO8IOhDz7s, uno se maravilla al ver la precisión de la Sabiduría Divina reflejada en cada uno de ellos, el ocho proclamando la grandeza de la creación de Dios, escrito después de que David venció a Goliat, y luego la profética conexión con los días del Apocalipsis de los Salmos 9 y 10, que son Salmos Acrósticos cortados y carentes de siete letras del Alefato, mostrando lo aciago de aquellos días... para finalmente ver que Jesús se basó en el Salmo 15 para preparar sus Sermones del Monte en Mateo y del Valle en Lucas, ambos conocidos como "Las Bienaventuranzas".
Updated May 24, 2017, 11:25 PM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
May 22, 2015, 8:56 AM
Ronald Eldon Wyatt took seriously the Word of God and discovered Gomorrah and other Cities of the Plain in in 1989 and the brimstone that destroyed them! https://youtu.be/pZbMf4r6NoQ Later on, one of his collaborators, Bill Fry, went to the Jordanian side and found Zeboiim, as he describes it in a heart felt way at: http://anchorstone.com/1998/06/sodom-gomorrah-update-4/
Remembering one of my presentations dealing with the actual evidence for the existence of Sodom and Gomorrah and their doom:
Updated May 22, 2017, 12:51 PM
Es un gran gozo comenzar a compartir mi estudio de los Salmos del Hebreo: https://youtu.be/glZfHCn-1Ag ¡Les Amo en Cristo!
Updated May 18, 2017, 3:24 PM
Museum of the Biblefacebook.com
Updated Apr 25, 2017, 12:34 PM
Fernando Castro-Chavez updated his status.
Reader, So, as a youngster, I was a fan of Alan Parsons; I think it was his Album "I Robot" (and the film "Star Wars"), what encouraged me to go into Science, here is that full Album, one of my all-time favorites: https://www.youtube.com/watch?v=-lgsCe-fLG4 (except for the penultimate song, "Total Eclipse", which is where all the robots go on to recycling). All this Album is conceived from the point of view of the robots, or against them, such as in the video "I Wouldn't Want to be Like You", where a younger Parsons despises a robot (i.e., its song "Breakdown", about a robot ceasing to function for a while.... the choral end of that one is amazing, here we hear: "Freedom, freedom, take the wall away"! Parsons's 1977 "prophecy" of the fall of Berlin's Wall (which happened on 1989), and which was the most conspicuous wall at that time...). The last song of this album bears the title of Gen. 1:32, a verse that doesn't exist; but that, for the context may as well be in the mind of Alan: "And many centuries later, there were man-made robots" (such as the future "robot" of "the beast", that according to Revelation 13:15, will be able, even to talk and to do other nasty things...) My first approach to this musical engineer was through another of his phenomenal compositions, that in my country of birth, Mexico, was used to promote the Volkswagen "Rabbit", which in Mexico was called: a "Caribe" (an army of these vehicles, in an ordered array, as the birds in the sky, was seen dominating a Mexican wide and winding road: https://www.youtube.com/watch?v=bUZ3tijNe3A, I used its 14 initial sounds of the bell plus the 15th "boom" in the 15 years of my little sister, with each of the 15 pretty ladies that initially where laying on the ground, standing up at the sound of each bell and last "boom"). Noticeably, in one of the later Albums of Parsons ("The Time Machine"), this is one of the lines, that if the listener believes, right there he gets born-again: "Call for Jesus. And ask him in"; and in other of his songs from the same Album, Parsons, like a contemporary "Agur", writes the next lines about our rapture from earth, even if they exceed his own ability of discernment (as he probably was thinking about "Icarus"): "Turn your eyes towards the light
Steal away in silent flight
The skies are calling out to you and me
Over sea and over land
God protect us with your hand
Bring us safely to our destiny" So, I say to that: "Amen", dear Alan! So, I wrote him today, to thank him for being a big inspiration for me and for my career... Fernando.
Steal away in silent flight
The skies are calling out to you and me
Over sea and over land
God protect us with your hand
Bring us safely to our destiny" So, I say to that: "Amen", dear Alan! So, I wrote him today, to thank him for being a big inspiration for me and for my career... Fernando.
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Apr 20, 2015, 6:54 AM
The second Audible voice of God to His son was a the Mount of Transfiguration (Mount Hermon), on the Day of Atonement (Tishri 10) of 27 A.D., the only day in the year when the High Priest entered into the Most Holy Place of the Temple! Peter, James and John were the witnesses here, when God Elected Jesus as 'The High Priest'!
La segunda vez que la voz audible de Dios se escuchó durante el servicio activo de Jesucristo, (siendo Dios mucho muy escueto en éstos Sus mensajes audibles), es cuando repitió la frase que le había dicho siete meses antes, ésta vez para ungirlo como Sumo Sacerdote según el orden eterno de Melquisedec (melek = rey + tzedek = justicia, Rey de Justicia, un superhéroe verdadero quien vive para siempre: el Rey Justiciero, pero que también es: Melquishalom, Rey de Paz), pero esta vez, nuestro gran Dios agregó: "A él escuchad", lo cual lo escucharon, aparte de Jesús, también sus tres más cercanos apóstoles. Cuando contamos las palabras que quedaron escritas de todo lo que dijo a partir de este momento hasta completar su servicio, efectivamente, tenemos más palabras a ser escuchadas (en un cálculo que hice, según recuerdo, hay un 77% más de palabras de Jesús dentro de este su servicio como El Sumo Sacerdote, comparado con su servicio previo, en el que solamente fungió como El Apóstol):
Updated Apr 20, 2017, 11:57 PM
Mujer Fuerte, Completando aquí mi lectura del libro de los Proverbios del hebreo: https://youtu.be/1abtG75fA-E , que culmina con el poema acróstico a tí, dando comienzo cada renglón con cada una de las 22 letras del alefato hebreo, del aleph al tav,, y que concluye diciendo, para la penúltima letra hebrea: "... Shin: Engañosa es la gracia y vana la hermosura; ¡la mujer que profundamente respeta al Dios fiel, ella será alabada!...". Y al igual que Iviis, yo también lo digo, y lo creo con todo mi corazón, que: ¡¡¡"Ni antes, ni después, el tiempo de Dios es perfecto"!!! Amén, en Cristo Jesús, Señor y Salvador de Ambos, Fernando.
Updated Apr 19, 2017, 1:26 PM
Fernando Castro-Chavez shared a memory.
9 Years Ago
Apr 19, 2012, 5:12 PM
Qué Hermoso Es! : http://www.youtube.com/watch?v=l76mBRQp_74 Con imágenes del Festival Musical del 2010, una bendición el convivir con santos creyentes de todo el mundo, de estudiar la Palabra, y de escuchar sus composiciones musicales alabando a Dios o enseñando a la Familia de Dios...
Recuerdos de creyentes:
Updated Apr 19, 2017, 12:44 PM
Fernando Castro-Chavez shared a memory.
10 Years Ago
Fernando Castro-Chavez added a new photo.
Apr 19, 2011, 1:56 PM
Aquí, restos de un caracol marino grande que encontré en el interior de una roca, evidencia de que las aguas del mar cubrieron a Texas quizás en el diluvio de Noé (los bosques petrificados de Arizona son aún más impresionantes):
Recuerdos del Diluvio:
Updated Apr 19, 2017, 12:43 PM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Apr 19, 2016, 8:21 PM
Y ahora, un poco de lo que escuchaba en mi adolescencia: https://youtu.be/4Ym6MOaKbsw
Recuerdos de la infancia:
Updated Apr 19, 2017, 12:39 PM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Apr 18, 2015, 11:10 PM
Yes, I believe in God’s prophecies! Of all the time that Jesus and his Dad God talked during the 70-week Ministry of Jesus, as prophesied by Daniel, it is amazing that only three times it was audibly heard the actual voice of God! The first time was when he was baptized by his older cousin John; at this time, God was Anointing Jesus to be ‘The Apostle’!
Las más maravillosas semanas en la historia de la humanidad, las 70 perfectas semanas del servicio de nuestro señor Jesucristo, las que se inician al momento en el que él es sumergido en el agua, y cuando, al salir de ella, el santo espíritu de Dios desciende, en forma visible como de paloma, y Jesús escucha la voz de su Abba quien le dice personalmente a Jesús que él es: "Su hijo amado en quien Él se complace". Las setenta semanas culminan con Cristo mismo enviando espíritu santo sobre los suyos en el Día de Pentecostés, día en el que lo reciben, ¡como 3,000 personas! Es decir, que primero la cabeza, y luego el cuerpo, ¡todos reciben el Don de Dios!
Updated Apr 18, 2017, 10:33 AM
It seems that at "Bethel Music", they prophecy and speak in tongues with interpretation; here, they compile some of those Words coming out of The Heart of God; next time, I´ll ask: "Does anybody want to sing in tongues with interpretation?" (Something available for almost the last 2K years, and still barely used!!!! & of course, that second part can be done as the person manifesting wants, either just speaking, or singing as well!); thank you Bob and @[100000612282452:2048:Candace Oliver] for showing me this one, and for a very awesome "Resurrection Celebration"; your song with @[1761157665:2048:Dianne McAllister] made me cry!!!: https://www.youtube.com/watch?v=4xx-AaGt29I
Updated Apr 17, 2017, 9:21 AM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Apr 16, 2015, 4:02 PM
The conversation of Jesus with his disciples in the outskirts of Sychar, in Samaria, is further evidence that the first seven months of the Ministry of Jesus, when God appointment him as ‘The Apostle’, corresponded to a Sabbatical Year; that explains the freedom of the people to flock, both around John the Baptist and around Jesus!
Santos Amados, ¡Feliz Resurrección Sabatina! La Cronología de la Vida de Jesús es Maravillosa y está muy clara para el que tiene ojos para ver, especialmente las 70 semanas de su Servicio (también llamado: "ministerio") activo, profetizado por Daniel, y también llamado "El Año Aceptable (o 'Agradable') del Señor" que se divide en dos períodos de aproximadamente 7 meses cada uno, siendo el primero cuando fungió como Apóstol (y andaba por donde le hicieron caso, de Samaria para arriba, con los fieles al Pentateuco). En la transparencia vemos que faltaban 4 meses para que este período concluyera, pues había sido un año Sabático en el que no se podía cosechar aunque estuviera maduro el grano, sino hasta su final, que caía en el Día de la Expiación (único día que el Sumo Sacerdote Levita Hebreo entraba en el Lugar Santísimo), cuando Jesús fue ungido por Dios como Sumo Sacerdote Melquisedéquico en el monte Hermón, en Damasco (en donde aún se fabrican las mejores espadas de acero del mundo entero, y Jesús regresa con espada de doble filo, @[1405591327:2048:Jeremiah Oliver] me lo enseñó)... quienes preguntan acerca de la fuente básica, favor de revisar: http://www.biblicalastronomy.com/jesusChristtheapostle.pdf y: http://www.preteristarchive.com/Books/pdf/1982_promised-seed.pdf, y mis videos relacionados: https://www.youtube.com/watch?v=9-EcBMbt9bc&t=18s , https://www.youtube.com/watch?v=MFDueUuA9ps&t=54s , https://www.youtube.com/watch?v=934ps7kMBHA y https://www.youtube.com/watch?v=sH0Ds-djk1E, Les Ama en Cristo, Fernando Castro-Chavez..
Updated Apr 16, 2017, 9:10 AM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Apr 14, 2015, 9:11 AM
Este es el audio de lo que compartí mediante Skype, viernes 10 de abril del 2015 como introducción a la "Cronología de Jesucristo": http://youtu.be/1PxydNXNdiw
Una vez más, recordando a aquel quien nos amó tanto, que dio su vida por todos nosotros, ¡sin preguntar nada!, sin cuestionar si lo merecíamos o no, y ¡sin siquiera considerar qué o quienes éramos!...:
Updated Apr 14, 2017, 9:47 AM
Aquí pongo mi lectura de Proverbios de hoy, ya casi terminando con ellos, hablan de cómo un líder que se alimenta de mentiras, acarrea miseria para con su pueblo, y de nuevo menciona al Sheol y al Abadón, que son insaciables como el ojo del ser humano, el primero por continuar almacenando difuntos y el segundo por contener a los ángeles encarcelados, los que se mantienen activos sin parar hasta que les llegue su día...: https://youtu.be/Yy2e3dBDEYI
Updated Apr 9, 2017, 5:24 PM
Fernando Castro-Chavez shared a memory.
A year ago, in Veracruz, MX, spreading the Good News of the Power of holy spirit from God within ourselves; today in Houston, seeking for the sweet lady companion for the rest of our days, and for those amazing little ones that the Lord will send... (ah, and I'll keep on doing abs for that belly of mine to disappear! :) )
Updated Apr 9, 2017, 3:35 PM
Fernando Castro-Chavez shared a memory.
9 Years Ago
Apr 3, 2012, 8:43 AM
La siguiente canción me motiva a introducir el estudio de más abajo, para que los lectores lo expandan, ya que la Palabra de Dios da vida y muestra Su amplio plan de salvación, no solamente a los cristianos, sino también a los no cristianos: "Tu palabra me da vida": http://www.youtube.com/watch?v=6Jsg1PAWZjM
Así de que Nuestro Gran Dios tiene un perfecto plan de salvación tanto para cristianos, como para judíos y para gentiles, y nos pide no ser tropezadero para ninguno de estos tres grupos claramente independientes, ¡y con los que el infinito amor de Dios se las entiende! Yo por mi parte, con mi casa, ¡serviremos a Dios por medio de Jesucristo!
Updated Apr 3, 2017, 8:50 AM
Fernando Castro-Chavez shared a memory.
9 Years Ago
Apr 2, 2012, 10:20 AM
@[1499774924:2048:Hazaelo DeJesús] me hizo ponerme a pensar en cuales serían las canciones específicamente religiosas que más me gustan desde mi infancia; creo que la primera de todas sería: "En Jesús puse toda mi esperanza": http://www.youtube.com/watch?v=I-A8LtGtrbM
¡Y seguimos poniendo TODA nuestra esperanza en Jesús, nuestro único Señor"
Updated Apr 2, 2017, 8:55 AM
Aquí está la continuación de mi lectura de los Proverbios del Hebreo, cuarta parte: https://youtu.be/japC6DFu840 Estos son una selección realizada de los muchos escritos de Salomón, por los hombres del rey Ezequías, aquí leemos eso de que las buenas noticias lejanas son como agua refrescante al sediento...
Updated Apr 1, 2017, 9:11 AM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Mar 31, 2015, 4:55 PM
Esta es la armonía de los cuatro Evangelios sin notas basada en el nexo previo: http://fdocc.ucoz.com/2/armonia_sin_notas.pdf [y también en docx, mismo nombre]
La continuidad de los cuatro Evangelios resalta la grandeza del "Año Agradable del Señor", el cual comenzó con el bautismo de Jesús por su primo Juan el Bautista y culminó con Jesucristo enviando espíritu santo desde el cielo para todo aquel que le acepta como su Señor, lo cual comenzó con sus doce Apóstoles en el día de Pentecostés:
Updated Mar 31, 2017, 9:17 PM
Fernando Castro-Chavez shared a memory.
10 Years Ago
Fernando Castro-Chavez added a new photo.
Mar 29, 2011, 4:01 PM
We did some analysis of old Texan rocks (Pat, Ed and me) and found the imprint of tree branches and of a cone shell. Basically every rock there is telling a story related to The Flood.
Restos del pasado en rocas de San Antonio, Texas:
Updated Mar 29, 2017, 9:34 AM
Aquí presento mi lectura del hebreo de Proverbios, del 19b al 24: https://youtu.be/r-QTU7mQonU
Updated Mar 26, 2017, 11:51 AM
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Mar 26, 2015, 9:05 AM
Based on the research started by Ernest L. Martin (1995), we can correct the maps related to the Temple that appear in the last half of an awesome pair of research manuscripts (1984) recently rediscovered: http://tinyurl.com/jcapohp [which I’ll review in my next W&S presentation!] Also, a statement in p. 70: “The Temple area (over 35 acres) was surrounded by a retaining wall built of immense stones, the largest as long as 46 feet, portions of which remain to this day” (B.A.R. May/June 1981) is now obsolete because we know that those walls, which include the “Wailing Wall”, actually correspond to the Roman ‘Fort Antonia’! But most importantly, because our Lord Jesus said that there will be left nothing, not even one stone over other stone (not only of the inner Temple and its outer walls, but of the complete Jewish city!!!
Remembering the locations of the Passion of our Christ:
Updated Mar 26, 2017, 7:53 AM
Today I met Prof. Luis Navarrete, from Peru, who has helped more than 900 adults to get their GED (equivalent to High School) within a frame-time from 3 to 6 months (something common in the U.S.)! His academic help page can be seen at: https://www.symbaloo.com/profile/lnavarrete and he also recommends: http://www.gedtestingservice.com/educators/home An inspiring example.
Updated Mar 20, 2017, 10:36 PM
Aquí está mi estudio de hoy sobre los Proverbios del Hebreo, capítulos del 17 al 19, para la edificación del oyente: https://youtu.be/wNs5cn1kE28
Updated Mar 17, 2017, 1:36 PM
Encontrando tu compañero de vida (grupo cristiano)
Mis hermanas en Cristo @[100006559380142:2048:Rut Booz] y @[1295941374:2048:Clau JGarb] me han invitado a participar en el grupo: https://www.facebook.com/groups/399466306885987/ para todos aquellos y aquellas que anden buscando pareja cristiana para el resto de sus días; allá puse mi mensaje, y mi foto de hoy, por si acaso desean verla y participar hasta ese gran día; en Cristo, @[100001280559168:2048:Fernando Castro-Chavez]
Updated Mar 15, 2017, 6:37 PM
Fernando Castro-Chavez posted in Encontrando tu compañero de vida (grupo cristiano).
Amadas Santas de la Presente Creación, Oferta, oferta, ¡oferta de una sola ocasión! Se subasta o regala persona inteligente... se trata de un creyente, estudioso de las cosas divinas, incluyendo a la Biblia, el uso práctico del don del santo espíritu, y recientemente, a la activación de los dones de servicio... es un postdoctoral en biología molecular aplicada a la Creación divina, trabajador, con 50 años de edad, esperando vivir otros 50, de 1.80 mts. de estatura, 78 kilos de peso actual (oscilando entre los 70 y los 85, los que se concentran en el centro); lo único que se requiere para su mantenimiento es proporcionarle el número de hijos que Dios quiera darles (él, es decir, quien esto escribe, le está pidiendo unos diez...)... para que en ello encuentre él la motivación para seguir adelante con El Crecimiento de la Gran Familia de Dios... tanto biológica como espiritualmente. Este ser humano quisiera que su futura mujercita fuera una jovencita, tal vez de entre unos 18 y 28 años... (por si conocen a alguien), y está abierto a toda buena oferta que se le pudiera presentar en ese sentido... tanto aquí en este foro, o en donde ahora vive, que es en Houston, TX, E.U.A.... todo ello se lo dejamos tan abierto a Dios como sea requerido... [La foto que aparece abajo es de hoy mismo, tomada a las 7:00 PM del 15 de marzo del 2017 en mi cuarto]. Atentamente, en el Cristo Vivo, Fernando Castro-Chavez
To the GED students: These two files are concluding the Class of Math: http://fdocc.ucoz.com/6/fdocc_GED_math_part1.pdf and http://fdocc.ucoz.com/6/fdocc_GED_math_part2.pdf Att., Fernando.
Fernando Castro-Chavez updated his status.
Yesterday, a big blessed and blessing day in company of my great brother Caleb, went to the Gym "Planet Fitness" as his guest, saw my dear friend Aracely after a year, then we went to H.E.B., I meet Kelly, and then Becky, Caleb ministered to the first one's hip, then, at the gas station we meet Miranda, a florist, and she gave us three gorgeous white orchids with their own and small water containers (each like a little green plastic and hermetic test tube), we gave one to Caleb's parents, another to father and son, Mark and Andy, then we kept the last one for our dinner table; then prayed (and still praying in the spirit), for the life of Marlon, injured in an accident and brother of Luis, the neighbor of Mark & Andy; today, we went to fellowship, meet Laurel, mother of Jessica (H.B.!!! To both!); then, studied all day for my class of math, teaching to ten of my hard working students of GED (Jorge, Yorlany, Lilibeth, Cristopher, Gerardo, Luz, José, Juan, Maria y Araceli) at the Gym of St. Mt. Cathedral, that they themselves requested to be thought even in "Spring Break"! Awesome the students that I have! And now, my dear brother Jerry is preparing an amazing dose of crawfish while other two of my brethren are recovering from last night... maybe we‘ll go back to the gym (PF)... however, today is colder than yesterday (~ a drop from 70 to 50 F down here)...
La tremenda continuación del libro de Proverbios que he estado leyendo directamente del interlineal hebreo con las notas de E. W. Büllinger insertas se encuentra en: https://youtu.be/HaJ2CFb21y4
Updated Mar 10, 2017, 5:16 PM
Dear students: Could these online materials help? https://web.archive.org/web/20140621140431/http://www.strongspace.com/saigon/public/upload/BaoLaTinhChua/HOCHANH/The_GED_for_Dummies.pdf, https://web.archive.org/web/20160331025702/http://www.rea.com/downloads/ged/GED2014OnlinePractice.pdf, https://web.archive.org/web/20160620214526/http://tutormemath.net/assets/ged_sample_practice_test.pdf, Fernando.
Updated Mar 9, 2017, 10:43 AM
Fernando Castro-Chavez shared a memory.
8 Years Ago
Mar 8, 2013, 8:10 AM
One of my favorite subjects is 'Adaptation', the origin of a reversible variation!, here exemplified by the cave fish (but imagine similar changes over an underground bipedal mammal): http://fdocc.blogspot.com/2006/02/adaptations-of-cave-fish.html
Adaptation:
Updated Mar 8, 2017, 12:28 PM
When visiting my dear parents, I also found a lost memory of my adolescence, of that night when I went to see the Russian Ballet, and at the end of the event I was able to go backstage and to see, like in a dream, the amazing ballerinas, and to ask for their autographs, some of them are deceased now, some others founded ballet academies, some did work for public arts, etc... time passes by... but only one thing remains forever... God's Living Word!
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Mar 4, 2015, 10:23 PM
The Bible mentions that the Book of God (Ps. 139:16) had all the instructions to form the human body; that ‘Book’ is ‘the Human Genome’!!! Its foundation is the Genetic Code, the dictionary that translates codons into amino acids!
This is true yesterday, today and tomorrow! Thanks to the Great Magnificent God and Dad that we have!
Updated Mar 4, 2017, 8:59 AM
Santos Amados: Aquí les dejo mi lectura de los Proverbios tomados del hebreo del 10 al 13 https://youtu.be/ae-4_v3ngb8 Los previos capítulos de Proverbios, del 1 al 9, se pueden escuchar aquí: https://www.youtube.com/watch?v=CwWMZHEk9C0&index=5&list=PLqrr904uU50ec-_hQCr3QxBxYB0LolyA0&t=31s Saludos y Deleites de los Cielos en Cristo, Fernando.
Updated Mar 2, 2017, 6:35 PM
Estimados Alumnos y Lectores, Ésta es la introducción bilingüe al producto de mis labores durante esos meses que estuve en México: https://youtu.be/-NuO49Xgw_0, que fue cuando estuve recordando y escribiendo acerca de mi mejor profesor de la infancia y de la adolescencia: Juan José Arreola. Estoy en las bibliotecas que llevan su nombre, en su pueblo natal Zapotlán el Grande y en Guadalajara, respectivamente; luego, detrás de mi, la más bella dama que conocí en dicho lugar, pero ella ya tenía otro interés amoroso, por lo que sigo buscando a la compañera de mi vida, ¿alguien se apunta? (yo deseo tener bastantes niños y seguir sirviendo a Dios con todo el corazón junto a mi bella y tierna compañera, ¡que me llegará de Dios!). En Cristo, Fernando Castro-Chavez.
Fernando Castro-Chavez shared a memory.
8 Years Ago
Feb 28, 2013, 5:28 PM
Three of the "Greatest Hits" with the students today were:
1 - The Costa Rican Jesus Lizard:
http://www.youtube.com/watch?v=45yabrnryXk
Four years ago I presented a set of slides showing the animal wonders of God to the "Yes!" charter school students, tomorrow, I'm on it again with a different and exciting topic (at least for me :) ):
Updated Feb 28, 2017, 3:23 PM
Body of Christ, Fallen Asleep, Awaiting the Return of Christ, One of My Best Friends in Houston: Margaret West (We'll Certainly Miss You Very Much, My So Dear Sister in the Lord!!!): http://obits.dignitymemorial.com/dignity-memorial/obituary.aspx?n=Margaret-West&lc=2673&pid=184135849&mid=7292764 (I'll Be There!!!). Fernando (From Zapotlán el Grande, Jalisco, México).
Fernando Castro-Chavez shared a memory.
Fernando Castro-Chavez shared a memory.
6 Years Ago
Fernando Castro-Chavez added a new photo.
Feb 16, 2015, 7:48 AM
Scientists who believe in God include Pasteur and Mendel. Pasteur founder of Microbiology and of the Modern Medicine and Mendel founder of Genetics and of Statistics!
Then, in my early adolescence , I did learn to value the work of two believers in God with real and practical discoveries of the Marvelous Creation of God: 1) Pasteur, the Founder of Microbiology and of the Modern Medicine, and 2) Mendel, the Founder of Genetics and of Statistics; If you go hand in hand with God, you are with the Best Company!!!
Updated Feb 16, 2017, 9:47 PM
He, reminding "me", when I was a kid, very curious about the Wonders of God!
Updated Feb 15, 2017, 9:09 PM
Fernando Castro-Chavez shared a memory.
9 Years Ago
Feb 14, 2012, 8:09 AM
... And also this one too, by Toby Mac, "Made to Love": http://www.youtube.com/watch?v=V2NDIq82H5s Happy Valentine's Day!
Happy Valentine's for All!!! With The Biggest Love being that from God and for God! In Christ, Fernando.
Updated Feb 14, 2017, 10:20 PM
Saint, When you search for the second sentence on the Internet, that of: "The Bible is not man's word about God, but God's word about man", you see that such phrase is almost unanimously attributed to the wrong Barth (meaning to John Barth, the American writer, and not to Karl Barth, the Swiss theologian, as it should be). One of the very few that got it right, the scanned material at Google Books!: http://tinyurl.com/karlbarth2 and http://tinyurl.com/karlbarth1 , and of course, its original source: Time, 20, Dec., 1968. So, beware! In Christ, Fernando.
Fernando Castro-Chavez shared a memory.
5 Years Ago
Jan 28, 2016, 11:31 AM
Es importante cuanto antes activar los Cinco Dones de Ministerio para el sano crecimiento del Cuerpo de Cristo, para evitar cosas como que los Judas, Ananías y Safiras de hoy controlen las finanzas que legalmente le corresponden a TODO el Cuerpo de Cristo, y para evitar que lobos rapaces intenten diezmar los corazones de los santos, o que personas se auto-engañen en "visiones" y "profecías" que no aprovechan. Por ejemplo, aquí presento un mensaje que le escribí a un creyente, pero si hubiera un equipo de profetas dentro del Cuerpo, en grupo se diría aún con mayor precisión y amor, ¡como plata refinada siete veces!: “Con humildad recomiendo que tú mismo te presentes con toda humildad y mansedumbre ante los demás. Cualquier luz verdadera que pudiéramos recibir es de lo alto, y ésta nos edifica y nos llena de gozo, y no de confusión. Dios Mismo es el Único que Revela Sus Secretos Divinos a los humildes, y esto está en plural, no solamente a uno sólo, ya que uno sólo pudiera fallar, sino en plural, y nos dice: ¡A Sus Santos Apóstoles y Profetas! ¡No es bueno jactarse de nada! Solamente Dios es quien nos exalta, no nosotros a nosotros mismos, eso cae de peso. En México decimos que: "Cae primero un hablador que un cojo". ¡Hemos aprendido que no importa quien cante, lo importante es que la canción se cante! Esto es como un ejercicio de humildad. Espero que no me tomes a mal lo que te digo, pero en mi espíritu confío en que es por tu bien el decirte que necesitas presentarte con una humildad genuina, y no con altivez para que tus palabras sean recibidas por los santos. Si me equivoco, por favor házmelo saber. En Cristo, Fernando.”
Santos Amados, El gran Apóstol Pablo remitió a los neófitos y a sus inexpertas "revelaciones" a que fueran a ser evaluados por los Apóstoles y Profetas de su tiempo y de sus grupos, pero, ¿cómo se hará esto ahora, si en la mayoría de los grupos cristianos de hoy hay un lidercillo envanecido que se siente “intocable”, y que evita que se activen los dones de servicio en los grupos regidos por él para evitar "perder" su dominio (y una de las estrategias que usa es la de super-condenar a cualquier miembro que desee expresar lo que Dios le está inspirando, convirtiéndose en un juez implacable e “im-perdonador” de las faltas de sus “subordinados”, oh, ¡qué lejos están de Cristo aquellos que se olvidan de que el Cuerpo de Cristo trasciende nacionalidades y denominaciones y se limitan a lo que llaman su propio “ministerio”, excluyendo a aquellos que tanto podrían realmente hacer crecer al Cuerpo de Cristo en esa área, más no a una “denominación” o “marca registrada” religiosa desarrollada por simples hombres!)? Oh, señor, suplico que tú, oh Cristo, como cabeza genuina de tu Ekklesía, toques los corazones de sus líderes para que en humildad establezcan el ambiente propicio para que también ahora haya múltiples Apóstoles, Profetas, Evangelistas, Pastores y Maestros en cada grupo Cristiano, pues en lo que a tu papá Dios respecta, Él ya cuenta con haber dado esos dones a los hombres por medio tuyo, ¡desde el día de Pentecostés! En Cristo, Fernando.
Updated Jan 28, 2017, 7:55 AM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Jan 25, 2016, 8:38 AM
Y Santos muy Amados, ¡Si llevan muchos años bajo un grupo cristiano carente del crecimiento directo que Cristo da, y aquí en los Estados Unidos, ¡aún la mayoría de los líderes, después de más de 30 años de servir, aún se extrañan mucho de que pueden consultar directamente con Cristo, lo que se refleja en grupos sin espíritu que ni crecen, o peor aún, que desaparecen!; por lo que, aún cuando la enseñanza de la Biblia sea correcta allí, los que enseñan, se den cuenta o no, están siendo usados por las astutas estratagemas del Adversario, por sus propias mentes y sus debilidades de vanidad, evitando siempre llegar al centro de nuestra era de gracia: ¡Que cada creyente puede comunicarse directamente con Cristo, la cabeza, de forma tal que cumpla con su función en el Cuerpo de Cristo al usar los Cinco Dones de Ministerio, y el resto de los Dones de Servicio, según Cristo mismo lo guíe, para un verdadero crecimiento conforme a Cristo, y no conforme a líderes plagados de debilidades carnales, y yo me incluyo!
Activating the Gifts of Service: https://www.youtube.com/watch?v=3J9RClh7cKI Activando los Dones de Servicio:
1: https://www.youtube.com/watch?v=-hwLsUQVO8w
2: https://www.youtube.com/watch?v=orrZPMigoQI
3: https://www.youtube.com/watch?v=ZjQSklK0JyE
1: https://www.youtube.com/watch?v=-hwLsUQVO8w
2: https://www.youtube.com/watch?v=orrZPMigoQI
3: https://www.youtube.com/watch?v=ZjQSklK0JyE
Updated Jan 25, 2017, 8:47 AM
Fernando Castro-Chavez shared a memory.
5 Years Ago
Jan 22, 2016, 1:31 PM
Santos Renacidos: ¿Y cómo proteger a los miembros del maravilloso Cuerpo de Cristo de sus propias debilidades humanas, y esto incluyendo desde luego a TODOS los líderes? Respuesta: ¡Mediante el deliberado uso de los Cinco Dones del Ministerio de Reconciliación!; ¡Conviene que haya grupos de profetas en cada comunidad Cristiana para que digan las cosas tal y como Dios las ve (mirando incluso a los líderes a los ojos)!; ¡Conviene que haya grupos de pastores que cuiden de las necesidades espirituales, emocionales, físicas y materiales de TODOS los creyentes de cada grupo Cristiano y no sólo de los líderes!; ¡Conviene que haya apóstoles que confronten y exhorten a los santos como Pablo en sus Epístolas, e incluso como lo hizo con Pedro, (y no que simplemente le den la espalda a otros)!; ¡Conviene que haya evangelistas que reconcilien, es decir, que conecten directamente a la gente con Dios para que Dios mismo responda a todos!; ¡Conviene que haya maestros que con toda mansedumbre y autoridad presenten las cosas de forma tal que los oyentes abran sus ojos ante la faz de Jesucristo, y no ante malos líderes amadores de sus propios vientres!
Hace un año estudiaba yo acerca de los cinco dones de servicio para edificar al Cuerpo de Cristo, y cómo es que al ser "dones" son algo ya dado por Dios que es responsabilidad de cada grupo del cuerpo de Cristo activar... como grupo, especialmente inspirados por Cristo quien es la cabeza pero alentados por los supervisores, episkopos, por los servidores, diáconos, etc., es decir, por aquellos que realmente desean ver crecer el Cuerpo de Cristo y no sus bolsillos o su popularidad personal, es decir, los que no toman a la ligera para su beneficio personal su servicio al resto de los santos renacidos llenos del espíritu de Dios...
Updated Jan 22, 2017, 8:42 AM
En los Estados Unidos, la costumbre es jurar decir la verdad poniendo la mano izquierda sobre la Biblia, mientras que se levanta la mano derecha extendida. En el caso de Trump, para asegurarse que se regirá por la verdad, y que hará lo mejor en su gobierno con la ayuda divina, él quiso, no solamente jurar sobre la Biblia gorda de Abraham Lincoln, sino también sobre la Biblia azul personal que le regalara su madre en la infancia: https://www.youtube.com/watch?v=tcfrbB9hpoI
Fernando Castro-Chavez shared a memory.
5 Years Ago
Jan 20, 2016, 11:21 AM
Santos Amados, Hoy llegó mi amigo FB # 3000: "Biblia Santa Valera"!!! A éste y a todos ustedes, santos de todos los colores y sabores, comento con toda humildad y mansedumbre que hoy investigo acerca de la consciente y deliberada activación de los 5 Dones del Ministerio de la Reconciliación por parte de los miembros de cada grupo del Cuerpo de Cristo! Herramientas que uso para capturar lo que dice la Escritura acerca de cada Don de Servicio: http://www.lcoggt.org/Wescott-Hort-Robinson-GreekNT.pdf , https://elmundobiblicodigital.files.wordpress.com/2015/03/252784253-nuevo-testamento-interlineal-griego-espanol-de-francisco-lacueva-barcelona-editorial-clie-1984-version-completa-y-optimizada-pdf.pdf , http://biblehub.com/interlinear/ephesians/4.htm Y, extra, los interlineales del A.T.: https://elmundobiblicodigital.files.wordpress.com/2014/02/a-t-interlineal-hebreo-espac3b1ol-vol-i.pdf , https://elmundobiblicodigital.files.wordpress.com/2014/02/a-t-interlineal-hebreo-espanol-vol-ii-pdf.pdf , https://elmundobiblicodigital.files.wordpress.com/2014/02/a-t-interlineal-hebreo-espanol-vol-iii-pdf.pdf , https://elmundobiblicodigital.files.wordpress.com/2014/02/a-t-interlineal-hebreo-espanol-vol-iv-pdf.pdf Amándoles mucho en Cristo con un Amor Incondicional, Fernando Castro-Chavez!
Leaders come, leaders go, but Christ our Brother and our Lord Remains Forever! And so his family! (No matter what).
Updated Jan 20, 2017, 9:08 AM
Dear All, These days, the nearby volcano ("The Colima"), is spitting more volcanic dust than usual. In my hand I have the collected "ash" from a small plate left outdoors overnight. If you go closer to the volcano, you find the porous light rocks shown below (the negative effect on the lower right image shows the visual similarity of the material). The rights sides are a close up of the left images. In Christ, Fernando.
Together with my parents and sister, I prepared Sauerkraut, an excellent source of goodies for the intestine, and, with exercise, also an aid to help reducing the stomach built on the past vacations...
Fernando Castro-Chavez shared a memory.
Dear All, This is my artwork from five years ago at the "Baylor College of Medicine" (Houston, Texas), and it looks like if it were today! With lots of changes, but my heart for God won't change!! God's Blessings to All in Christ!!! Fernando.
Updated Jan 13, 2017, 8:26 AM
Aquí estamos, la escritora Virginia Arreola Zúñiga, hermana de Juan José Arreola, y yo, después de haber completado el "Prefacio". Aquí está su fragmento inicial: "Primeramente diré que mi hermano comenzó siendo declamador y poeta, y éste es el poema que entre Juan José y yo, Virginia… hicimos…": Soneto: Tiempo de Zapotlán, tiempo dormido / al pie de un monte que tu sueño vela... (las líneas nones son las de Juan José, comenzando con la primera y gran línea..., y las pares que les siguen son las mías)... [Mi Nota: Amada de Dios y de mi, Virginia, ¡Muchas Gracias!]
Hello, This is my painting 4 U, "Flamingos", with my earnest desire for your best 2017!!!: In my case, this will be a beautiful family looking towards the same God, and with an increase of little "flamingos"... this, and a song, reminding us that, really, it never is "too late...": https://www.youtube.com/watch?v=ULb_oFejouI plus, my writing again on "The Promise"
Such as the fruit is the fulfillment
of the promise of the button and its flower,
The butterfly is the fulfillment
of the promise of the worm and its cocoon,
The chicken is the fulfillment
of the promise of the hen and of its egg,
And the baby is the fulfillment
of the promise of the woman and her belly,
The eternity is the fulfillment
of the human promise and their anointed!
Fernando Castro. (Thanking God for His forgiveness in Christ, and asking in their names for your forgiveness towards me). With All My Love.
Such as the fruit is the fulfillment
of the promise of the button and its flower,
The butterfly is the fulfillment
of the promise of the worm and its cocoon,
The chicken is the fulfillment
of the promise of the hen and of its egg,
And the baby is the fulfillment
of the promise of the woman and her belly,
The eternity is the fulfillment
of the human promise and their anointed!
Fernando Castro. (Thanking God for His forgiveness in Christ, and asking in their names for your forgiveness towards me). With All My Love.
Éste es el mirador desde el cual Juan José Arreola nos enseñaba algunas maravillas heroicas, como la siguiente acerca de su tío, el íntegro educador y varón de Dios Don José María Arreola Mendoza y nos decía que así también nosotros habíamos de ser: http://fdocc.ucoz.com/6/chema_arreola.htm Con el fragmento de un poema dedicado a él y a Él:
A Mi Distinguido Amigo
El Sr. Pbro. José María Arreola
Tras los celajes que la nube oculta
Se pierde tú mirada,
Y en los mundos que insulta
El miserable ateo, cuando á la nada
Atribuye su máquina grandiosa,
Tú descubres á Dios en cada cosa...
Graham Bell
Zapotlán, junio 24 de 1895.
A Mi Distinguido Amigo
El Sr. Pbro. José María Arreola
Tras los celajes que la nube oculta
Se pierde tú mirada,
Y en los mundos que insulta
El miserable ateo, cuando á la nada
Atribuye su máquina grandiosa,
Tú descubres á Dios en cada cosa...
Graham Bell
Zapotlán, junio 24 de 1895.
#yearinreview2016 |
#yearinreview2016
At: https://www.facebook.com/TastersOfTheWord (please, check its index), I´m reaching now Arreola's Class number 33, and very close to its end (with two more left!), it's time to start producing my own literature based on Arreola's literary principles! Don't you think? Here is my first "tenth", but free ('Decima Libre' in Spanish, the most common composition of Zapotlan, the birth place of Arreola and of my mother), dedicated to that ONE and ONLY woman (still unknown to me), that will be my wife for the rest of my days, to build our big family serving in love God and His family!:
The Promise
Such as the fruit is the fulfillment
of the promise of the button and its flower,
The butterfly is the fulfillment
of the promise of the worm and its cocoon,
The chicken is the fulfillment
of the promise of the hen and of its egg,
And the baby is the fulfillment
of the promise of the woman and her belly,
The eternity is the fulfillment
of the human promise and their anointed!
Fernando Castro.
Then, I put HERE the inspiring portions of "The Arreola's Chair" that led me to it:
First Arreola said that the most important line of poetry of all the French literature, by common agreement of the French Poets was:
“‘And the fruit improves the promise of the flower’ or ‘the fruit provides for the promise of the flower’ or ‘the fruit fulfills the promise in bloom’… Which one is best for you? The last one of the three is the most poetical. It is said that this is the best verse of the French poetry. It was written by a minor poet, François de Malherbe – Frank Weed (lit., in Spanish: ‘Francisco Maleza’); of the oldest second names in France, were nicknames –, the original verse (in French) reads as follows: “Et les fruits passeront la promesse des fleurs” (‘And the fruits provide for the promise of the flowers’)” ("Apuntes", by Preciado Zacarias, our textbook, see the end of this post and the first slides).
And then, I read in his speech for women entitled "The Implantation of the spirit" and in other two of his works:
“Imagine you that we find one of those worms falling from the tree that are on the sidewalk exposed to be squeezed by the first walker-by who is either distracted or malicious. We confront the worm and we ask: do you want to be a butterfly? The worm no doubt will laugh at us. Attached with all its body to the surface of the earth, the proposition to fly may seem to it frankly laughable and, however, through an act of profound meditation modifies apart of its cellular structure all the mass of its original matter making it to evolve from that substance almost viscous, liquid, to the perfection of the shiver, of the chip of color and light which transforms into the double eave of wings the shining glow of the butterfly” (Obras).
"I believe that the enigmatic operation that resolves a worm into a butterfly is due to a deep reflection; that which we all should undertake going into the inside of our lives. The worm crawls on the ground, being it the surface of a stem, a leave, a trunk, or simply let's say: the worm crawls on the surface of the earth. But lo and behold that it decides to fly. Then it goes into itself and he embalms itself with its own substance like a mummy that knows that it is capable of resurrection. Because it is going to emerge from its own material being, but encouraged by the spirit. As all of us. Hence its deep thought. Such as Jonah encompassed and then delivered by the whale, that mass of original nothing that returns the Everything for us, if we are capable of a good act of reflexive contrition."" (Inventario).
"Butterflies exerted on me as for ever a great fascination, that increased of course when I learnt that the Greek represented the soul, the "psique", as a butterfly. I have written elsewhere about the metamorphosis. For me, it is a phenomenon of reflection. I remember a lot those horrible worms... I think that suddenly the worm understands its condition and decides to encapsulate into a self-enclosure, it decides "to be abstracted itself", to annihilate its being and to resurrect into another, infinitely more beautiful. Life goes towards an infinitesimal bridge to death. The horrible worm is transformed into the imaginable light creature, winged, wonderfully endued of light corpuscles." (Memoria y Olvido).
All of this leads us to the Seventh principle that I take from Arreola's Class: "7. Write!"
Then, I may say that the virtual Biblical recordings and presentations that I initially started more than three years ago in Houston I decided to entitle them as: "Tasters of the Word" ('Catadores de la Palabra', in Spanish). This title was inspired to me through the Scripture that says: Psalm 34:8 "Taste and see...".
Last week, I got very impressed when I discovered that Arreola had a similar inspiration but for a different application ('poetry!'), here are his words:
“In the same way that there are tasters to see where are irradiation, there must be tasters of poetry: that we could be able pass over a poem and in a given time, when there is poetry, the needle could be able to move” (Jorge Arturo Ojeda when interviewed by Victor Manuel Pazarin about Arreola, his teacher):
https://web.archive.org/web/20161115204845/http://www.revistadelauniversidad.unam.mx/ojs_rum/files/journals/1/articles/15854/public/15854-21252-1-PB.pdf
Then, to conclude properly this ante-penultimate class I will add some of the beautiful and most frequent readings that Arreola used to do for us, his students:
“In “Notes of the Idle Summer” of El Espectador (a newspaper, ‘The Spectator’) you can find – with that elegantly twisted language of Ortega (y Gasset) that always amazes me – some portraits of women that are worthy of admiration. ‘In the Bar Basque’, below the Grand Hotel on the Biarritz beach, summer station in the Gulf of Gascony, describes for us a woman that is not all whole, that remains absent”:
In the Bar Basque
By Jose Ortega y Gasset
…with such a mild and restrained smile as if a spiritual rein were retaining her… The best of herself did stay there far away, attached to her loneliness, as the Hamadryads nymphs, that could not leave the tree where they lived infused.
“The real leisure in women consists for Ortega y Gasset in that “divine gesture of choosing” that retains the elegance of their person and that lies in the long hours and spaces that she keeps for herself”.
“Let’s see, let’s read another splendid essay by Ortega (y Gasset) where he paints for us the silhouette of a countrywoman garrisoning of the rain under the arch of a porterhouse”:
"Our Lady of the Sieve
By Jose Ortega y Gasset
However, in the countryside rain falls sometimes with a delightful prestige. I keep the musical memory, almost ‘Beethovenian’ (from Ludwig van Beethoven), of a storm in Castile…
It was the time of August, muggy, restless, and in that cold land they were still in the harvest. The little towns were girded by the golden belt of the wheat fields (lit., in Spanish: ‘las eras’), where the mountains of mowed wheat (lit., in Spanish: ‘parvas’) sparkled like yellow jewels. At noon I reached Romanillos, a small village capsized in a sea of wheat ears. I entered the inn to protect myself from the excess of sun. In contrast to the outer radiation, the hostel looked like a cool murk. In contrast, from within the dim, the gantry was a cinematographic screen overfilled with light and vaguely unreal. The peasants were crossing through the road, dressed with knee-breeches and bandanna Soria style (lit., ‘a la soriana’) – bodies of giblets, and gnarled, black skins, ivory teeth -. Behind them, the little mules, sounding their bells, laden with sacks of blonde barley, freshly winnowed. All the people of both sexes were working nervously in the fields, because at that time the rains are imminent and the harvest can be fermented if it is not collected soon.
Over the horizon rears its black shoulder a round cloud, baleful, malefic, magical, and with it a strange drama in the landscape. Suddenly enters the threshold a swirl of dust (lit., in Spanish: ‘tolvanera’) that lights the darkness countless little lights with the color of gold: the thin straws flying and blinding. Shortly after other burst and another. Thick drops exploding over the dust of the road are falling. The passers-by enliven their step. The drops now are thinner and a giant thunder rumbles. The cloud covers the horizon. Arriving on the run, in a triumphant gallop, as if within it a barbarian god were traveling. Rains. People passes running, the raining squalls. Another thunder seems to crush the valleys near the river (lit., in Spanish: ‘las vegas’). A thunderbolt gives its whip to the aerial horses of the cloud. The dust storm obscures everything, and suddenly enters a mouthful of men and women seeking protection in the hallway. Laughs, cries, a spontaneous rural orgy. In the door jamb, in the backlit stays a wench. The red petticoat hugs her hips, and a white female blouse swells, like a candle, under the double elastic wind of her breasts. She is blonde, like barley, and with blue eyes, like where sprigs of water are born (lit., in Spanish: ‘hontanares’). She supports herself in one leg and the other leaves a stilted rump upon which she lets to rest a sieve (lit., in Spanish: ‘harnero’) that she is holding with her arm.
Among the shouts the sibilant voice of an old woman is heard, with an obscure and thick face, with Sibyl eyes, saying indecencies, exalted by the adventure, electrified by the lightning and the agglomeration. She speaks of the lima beans of the country and her pupils see in the air the eternally presiding Priapus of the harvests. The gal at the threshold smiles on hearing her, as dissolving and annulling, by force of essential virginity, the lubricating allusion. She is so beautiful and so virgin, that I decide to adore her under the title of ‘Our Lady of the Sieve’. The storm gives up. The dust storms subside. A fresh breath arrives tasting like straw and cloud. Some people do abandon the meson. The little bells of the blunted little mules are heard again and a new ray of sun entangles itself in the hair of the virgin. To the symphonic crescendo (‘increasing’) of the meteor follows a soft diminuendo (‘decreasing’). The landscape returns to its compass. And I’m on the road again…"
https://web.archive.org/web/20161113231040/http://mercaba.org/SANLUIS/Filosofia/autores/Contemporánea/Ortega%20y%20Gasset/Obras%20completas/Tomo%202.pdf (pp. 412 – 414, and from there, replace the 2 with numbers from 1 to 9 to get all the volumes of the works by Ortega y Gasset).
The isolated story also at: https://web.archive.org/web/20161115150606/http://www.revistadelauniversidad.unam.mx/4808/4808/pdfs/48delacolina.pdf
Then Arreola also selected:
“…D’Annunzio‘s “The Rain in the Pinewood” is phonetic. You feel the rain falling as you read it (then he reads this poem in its original tongue, Italian. Here below is my particular translation into English)”:
"The Rain in the Pinewood
By Gabriel D’Annunzio
…Listen. Rains
among scattered clouds.
Rains over the tamarisks
brackish and burned,
rains over the pines,
flaky and rigid,
rains over the myrtles
divine,
over the broom that shines
with novel flowers,
over the thick gin
of fragrant buds,
it rains over our faces
wild,
it rains over our hands
naked,
over our clothing
light,
over the novel thoughts
whose buds are opening
in the soul,
over the beautiful tale
that yesterday
captivated you, and today captivates me,
o Hermione, do you hear? The rain is falling
over the lonesome
greenness
with a lasting crackling
and changes in the air
according to the fronds
the thicker, the clearer.
Listen. Respond
to tears, the song
of the cicadas
as the austral cry
doesn’t scare them, neither an ashen heaven.
And the pine
provides us with a note, and the myrtle
another note,
and the gin
another sound: instruments
diverse
under numberless fingers."
Then the disciple, Vicente Preciado selected a delightful one:
"Preciado: “I brought the promised prologue. Speaks about Joyce starting with a beautiful depiction of a Rolls Royce”:
"Excerpt of the Prologue to James Joyce’s in Spanish: “A Portrait of the Artist as a Young Man”
By Antonio Marichalar
“Stops raining; the last droplet falls in the “Rue de l’Odéon”. The atmosphere, freshly frozen, boils in imperceptible hum”. Suddenly, piercing the gray veiling, disembogues something clear: arrives the solemn silence of a magnificent Rolls. It carries a weightless step and muffled the look of glass of its speechless headlights. Like a continuous murmur, it slides seeping, stealthy, meek. barely causing rumor the fluffy turn of wheels that are detaching softly from the wet decorated soil (in Spanish: “entarugado”).”
“Furrowing the street, through the line of houses, advances the car until bumping with a pennant that, starting a pass from the façade, interposes itself and forces him to stop. It has stopped in front of a bookstore in whose tagline says: “Shakespeare and Company”.”
“With a dull hum the car gets quiet. A flap door yields, and, in the inner mansard, it stirs a vague scent of furs, of pearls, of woman… in short emerges the camber of a necklace and slightly waves over the abyss of the sidewalk. Grazing the biggest pearl, ventures as well, a foot – is the most elegant duchess in Paris… a schoolgirl irrupting approaches her… outstanding through the bookstore… She is the captain; in the shelves the rigid volumes, aligned, fit, obey her voice. The two women speak, and a book – fatal parcel – takes a step forward. The lady takes it like a trophy… Back to the car, clutching her treasure. The prestigious J.J. that justify in the copy the printed number of the book, themselves correspond exactly to those R.R. that flaunts on the shining frontal the abducting car. James Joyce: Rolls Royce…”
Arreola: “Antonio Marichalar (is the author)! And here you have the end of that paragraph that it is very beautiful: “Let’s Go. The “chauffeur” sinks-in the black hat… the car sets sail. And it’s leaving, suspended in the mist, displacing silence – and folding back on passing the lasting trail of its own rumor”…”
Then Arreola selected:
"Autumn Song
By Paul Verlaine
The endless lament
Of the tearful violin
Autumnal,
Wounds the heart
With a languid song
Lethal.
Always dreaming,
And feverish when
The hour sounds…
My soul reflects
The senile life
And cries.
And drags a brutal
Perverse wind
To my uncertain soul
Here and there
The same as that
Dead leaf."
Plus:
“Culture shouldn’t be imposed. Culture is the adoption of the legitimate; only by that measure are we universal. Culture shouldn’t be ostentatious; should ooze, should emerge from the daily living. Culture is not imminent: should be transcendent. Only God is imminent and transcendent (and should transcend from us in the measure that He prolongs His being to the region of the secrets (“mysteria”) and the revelation)… I – being pantheistic – can see the creation as a manifested God. God is transcendent: He is before and after the creation. God He is being, as Rilke says. God is yet to come constantly. According to Grillparzer”:
"Something about the Times
By Franz Grillparzser
If my time contradicts me,
I let it go quietly.
I come from other times.
Waiting to go to others."
“The last tercet of a sonnet by Alberti says”:
"Excerpt of “The Bull of Death”
By Rafael Alberti
To be a shadow armed against armed light,
mortal derision against derision,
bull without tears against the bravest."
And:
"...let’s see it in the poetical perfection ruling the next sonnet”:
“To Rosa de Alberti, who Played, Thoughtful, the Harp”
By Rafael Alberti
Rosa de Alberti there above the baseboard
from the oriel of heaven was its opening,
throbbing the wind and cousin of mine,
to the neck a white bind of Moire.
The banister of the harp, from the foot
to the curl in the snow, she was covered.
Entangling her cords, she was greening
- something in threads – the hand that was.
Full of softness and carmine,
Lighthouse of dreams, sloven and flightful,
Flew to the highest balconies.
Look at her Cherub of cherubs,
Of the orchard of the airs pulsatrix,
Thoughtful de Alberti among the flowers!"
"Preciado: “What is a high “baseboard” (in Spanish: “rodapie”)?”
Arreola: “It is a kind of grid that, as an edging of wrought iron, did cover the bottom of the railing of the Balconies to prevent that from below, it could be seen, the feet of persons… the feet and something else…"
“The internal rhythms in poetry were originated in the biblical verse. This internal rhythm in the poem is the estrus (“estro” in Spanish) of the Greeks that is not known where did it originate. “The black luminary of the look” is a verse of one of my sonnets (Arreola laughs).”
“I suffered the terror of feeling like an ant in a concrete gully in New York. I was there, aground, two or three weeks between Broadway and the Eight Avenue feeding on Smyrna figs and milk… There a humble hit of mine – on speaking of the sonnet of the “Unfortunate” of Gerardo de Nerval – was to rhyme (in Spanish) “waste tower” with “melancholy”. Antonio Alatorre corrected my first version. He added that of: “turn me into the Posillipo”. Posillipo is a promontory of the Navy of Naples.”
"Excerpt from “Inventory”
By Juan Jose Arreola
I am murk, the widower, the disconsolate
prince of Aquitaine in his wasted tower.
My only star has died, my laud is constellated
the black sun holds of melancholy.
In the funereal night, you who have comforted me
turn me into the Posillipo, and the sea that was mine,
the flower most pleasant to the desolate chest,
the vine in which the pompano of the rose is an ally"
“Arreola now reads a fragment of a letter sent by him to his father from Mexico City in 1944”:
"Fragment of “A Letter to my Dad, 1944”
By Juan Jose Arreola
The fixing of my teeth, costs eight hundred and fifty pesos…I have two days bleeding because of a molar… The dentist is of certain Polendos (“polendas” in Spanish)… he is going to extract to me others more: “I’m going to make you a railway settlement like to the gate of Maria Rojas (explanation: She was a wealthy elderly owner of one of the estates most beautiful and stately in Zapotlan. Her avarice prevented her from changing the wood of the door of her barracks, only admitting patches of nailed planks in said gate).”
Then Arreola continues: “Nobody could say that in me a fire of straw was all that burned, Here in Zapotlan we call it: “a flare of “petate” (a “bedroll” made with dry vegetable fibers)””.
“In ‘The Fair’ someone says: ‘Every year there is among us a man who is responsible for fulfilling the word, that man is the steward, that one who died’. Its first draft had as its epigraph: ‘nous sommes la piétaille’ (lit., from the French: ‘we are the rank and file’), by Charles Péguy. This verse comes in the poem: “Presentation of the Beauce Region to Notre Dame of Chartres”. The constant recurring image that repeats itself is the cathedral of Chartres like a ship rowing on a sea of gold: the plain populated by wheat. The cathedral has two unequal towers because two different architects built them. Peguy used to walk, from Paris to Chartres via Versailles… Péguy was an infinite poet. He wrote a poem entitled Eve, it contains sixteen thousand verses joined in four thousand Alexandrian quatrains. He married a girl belonging to the Jewish community. Péguy is the Amado Nervo of France. He loved the editorial work and he had a print shop and a bookstore. ‘Les Cahiers de la Quinzaine’ (‘The Notebooks of the Fortnight’) was a magazine he founded in 1900. He died in the trenches of a bullet of Mauser at the base of the nose.”
“Father Ignacio Macias Campos – parish priest of Tamazula – is the priest who appears in ‘The Fair’”:
"Excerpt from “The Fair”
By Juan Jose Arreola
- I accuse myself Father that in the press where I work we also do the newspaper of Don Terencio.
- Well, that’s not your fault.
- Not, but in the last number go out a few verses of a military man.
- Tell them to me.
- Let’s see if I remember:
“Retro expired, cassock bandits
Spawn of Loyola and Satan”
- What atrocity!
- And when they were going to put that statement to the press, I saw that it said ‘spaun, with ‘u’, and I put the ‘w’. Is this a sin?
- No… it’s not a sin… "
“When Hosea says: “Go and take adulterous wife” (Hos. 1:2), he refers to Israel as a fornicating wife.”
“First I was a poet (Arreola said); then a prose writer. Poetic prose”
“A “pastiche” is a text made in the exact style of an author. I did one imitating even the poetic rhythm: “Tacata-ta, tacata-ta, of Berceo”. The best “pastichero” (“pasticho”) is this Argentine (Conrado) Nale Roxlo who makes perfect imitations of Unamuno, Pio Baroja, Dario. Another brilliant “pastichero” is Alphonse Allais. Listen… (then he suffocates in laughter while translating a scene of an elevator transformed into a sardine can written by Allais, imitating Proust).
“(One of Arreola’s books:) ”Varia Invencion” (“Varied Invention”) means: “Varied Imagination”, (inspired is title in a) sonnet by Don Luis de Gongora written in 1584”:
"Fragment of “Sonnet 72”
By Don Luis de Gongora y Argote
Varied imagination, that, in a thousand attempts,
through regret you are wasting your sad owner
the sweet ammunition of the soft dream,
feeding vain thoughts."
“Here, hear this (Arreola says)”:
"Excerpt of the monologue of Sigismund in the drama “Life is a Dream”
By Calderon de la Barca
Woe miserable of me, and woe so unhappy!
…for the major offence
of man is to be born.
…The bird is born, and with the galas
that provide him with great beauty,
very nearly is flower of feather
Or corsage with wings.
…the fish is born, without breathing
abortion of eggs and slippery
and just a ship of scales…
and having myself more life,
have I less freedom?"
“(Joseph) Bergamin wrote the best sonnets. He arrived to Mexico with the first group of Spanish refugees in 1939… Spaniards still do not know the poet that Bergamin is”:
“Sonnet III” (from: “Seven Unpunctual Sonnets”)
By Joseph Bergamin
Let’s go and tell to the clear down,
the sky, the sea, the rapid element
that makes quiet with its own motion
the light over the glass where it stands;
Let’s go and tell the rare bird
when it dwells with its wings on the wind;
to the submarine fish; and to the grey
mole that declares his shady desire;
to the star that focuses her sight
in the high, spacious firmament
by shiny shouts surrounded;
let’s go to tell them about the cry
of one blood that cries in prison
in a chest without light, nor sea nor wind."
“Sem Tob (ben Ishaq ibn Ardutiel) a Jew converted to Christianity – and with verse (note: there is a word game that is lost in translation, as “converted” is ‘converso’ in Spanish, and “with verse” is ‘con verso’ in Spanish) – he said: “the truth is the truth, even if a Jew is telling it’. He lived in the mid-fourteen century”:
"Excerpt from “Moral Proverbs”
By Sem Tob
Being born in thorn
the rose, I do not feel
that loses, neither the good wine
by emerging from the vine.
Neither is the goshawk less
by continuing in a vile nest,
neither the good examples
even if a Jew tells them."
“Rodrigo Cota (de Maguaque) is a Spanish Jew of the times of Don Juan II. He was a doctor. He knew de secrets of medieval pharmacy. To him has been attributed the first act of “La Celestina” (‘The Tragicomedy of Calisto and Melibea’), the first novel of the Spanish literature. In other words, Rodrigo (de) Cota (also written with the intermediate ‘de’ in Spanish) intervened in the body of La Celestina. “Be careful with your laughter, Melibea”… He is the author of the ‘Dialogue between Love and an Old Man’. We did present this dialog with Liliana A. in the ‘Lake House’in 1965”:
"Excerpts of the “Dialogue between Love and an Old Man”
By Rodrigo Cota
The Old Man
My door was closed
What’s the reason of you coming? From where did you enter?
Say, thief, why did you jump
the walls of my garden?
Age and reason
already from you have released me;
leave the poor heart
retracted in its corner
contemplates which thing have you raised…
Love
In your speech you are making known
that you have known us well…
The Old Man
Come closer a little more:
you have such beautiful reasons,
that I have to suffer you to inflame me
for the glory you provide to me;
all your sayings pander me, with truth or with deception,
in the soul you insert them to me;
for the sweetness of your promise
that all year is for you waiting.
Love
Let both of us embrace ourselves,
naked without any other purpose;
you will fell in yourself remedy,
on your doorstep new branches…
End
Because in you I had my hope,
you pardon my sin;
great lineage of revenge
is to forgive the guilt.
If from the price of the defeated
from hi that overcomes is the honor,
Me by you so very battled
I won’t be a weakling fallen,
not you the strongest victor."
“The best novel of Sartre is “The Postponement”. It is the best idea of simultaneity. It is a direct antecedent of “The Fair” (in Spanish: “La Feria”, an important work by Arreola). Let’s read this passage from “The Postponement””:
"Excerpt from “The Postponement”
By Jean-Paul Sartre
It was a beautiful golden afternoon, a September fruit. Looking out at the balcony, Stephen Hartley mumbled: “The wide and slow swirls of the evening crowd”..."
“From St. John of the Cross the most important is what we read the least from him; he says the next in a romance about a Psalm”:
"Excerpt from “Romance X regarding the Psalm “Super Flumina Babilonis” (‘By the Rivers of Babylon’, Ps. 137)”
By St. John of the Cross
I left the party gowns,
those for work I took
and hung up on the green willows
the music that I carried…"
“Let’s see, let’s read a portion of “The Lantern”. It is a tale by Zamyatin. Marey is a boy who has a linen hair; Kortoma, a festive storekeeper”:
"Fragment of “The Lantern”
By Yevgeny Ivanovich Zamyatin
Morn. Seed pearls at the tip of the green needles of the pines. And in the droplets green and rosy sparks. Thank God! Dawn. The sun begins to rise. The sky is blue and under the blue two green butterflies pursue themselves; flies one around the other, they coalesce they take flight… a new life!".
And Arreola was endless, and he continued in this literary feast and banquet...
All of these literary fragments, many of them poetic, where taken from the recollections by Vicente Preciado Zacarias in his book: "Apuntes de Arreola en Zapotlan", that we are using as our textbook, thanks! The original of this post, can be found at: https://www.facebook.com/TastersOfTheWord/posts/1340942335928199:0
The Promise
Such as the fruit is the fulfillment
of the promise of the button and its flower,
The butterfly is the fulfillment
of the promise of the worm and its cocoon,
The chicken is the fulfillment
of the promise of the hen and of its egg,
And the baby is the fulfillment
of the promise of the woman and her belly,
The eternity is the fulfillment
of the human promise and their anointed!
Fernando Castro.
Then, I put HERE the inspiring portions of "The Arreola's Chair" that led me to it:
First Arreola said that the most important line of poetry of all the French literature, by common agreement of the French Poets was:
“‘And the fruit improves the promise of the flower’ or ‘the fruit provides for the promise of the flower’ or ‘the fruit fulfills the promise in bloom’… Which one is best for you? The last one of the three is the most poetical. It is said that this is the best verse of the French poetry. It was written by a minor poet, François de Malherbe – Frank Weed (lit., in Spanish: ‘Francisco Maleza’); of the oldest second names in France, were nicknames –, the original verse (in French) reads as follows: “Et les fruits passeront la promesse des fleurs” (‘And the fruits provide for the promise of the flowers’)” ("Apuntes", by Preciado Zacarias, our textbook, see the end of this post and the first slides).
And then, I read in his speech for women entitled "The Implantation of the spirit" and in other two of his works:
“Imagine you that we find one of those worms falling from the tree that are on the sidewalk exposed to be squeezed by the first walker-by who is either distracted or malicious. We confront the worm and we ask: do you want to be a butterfly? The worm no doubt will laugh at us. Attached with all its body to the surface of the earth, the proposition to fly may seem to it frankly laughable and, however, through an act of profound meditation modifies apart of its cellular structure all the mass of its original matter making it to evolve from that substance almost viscous, liquid, to the perfection of the shiver, of the chip of color and light which transforms into the double eave of wings the shining glow of the butterfly” (Obras).
"I believe that the enigmatic operation that resolves a worm into a butterfly is due to a deep reflection; that which we all should undertake going into the inside of our lives. The worm crawls on the ground, being it the surface of a stem, a leave, a trunk, or simply let's say: the worm crawls on the surface of the earth. But lo and behold that it decides to fly. Then it goes into itself and he embalms itself with its own substance like a mummy that knows that it is capable of resurrection. Because it is going to emerge from its own material being, but encouraged by the spirit. As all of us. Hence its deep thought. Such as Jonah encompassed and then delivered by the whale, that mass of original nothing that returns the Everything for us, if we are capable of a good act of reflexive contrition."" (Inventario).
"Butterflies exerted on me as for ever a great fascination, that increased of course when I learnt that the Greek represented the soul, the "psique", as a butterfly. I have written elsewhere about the metamorphosis. For me, it is a phenomenon of reflection. I remember a lot those horrible worms... I think that suddenly the worm understands its condition and decides to encapsulate into a self-enclosure, it decides "to be abstracted itself", to annihilate its being and to resurrect into another, infinitely more beautiful. Life goes towards an infinitesimal bridge to death. The horrible worm is transformed into the imaginable light creature, winged, wonderfully endued of light corpuscles." (Memoria y Olvido).
All of this leads us to the Seventh principle that I take from Arreola's Class: "7. Write!"
Then, I may say that the virtual Biblical recordings and presentations that I initially started more than three years ago in Houston I decided to entitle them as: "Tasters of the Word" ('Catadores de la Palabra', in Spanish). This title was inspired to me through the Scripture that says: Psalm 34:8 "Taste and see...".
Last week, I got very impressed when I discovered that Arreola had a similar inspiration but for a different application ('poetry!'), here are his words:
“In the same way that there are tasters to see where are irradiation, there must be tasters of poetry: that we could be able pass over a poem and in a given time, when there is poetry, the needle could be able to move” (Jorge Arturo Ojeda when interviewed by Victor Manuel Pazarin about Arreola, his teacher):
https://web.archive.org/web/20161115204845/http://www.revistadelauniversidad.unam.mx/ojs_rum/files/journals/1/articles/15854/public/15854-21252-1-PB.pdf
Then, to conclude properly this ante-penultimate class I will add some of the beautiful and most frequent readings that Arreola used to do for us, his students:
“In “Notes of the Idle Summer” of El Espectador (a newspaper, ‘The Spectator’) you can find – with that elegantly twisted language of Ortega (y Gasset) that always amazes me – some portraits of women that are worthy of admiration. ‘In the Bar Basque’, below the Grand Hotel on the Biarritz beach, summer station in the Gulf of Gascony, describes for us a woman that is not all whole, that remains absent”:
In the Bar Basque
By Jose Ortega y Gasset
…with such a mild and restrained smile as if a spiritual rein were retaining her… The best of herself did stay there far away, attached to her loneliness, as the Hamadryads nymphs, that could not leave the tree where they lived infused.
“The real leisure in women consists for Ortega y Gasset in that “divine gesture of choosing” that retains the elegance of their person and that lies in the long hours and spaces that she keeps for herself”.
“Let’s see, let’s read another splendid essay by Ortega (y Gasset) where he paints for us the silhouette of a countrywoman garrisoning of the rain under the arch of a porterhouse”:
"Our Lady of the Sieve
By Jose Ortega y Gasset
However, in the countryside rain falls sometimes with a delightful prestige. I keep the musical memory, almost ‘Beethovenian’ (from Ludwig van Beethoven), of a storm in Castile…
It was the time of August, muggy, restless, and in that cold land they were still in the harvest. The little towns were girded by the golden belt of the wheat fields (lit., in Spanish: ‘las eras’), where the mountains of mowed wheat (lit., in Spanish: ‘parvas’) sparkled like yellow jewels. At noon I reached Romanillos, a small village capsized in a sea of wheat ears. I entered the inn to protect myself from the excess of sun. In contrast to the outer radiation, the hostel looked like a cool murk. In contrast, from within the dim, the gantry was a cinematographic screen overfilled with light and vaguely unreal. The peasants were crossing through the road, dressed with knee-breeches and bandanna Soria style (lit., ‘a la soriana’) – bodies of giblets, and gnarled, black skins, ivory teeth -. Behind them, the little mules, sounding their bells, laden with sacks of blonde barley, freshly winnowed. All the people of both sexes were working nervously in the fields, because at that time the rains are imminent and the harvest can be fermented if it is not collected soon.
Over the horizon rears its black shoulder a round cloud, baleful, malefic, magical, and with it a strange drama in the landscape. Suddenly enters the threshold a swirl of dust (lit., in Spanish: ‘tolvanera’) that lights the darkness countless little lights with the color of gold: the thin straws flying and blinding. Shortly after other burst and another. Thick drops exploding over the dust of the road are falling. The passers-by enliven their step. The drops now are thinner and a giant thunder rumbles. The cloud covers the horizon. Arriving on the run, in a triumphant gallop, as if within it a barbarian god were traveling. Rains. People passes running, the raining squalls. Another thunder seems to crush the valleys near the river (lit., in Spanish: ‘las vegas’). A thunderbolt gives its whip to the aerial horses of the cloud. The dust storm obscures everything, and suddenly enters a mouthful of men and women seeking protection in the hallway. Laughs, cries, a spontaneous rural orgy. In the door jamb, in the backlit stays a wench. The red petticoat hugs her hips, and a white female blouse swells, like a candle, under the double elastic wind of her breasts. She is blonde, like barley, and with blue eyes, like where sprigs of water are born (lit., in Spanish: ‘hontanares’). She supports herself in one leg and the other leaves a stilted rump upon which she lets to rest a sieve (lit., in Spanish: ‘harnero’) that she is holding with her arm.
Among the shouts the sibilant voice of an old woman is heard, with an obscure and thick face, with Sibyl eyes, saying indecencies, exalted by the adventure, electrified by the lightning and the agglomeration. She speaks of the lima beans of the country and her pupils see in the air the eternally presiding Priapus of the harvests. The gal at the threshold smiles on hearing her, as dissolving and annulling, by force of essential virginity, the lubricating allusion. She is so beautiful and so virgin, that I decide to adore her under the title of ‘Our Lady of the Sieve’. The storm gives up. The dust storms subside. A fresh breath arrives tasting like straw and cloud. Some people do abandon the meson. The little bells of the blunted little mules are heard again and a new ray of sun entangles itself in the hair of the virgin. To the symphonic crescendo (‘increasing’) of the meteor follows a soft diminuendo (‘decreasing’). The landscape returns to its compass. And I’m on the road again…"
https://web.archive.org/web/20161113231040/http://mercaba.org/SANLUIS/Filosofia/autores/Contemporánea/Ortega%20y%20Gasset/Obras%20completas/Tomo%202.pdf (pp. 412 – 414, and from there, replace the 2 with numbers from 1 to 9 to get all the volumes of the works by Ortega y Gasset).
The isolated story also at: https://web.archive.org/web/20161115150606/http://www.revistadelauniversidad.unam.mx/4808/4808/pdfs/48delacolina.pdf
Then Arreola also selected:
“…D’Annunzio‘s “The Rain in the Pinewood” is phonetic. You feel the rain falling as you read it (then he reads this poem in its original tongue, Italian. Here below is my particular translation into English)”:
"The Rain in the Pinewood
By Gabriel D’Annunzio
…Listen. Rains
among scattered clouds.
Rains over the tamarisks
brackish and burned,
rains over the pines,
flaky and rigid,
rains over the myrtles
divine,
over the broom that shines
with novel flowers,
over the thick gin
of fragrant buds,
it rains over our faces
wild,
it rains over our hands
naked,
over our clothing
light,
over the novel thoughts
whose buds are opening
in the soul,
over the beautiful tale
that yesterday
captivated you, and today captivates me,
o Hermione, do you hear? The rain is falling
over the lonesome
greenness
with a lasting crackling
and changes in the air
according to the fronds
the thicker, the clearer.
Listen. Respond
to tears, the song
of the cicadas
as the austral cry
doesn’t scare them, neither an ashen heaven.
And the pine
provides us with a note, and the myrtle
another note,
and the gin
another sound: instruments
diverse
under numberless fingers."
Then the disciple, Vicente Preciado selected a delightful one:
"Preciado: “I brought the promised prologue. Speaks about Joyce starting with a beautiful depiction of a Rolls Royce”:
"Excerpt of the Prologue to James Joyce’s in Spanish: “A Portrait of the Artist as a Young Man”
By Antonio Marichalar
“Stops raining; the last droplet falls in the “Rue de l’Odéon”. The atmosphere, freshly frozen, boils in imperceptible hum”. Suddenly, piercing the gray veiling, disembogues something clear: arrives the solemn silence of a magnificent Rolls. It carries a weightless step and muffled the look of glass of its speechless headlights. Like a continuous murmur, it slides seeping, stealthy, meek. barely causing rumor the fluffy turn of wheels that are detaching softly from the wet decorated soil (in Spanish: “entarugado”).”
“Furrowing the street, through the line of houses, advances the car until bumping with a pennant that, starting a pass from the façade, interposes itself and forces him to stop. It has stopped in front of a bookstore in whose tagline says: “Shakespeare and Company”.”
“With a dull hum the car gets quiet. A flap door yields, and, in the inner mansard, it stirs a vague scent of furs, of pearls, of woman… in short emerges the camber of a necklace and slightly waves over the abyss of the sidewalk. Grazing the biggest pearl, ventures as well, a foot – is the most elegant duchess in Paris… a schoolgirl irrupting approaches her… outstanding through the bookstore… She is the captain; in the shelves the rigid volumes, aligned, fit, obey her voice. The two women speak, and a book – fatal parcel – takes a step forward. The lady takes it like a trophy… Back to the car, clutching her treasure. The prestigious J.J. that justify in the copy the printed number of the book, themselves correspond exactly to those R.R. that flaunts on the shining frontal the abducting car. James Joyce: Rolls Royce…”
Arreola: “Antonio Marichalar (is the author)! And here you have the end of that paragraph that it is very beautiful: “Let’s Go. The “chauffeur” sinks-in the black hat… the car sets sail. And it’s leaving, suspended in the mist, displacing silence – and folding back on passing the lasting trail of its own rumor”…”
Then Arreola selected:
"Autumn Song
By Paul Verlaine
The endless lament
Of the tearful violin
Autumnal,
Wounds the heart
With a languid song
Lethal.
Always dreaming,
And feverish when
The hour sounds…
My soul reflects
The senile life
And cries.
And drags a brutal
Perverse wind
To my uncertain soul
Here and there
The same as that
Dead leaf."
Plus:
“Culture shouldn’t be imposed. Culture is the adoption of the legitimate; only by that measure are we universal. Culture shouldn’t be ostentatious; should ooze, should emerge from the daily living. Culture is not imminent: should be transcendent. Only God is imminent and transcendent (and should transcend from us in the measure that He prolongs His being to the region of the secrets (“mysteria”) and the revelation)… I – being pantheistic – can see the creation as a manifested God. God is transcendent: He is before and after the creation. God He is being, as Rilke says. God is yet to come constantly. According to Grillparzer”:
"Something about the Times
By Franz Grillparzser
If my time contradicts me,
I let it go quietly.
I come from other times.
Waiting to go to others."
“The last tercet of a sonnet by Alberti says”:
"Excerpt of “The Bull of Death”
By Rafael Alberti
To be a shadow armed against armed light,
mortal derision against derision,
bull without tears against the bravest."
And:
"...let’s see it in the poetical perfection ruling the next sonnet”:
“To Rosa de Alberti, who Played, Thoughtful, the Harp”
By Rafael Alberti
Rosa de Alberti there above the baseboard
from the oriel of heaven was its opening,
throbbing the wind and cousin of mine,
to the neck a white bind of Moire.
The banister of the harp, from the foot
to the curl in the snow, she was covered.
Entangling her cords, she was greening
- something in threads – the hand that was.
Full of softness and carmine,
Lighthouse of dreams, sloven and flightful,
Flew to the highest balconies.
Look at her Cherub of cherubs,
Of the orchard of the airs pulsatrix,
Thoughtful de Alberti among the flowers!"
"Preciado: “What is a high “baseboard” (in Spanish: “rodapie”)?”
Arreola: “It is a kind of grid that, as an edging of wrought iron, did cover the bottom of the railing of the Balconies to prevent that from below, it could be seen, the feet of persons… the feet and something else…"
“The internal rhythms in poetry were originated in the biblical verse. This internal rhythm in the poem is the estrus (“estro” in Spanish) of the Greeks that is not known where did it originate. “The black luminary of the look” is a verse of one of my sonnets (Arreola laughs).”
“I suffered the terror of feeling like an ant in a concrete gully in New York. I was there, aground, two or three weeks between Broadway and the Eight Avenue feeding on Smyrna figs and milk… There a humble hit of mine – on speaking of the sonnet of the “Unfortunate” of Gerardo de Nerval – was to rhyme (in Spanish) “waste tower” with “melancholy”. Antonio Alatorre corrected my first version. He added that of: “turn me into the Posillipo”. Posillipo is a promontory of the Navy of Naples.”
"Excerpt from “Inventory”
By Juan Jose Arreola
I am murk, the widower, the disconsolate
prince of Aquitaine in his wasted tower.
My only star has died, my laud is constellated
the black sun holds of melancholy.
In the funereal night, you who have comforted me
turn me into the Posillipo, and the sea that was mine,
the flower most pleasant to the desolate chest,
the vine in which the pompano of the rose is an ally"
“Arreola now reads a fragment of a letter sent by him to his father from Mexico City in 1944”:
"Fragment of “A Letter to my Dad, 1944”
By Juan Jose Arreola
The fixing of my teeth, costs eight hundred and fifty pesos…I have two days bleeding because of a molar… The dentist is of certain Polendos (“polendas” in Spanish)… he is going to extract to me others more: “I’m going to make you a railway settlement like to the gate of Maria Rojas (explanation: She was a wealthy elderly owner of one of the estates most beautiful and stately in Zapotlan. Her avarice prevented her from changing the wood of the door of her barracks, only admitting patches of nailed planks in said gate).”
Then Arreola continues: “Nobody could say that in me a fire of straw was all that burned, Here in Zapotlan we call it: “a flare of “petate” (a “bedroll” made with dry vegetable fibers)””.
“In ‘The Fair’ someone says: ‘Every year there is among us a man who is responsible for fulfilling the word, that man is the steward, that one who died’. Its first draft had as its epigraph: ‘nous sommes la piétaille’ (lit., from the French: ‘we are the rank and file’), by Charles Péguy. This verse comes in the poem: “Presentation of the Beauce Region to Notre Dame of Chartres”. The constant recurring image that repeats itself is the cathedral of Chartres like a ship rowing on a sea of gold: the plain populated by wheat. The cathedral has two unequal towers because two different architects built them. Peguy used to walk, from Paris to Chartres via Versailles… Péguy was an infinite poet. He wrote a poem entitled Eve, it contains sixteen thousand verses joined in four thousand Alexandrian quatrains. He married a girl belonging to the Jewish community. Péguy is the Amado Nervo of France. He loved the editorial work and he had a print shop and a bookstore. ‘Les Cahiers de la Quinzaine’ (‘The Notebooks of the Fortnight’) was a magazine he founded in 1900. He died in the trenches of a bullet of Mauser at the base of the nose.”
“Father Ignacio Macias Campos – parish priest of Tamazula – is the priest who appears in ‘The Fair’”:
"Excerpt from “The Fair”
By Juan Jose Arreola
- I accuse myself Father that in the press where I work we also do the newspaper of Don Terencio.
- Well, that’s not your fault.
- Not, but in the last number go out a few verses of a military man.
- Tell them to me.
- Let’s see if I remember:
“Retro expired, cassock bandits
Spawn of Loyola and Satan”
- What atrocity!
- And when they were going to put that statement to the press, I saw that it said ‘spaun, with ‘u’, and I put the ‘w’. Is this a sin?
- No… it’s not a sin… "
“When Hosea says: “Go and take adulterous wife” (Hos. 1:2), he refers to Israel as a fornicating wife.”
“First I was a poet (Arreola said); then a prose writer. Poetic prose”
“A “pastiche” is a text made in the exact style of an author. I did one imitating even the poetic rhythm: “Tacata-ta, tacata-ta, of Berceo”. The best “pastichero” (“pasticho”) is this Argentine (Conrado) Nale Roxlo who makes perfect imitations of Unamuno, Pio Baroja, Dario. Another brilliant “pastichero” is Alphonse Allais. Listen… (then he suffocates in laughter while translating a scene of an elevator transformed into a sardine can written by Allais, imitating Proust).
“(One of Arreola’s books:) ”Varia Invencion” (“Varied Invention”) means: “Varied Imagination”, (inspired is title in a) sonnet by Don Luis de Gongora written in 1584”:
"Fragment of “Sonnet 72”
By Don Luis de Gongora y Argote
Varied imagination, that, in a thousand attempts,
through regret you are wasting your sad owner
the sweet ammunition of the soft dream,
feeding vain thoughts."
“Here, hear this (Arreola says)”:
"Excerpt of the monologue of Sigismund in the drama “Life is a Dream”
By Calderon de la Barca
Woe miserable of me, and woe so unhappy!
…for the major offence
of man is to be born.
…The bird is born, and with the galas
that provide him with great beauty,
very nearly is flower of feather
Or corsage with wings.
…the fish is born, without breathing
abortion of eggs and slippery
and just a ship of scales…
and having myself more life,
have I less freedom?"
“(Joseph) Bergamin wrote the best sonnets. He arrived to Mexico with the first group of Spanish refugees in 1939… Spaniards still do not know the poet that Bergamin is”:
“Sonnet III” (from: “Seven Unpunctual Sonnets”)
By Joseph Bergamin
Let’s go and tell to the clear down,
the sky, the sea, the rapid element
that makes quiet with its own motion
the light over the glass where it stands;
Let’s go and tell the rare bird
when it dwells with its wings on the wind;
to the submarine fish; and to the grey
mole that declares his shady desire;
to the star that focuses her sight
in the high, spacious firmament
by shiny shouts surrounded;
let’s go to tell them about the cry
of one blood that cries in prison
in a chest without light, nor sea nor wind."
“Sem Tob (ben Ishaq ibn Ardutiel) a Jew converted to Christianity – and with verse (note: there is a word game that is lost in translation, as “converted” is ‘converso’ in Spanish, and “with verse” is ‘con verso’ in Spanish) – he said: “the truth is the truth, even if a Jew is telling it’. He lived in the mid-fourteen century”:
"Excerpt from “Moral Proverbs”
By Sem Tob
Being born in thorn
the rose, I do not feel
that loses, neither the good wine
by emerging from the vine.
Neither is the goshawk less
by continuing in a vile nest,
neither the good examples
even if a Jew tells them."
“Rodrigo Cota (de Maguaque) is a Spanish Jew of the times of Don Juan II. He was a doctor. He knew de secrets of medieval pharmacy. To him has been attributed the first act of “La Celestina” (‘The Tragicomedy of Calisto and Melibea’), the first novel of the Spanish literature. In other words, Rodrigo (de) Cota (also written with the intermediate ‘de’ in Spanish) intervened in the body of La Celestina. “Be careful with your laughter, Melibea”… He is the author of the ‘Dialogue between Love and an Old Man’. We did present this dialog with Liliana A. in the ‘Lake House’in 1965”:
"Excerpts of the “Dialogue between Love and an Old Man”
By Rodrigo Cota
The Old Man
My door was closed
What’s the reason of you coming? From where did you enter?
Say, thief, why did you jump
the walls of my garden?
Age and reason
already from you have released me;
leave the poor heart
retracted in its corner
contemplates which thing have you raised…
Love
In your speech you are making known
that you have known us well…
The Old Man
Come closer a little more:
you have such beautiful reasons,
that I have to suffer you to inflame me
for the glory you provide to me;
all your sayings pander me, with truth or with deception,
in the soul you insert them to me;
for the sweetness of your promise
that all year is for you waiting.
Love
Let both of us embrace ourselves,
naked without any other purpose;
you will fell in yourself remedy,
on your doorstep new branches…
End
Because in you I had my hope,
you pardon my sin;
great lineage of revenge
is to forgive the guilt.
If from the price of the defeated
from hi that overcomes is the honor,
Me by you so very battled
I won’t be a weakling fallen,
not you the strongest victor."
“The best novel of Sartre is “The Postponement”. It is the best idea of simultaneity. It is a direct antecedent of “The Fair” (in Spanish: “La Feria”, an important work by Arreola). Let’s read this passage from “The Postponement””:
"Excerpt from “The Postponement”
By Jean-Paul Sartre
It was a beautiful golden afternoon, a September fruit. Looking out at the balcony, Stephen Hartley mumbled: “The wide and slow swirls of the evening crowd”..."
“From St. John of the Cross the most important is what we read the least from him; he says the next in a romance about a Psalm”:
"Excerpt from “Romance X regarding the Psalm “Super Flumina Babilonis” (‘By the Rivers of Babylon’, Ps. 137)”
By St. John of the Cross
I left the party gowns,
those for work I took
and hung up on the green willows
the music that I carried…"
“Let’s see, let’s read a portion of “The Lantern”. It is a tale by Zamyatin. Marey is a boy who has a linen hair; Kortoma, a festive storekeeper”:
"Fragment of “The Lantern”
By Yevgeny Ivanovich Zamyatin
Morn. Seed pearls at the tip of the green needles of the pines. And in the droplets green and rosy sparks. Thank God! Dawn. The sun begins to rise. The sky is blue and under the blue two green butterflies pursue themselves; flies one around the other, they coalesce they take flight… a new life!".
And Arreola was endless, and he continued in this literary feast and banquet...
All of these literary fragments, many of them poetic, where taken from the recollections by Vicente Preciado Zacarias in his book: "Apuntes de Arreola en Zapotlan", that we are using as our textbook, thanks! The original of this post, can be found at: https://www.facebook.com/TastersOfTheWord/posts/1340942335928199:0
For this 32nd class of "Arreola's Chair", and while I await for the perfect woman, with those special characteristics and spiritual sensitivity that God will send to me (to build that family), we are going to see another of the most appreciated writers by Arreola: Paul Claudel.
In the slide shown in Spanish, we can read some accurate, I must say, inspired, fragments by Claudel, who originally wrote in French:
About James: “All the Apostles are gone but James the brother of Christ remains / alone in the Jerusalem that the real Israelite has deserted, / that city since now perfect and filled in which is gathered / a whole people over which the Blood did fall and which awaits their ruin. / The blaspheme Temple still has forty years remaining.”
About Paul: “I beg you they could hear like me, before the hour and the process have concluded, / that voice that tells to them: ‘Paul, I am the Jesus that you have persecuted!’”
About John: “John, that saw the end of things and that was at bay between the seas and the heaven / while the Seventh Veil was being torn, / John has no more but only one word for all of us: / ‘My Children, love one another’.”
Then, in the textbook that we are using by Vicente Preciado (Arreola's Notes in Zapotlan) we read:
“I (Arreola) arrived to France on November 1945. In August the Germans were still in Paris. Between Calais, France and Dover, England a storm took us in the “Liberty Ship”. There I met dread at sea. Claudel, who traveled a lot through the sea, has some verses that say: “I see around the pale cavalry of foam”.
“In “the group of the Apostles” I can be recognized from two or three fortunate passages that I accomplished in my version of Claudel”:
Excerpts from “The Group of the Apostles”
Arreola's translation of the original writing by Paul Claudel:
Saint Bartholomew
…They have taken from its pod the sable, they have stripped bare
the red man that was inside, the bloodied angel of the Lord,
…Truly naked Apostle, a completely skinned athlete!
Saint truly clean and at last from your flesh circumcised!
Saint James the Greater
In late July and in Spain, James perished by the sword.
Between the burning months, lies his severed head.
…Apostle of the heat-wave, take yourself forever the party of God.
Saint Peter
Now Peter is the sheep led to the fold. The night falls. It stops.
And as in the fishing mornings at the lakeside, to undressing he acquiesces.
…As the fruit on the branch, suspends of Jesus towards the earth the weight of himself.
But Peter is crucified at the anchor,
into the deepest depths of the vertigo and of the abyss.
Saint James the Less
The fruits of the sinful world, safe and ascending
will be worth for a long time, and in the space in which the dissidents discuss
the Apostle of eternity, James, kneeling before God, looks at him
clenching his teeth.
Saint John Evangelist
In the same way that the heart needs to be opened so that someone could be able to penetrate it.
Behold John and Jesus, behold God in the power of John, priest at the altar.
…The work of a strange old age over John reaches its end;
In this old man of white eyelashes begins to shine the Seraph.
Felipe
…But the man who expects nothing is a terrible optimist.
And constantly is occupied in his own salvation
And looks at the tonalities of the sky and the clouds in procession.
Saint Matthew
…Conscientious, calm, imperturbable…
Slowly began to carve his great plain of a parchment.
Saint Paul
Lamb of God you who promised your kingdom to the furious,
receive Paul your servant who brings to you ten talents
…I beg you that they may hear as myself, before the hour and the process have been completed,
that voice that tells them: Paul, I am the Jesus whom you have pursued!
Preciado: “Why James the Greater is a heat-wave Apostle?”
Arreola: “Because the months of July and August – when he was beheaded – are the months of the heat-wave (in Spanish: of the “canicula”), because the constellation of Canis Major rises and sets in the sky, like the sun.”
“The man at the window, in “The Book of Cristobal Colon”, represents the port of Genoa in the presence of the vocation calling Colon: “Leave, leave your mother! Like Abraham to whom God called to go out of Ur” (Paul Claudel).”
“I translated the poem that Claudel dedicated to Veraline: “The good song was already sung”. In “Bestiary” (in Spanish: “Bestiario”, a literary work by Arreola), I have several approaches to texts of Claudel. “Ballad” is another of the many poems of Claudel describing the sea or the earth seen from the sea. “Ballad” starts when the gateway has been removed from the dock and the ship has already parted the dock”:
Excerpt of “Ballad”
Paul Claudel
Those to whom, in the wings of this seagull, still
joins the handkerchief when the arm that waved it has disappeared…
for all of them, behold the duty around,
with the dimensions of this circular horizon.
It is the sea that goes to them, it’s not necessary to seek the route…
Just the sea to and fro, just this that goes up and down!
Enough of this constant thorn in the heart, enough
of these days drop by drop!
The eternal sea forever, all of it at once, of a single
Gulp! Us and it are penetrated!
“The last paragraph was the shipwreck”.
Fragment of “Memento for a Saturday Night”
By Paul Claudel
…Psalm of David hidden in Adulam because of Absalom
When waters of bitterness penetrated in my heart…
Traveler riding and aspiring to the intermittent star
my heart directs its thirst towards desirable fountain.
There is the silence and is the very night
and the Time behind me, everything declines and plunges
“I have just translated this and you are the first one to hear it”.
[Preciado’s Note: Until this moment the teacher (Arreola) allowed the use of a recorder. From here, everything was taken on paper and pencil in pocket notebooks… it was only possible to capture one or two phrases from the verbal array integrated by his splendid conversation – some dialogues have been reconstructed by memory]
“The poem that Claudel writes to the death of Charles-Louis Philippe is noticeable, Philippe was the youngest friend of Claudel, who believed that he had snubbed Philippe in their last encounter:
Fragment of “Charles-Louis Philippe”
By Paul Claudel
Bye, they wait for me without delay and I’m going in haste!
I see him putting the hand on the door with painful smile
Like before after another again I feel it getting closed.
He is living us and we stay out of his knowledge…
And you were going to tell me… You left me without hearing it for infinity?
““Someone who is in myself, greater than myself”, says Claudel in the poem VII of the “Verses from Exile”… Claudel is untranslatable: needs to be translated first to French… (Arreola laughs).” [Until here my translations into English of Claudel's works as per Arreola's teachings to Preciado].
This is what Orso wrote about him: “In his (Claudel) poetry and in his theater there is ever present the religious aspect… that closed for him many doors, but did open others bigger, such as those of Heaven. He was a great religious, lyrical and dramatic poet, a great poet period. Thanks to him I knew the Japanese theater of shadows, in which he was inspired by some scenery of his works. Of his book “Apostleship” I did a translation (“El Grupo de los Apóstoles” [Aproximaciones], in Spanish) that is published, as well as his “Hundred phrases for air-fans” (“Cien frases para abanico”, in Spanish) that has not been published since I completed it, more than eight years ago (from 1998). There was a time when I was very interested in Claudel’s Theater, since the time I saw in Guadalajara his work “The Announcement Made to Mary” (“L'announce faite a Marie”, in French), presented by Louis Jouvet, that I knew thanks to the translation by Efrain Gonzalez Luna. Other works that were part of my usual readings were “The Satin Shoe” (“Le soulier de Satin” , in French) and “Christopher Columbus” (“Cristobal Colon”, in Spanish); I also read with great attention his memories, in which he narrates his life as traveler and diplomatic in IndoChina. I know about his loves and his ruptures, I even had a romantic relation with a woman through the work of Claudel. Paul Claudel is little read in the world today, he was attacked by his religiosity (an orthodox and closed Catholicism). To read him is not easy, especially in a world like the one of today, that I have already said that does not belong to me” (J. J. Arreola to his son Orso Arreola, El Último Juglar).
Links:
Fragments of the translation by Arreola of 'The Group of the Apostles' can be seen at: http://tinyurl.com/claudelapostoles
Some of Arreola's translations of the work by Paul Claudel can be seen at: http://www.revistadelauniversidad.unam.mx/ojs_rum/files/journals/1/articles/6831/public/6831-12229-1-PB.pdf
Translated into Spanish by somebody else, a work that was never published from Arreola's translations of Claudel's work (notice there the beautiful aesthetics of the presentation): https://web.archive.org/web/20161114211730/http://literaturafrancesatraducciones.blogspot.mx/2011/04/paul-claudel-diecisiete-frases-para.html
Notices: Yurkievich wrote this Note before presenting: ‘El Grupo de los Apóstoles’ [Aproximaciones]: Arreola’s version of these poems by Paul Claudel – belonging to his book ‘Corona Benignitatis Anni Dei’ – was published for the first time in ‘El Greco’, private edition of 1970, in which the poems accompany the reproductions of the paintings of ‘El Greco’ that are grouped by the denomination of ‘Apostolado’ (“Apostleship” in English), that beyond containing an introductory study about the Spaniard painter and biographical notes of Paul Claudel and Jacobo de la Voragine (a Dominican’s Monk of the XIII Century, author of the hiographic notes there included). In this edition we are limited to publish the version by Arreola. [Extra: For the classes 30th and 31st you need to seek for them directly at my original site of: https://www.facebook.com/TastersOfTheWord as their contents are highly 'steamy']. Original of this one at: https://www.facebook.com/TastersOfTheWord/posts/1339702862718813:0
In the slide shown in Spanish, we can read some accurate, I must say, inspired, fragments by Claudel, who originally wrote in French:
About James: “All the Apostles are gone but James the brother of Christ remains / alone in the Jerusalem that the real Israelite has deserted, / that city since now perfect and filled in which is gathered / a whole people over which the Blood did fall and which awaits their ruin. / The blaspheme Temple still has forty years remaining.”
About Paul: “I beg you they could hear like me, before the hour and the process have concluded, / that voice that tells to them: ‘Paul, I am the Jesus that you have persecuted!’”
About John: “John, that saw the end of things and that was at bay between the seas and the heaven / while the Seventh Veil was being torn, / John has no more but only one word for all of us: / ‘My Children, love one another’.”
Then, in the textbook that we are using by Vicente Preciado (Arreola's Notes in Zapotlan) we read:
“I (Arreola) arrived to France on November 1945. In August the Germans were still in Paris. Between Calais, France and Dover, England a storm took us in the “Liberty Ship”. There I met dread at sea. Claudel, who traveled a lot through the sea, has some verses that say: “I see around the pale cavalry of foam”.
“In “the group of the Apostles” I can be recognized from two or three fortunate passages that I accomplished in my version of Claudel”:
Excerpts from “The Group of the Apostles”
Arreola's translation of the original writing by Paul Claudel:
Saint Bartholomew
…They have taken from its pod the sable, they have stripped bare
the red man that was inside, the bloodied angel of the Lord,
…Truly naked Apostle, a completely skinned athlete!
Saint truly clean and at last from your flesh circumcised!
Saint James the Greater
In late July and in Spain, James perished by the sword.
Between the burning months, lies his severed head.
…Apostle of the heat-wave, take yourself forever the party of God.
Saint Peter
Now Peter is the sheep led to the fold. The night falls. It stops.
And as in the fishing mornings at the lakeside, to undressing he acquiesces.
…As the fruit on the branch, suspends of Jesus towards the earth the weight of himself.
But Peter is crucified at the anchor,
into the deepest depths of the vertigo and of the abyss.
Saint James the Less
The fruits of the sinful world, safe and ascending
will be worth for a long time, and in the space in which the dissidents discuss
the Apostle of eternity, James, kneeling before God, looks at him
clenching his teeth.
Saint John Evangelist
In the same way that the heart needs to be opened so that someone could be able to penetrate it.
Behold John and Jesus, behold God in the power of John, priest at the altar.
…The work of a strange old age over John reaches its end;
In this old man of white eyelashes begins to shine the Seraph.
Felipe
…But the man who expects nothing is a terrible optimist.
And constantly is occupied in his own salvation
And looks at the tonalities of the sky and the clouds in procession.
Saint Matthew
…Conscientious, calm, imperturbable…
Slowly began to carve his great plain of a parchment.
Saint Paul
Lamb of God you who promised your kingdom to the furious,
receive Paul your servant who brings to you ten talents
…I beg you that they may hear as myself, before the hour and the process have been completed,
that voice that tells them: Paul, I am the Jesus whom you have pursued!
Preciado: “Why James the Greater is a heat-wave Apostle?”
Arreola: “Because the months of July and August – when he was beheaded – are the months of the heat-wave (in Spanish: of the “canicula”), because the constellation of Canis Major rises and sets in the sky, like the sun.”
“The man at the window, in “The Book of Cristobal Colon”, represents the port of Genoa in the presence of the vocation calling Colon: “Leave, leave your mother! Like Abraham to whom God called to go out of Ur” (Paul Claudel).”
“I translated the poem that Claudel dedicated to Veraline: “The good song was already sung”. In “Bestiary” (in Spanish: “Bestiario”, a literary work by Arreola), I have several approaches to texts of Claudel. “Ballad” is another of the many poems of Claudel describing the sea or the earth seen from the sea. “Ballad” starts when the gateway has been removed from the dock and the ship has already parted the dock”:
Excerpt of “Ballad”
Paul Claudel
Those to whom, in the wings of this seagull, still
joins the handkerchief when the arm that waved it has disappeared…
for all of them, behold the duty around,
with the dimensions of this circular horizon.
It is the sea that goes to them, it’s not necessary to seek the route…
Just the sea to and fro, just this that goes up and down!
Enough of this constant thorn in the heart, enough
of these days drop by drop!
The eternal sea forever, all of it at once, of a single
Gulp! Us and it are penetrated!
“The last paragraph was the shipwreck”.
Fragment of “Memento for a Saturday Night”
By Paul Claudel
…Psalm of David hidden in Adulam because of Absalom
When waters of bitterness penetrated in my heart…
Traveler riding and aspiring to the intermittent star
my heart directs its thirst towards desirable fountain.
There is the silence and is the very night
and the Time behind me, everything declines and plunges
“I have just translated this and you are the first one to hear it”.
[Preciado’s Note: Until this moment the teacher (Arreola) allowed the use of a recorder. From here, everything was taken on paper and pencil in pocket notebooks… it was only possible to capture one or two phrases from the verbal array integrated by his splendid conversation – some dialogues have been reconstructed by memory]
“The poem that Claudel writes to the death of Charles-Louis Philippe is noticeable, Philippe was the youngest friend of Claudel, who believed that he had snubbed Philippe in their last encounter:
Fragment of “Charles-Louis Philippe”
By Paul Claudel
Bye, they wait for me without delay and I’m going in haste!
I see him putting the hand on the door with painful smile
Like before after another again I feel it getting closed.
He is living us and we stay out of his knowledge…
And you were going to tell me… You left me without hearing it for infinity?
““Someone who is in myself, greater than myself”, says Claudel in the poem VII of the “Verses from Exile”… Claudel is untranslatable: needs to be translated first to French… (Arreola laughs).” [Until here my translations into English of Claudel's works as per Arreola's teachings to Preciado].
This is what Orso wrote about him: “In his (Claudel) poetry and in his theater there is ever present the religious aspect… that closed for him many doors, but did open others bigger, such as those of Heaven. He was a great religious, lyrical and dramatic poet, a great poet period. Thanks to him I knew the Japanese theater of shadows, in which he was inspired by some scenery of his works. Of his book “Apostleship” I did a translation (“El Grupo de los Apóstoles” [Aproximaciones], in Spanish) that is published, as well as his “Hundred phrases for air-fans” (“Cien frases para abanico”, in Spanish) that has not been published since I completed it, more than eight years ago (from 1998). There was a time when I was very interested in Claudel’s Theater, since the time I saw in Guadalajara his work “The Announcement Made to Mary” (“L'announce faite a Marie”, in French), presented by Louis Jouvet, that I knew thanks to the translation by Efrain Gonzalez Luna. Other works that were part of my usual readings were “The Satin Shoe” (“Le soulier de Satin” , in French) and “Christopher Columbus” (“Cristobal Colon”, in Spanish); I also read with great attention his memories, in which he narrates his life as traveler and diplomatic in IndoChina. I know about his loves and his ruptures, I even had a romantic relation with a woman through the work of Claudel. Paul Claudel is little read in the world today, he was attacked by his religiosity (an orthodox and closed Catholicism). To read him is not easy, especially in a world like the one of today, that I have already said that does not belong to me” (J. J. Arreola to his son Orso Arreola, El Último Juglar).
Links:
Fragments of the translation by Arreola of 'The Group of the Apostles' can be seen at: http://tinyurl.com/claudelapostoles
Some of Arreola's translations of the work by Paul Claudel can be seen at: http://www.revistadelauniversidad.unam.mx/ojs_rum/files/journals/1/articles/6831/public/6831-12229-1-PB.pdf
Translated into Spanish by somebody else, a work that was never published from Arreola's translations of Claudel's work (notice there the beautiful aesthetics of the presentation): https://web.archive.org/web/20161114211730/http://literaturafrancesatraducciones.blogspot.mx/2011/04/paul-claudel-diecisiete-frases-para.html
Notices: Yurkievich wrote this Note before presenting: ‘El Grupo de los Apóstoles’ [Aproximaciones]: Arreola’s version of these poems by Paul Claudel – belonging to his book ‘Corona Benignitatis Anni Dei’ – was published for the first time in ‘El Greco’, private edition of 1970, in which the poems accompany the reproductions of the paintings of ‘El Greco’ that are grouped by the denomination of ‘Apostolado’ (“Apostleship” in English), that beyond containing an introductory study about the Spaniard painter and biographical notes of Paul Claudel and Jacobo de la Voragine (a Dominican’s Monk of the XIII Century, author of the hiographic notes there included). In this edition we are limited to publish the version by Arreola. [Extra: For the classes 30th and 31st you need to seek for them directly at my original site of: https://www.facebook.com/TastersOfTheWord as their contents are highly 'steamy']. Original of this one at: https://www.facebook.com/TastersOfTheWord/posts/1339702862718813:0
Dear Saints of All the Inhabited Universe!: For the 21th Class of the "Arreola's Chair" in English that I started a month ago, I wish to present the fourth Biblical Scripture included by Arreola in his "To Read Out Loud" Anthology ('Lectura en Voz Alta'), and here, as per my search for her, and for me to have a big and a godly family, here is "The Praise to the Strong Woman", as Arreola found it, closer to the Hebrew, point corroborated by E. W. Bullinger, who even declares something like this, that the only woman called "strong" (using the same Hebrew word that is used here in Proverbs 31) in the whole Old Testament is Ruth from Moab! So, this may be a praise to her, says Bullinger, with a wish to extend her great qualities to the rest of women! And he even goes further to say that this is a wonderful acrostic poem using all the letters of the Hebrew Alphabet ('Alefato' in Spanish):
Pr. 31:10-31
10 Who can find a virtuous woman? for her price is far above rubies.
11 The heart of her husband doth safely trust in her, so that he shall have no need of spoil.
12 She will do him good and not evil all the days of her life.
13 She seeketh wool, and flax, and worketh willingly with her hands.
14 She is like the merchants' ships; she bringeth her food from afar.
15 She riseth also while it is yet night, and giveth meat to her household, and a portion to her maidens.
16 She considereth a field, and buyeth it: with the fruit of her hands she planteth a vineyard.
17 She girdeth her loins with strength, and strengtheneth her arms.
18 She perceiveth that her merchandise is good: her candle goeth not out by night.
19 She layeth her hands to the spindle, and her hands hold the distaff.
20 She stretcheth out her hand to the poor; yea, she reacheth forth her hands to the needy.
21 She is not afraid of the snow for her household: for all her household are clothed with scarlet.
22 She maketh herself coverings of tapestry; her clothing is silk and purple.
23 Her husband is known in the gates, when he sitteth among the elders of the land.
24 She maketh fine linen, and selleth it; and delivereth girdles unto the merchant.
25 Strength and honour are her clothing; and she shall rejoice in time to come.
26 She openeth her mouth with wisdom; and in her tongue is the law of kindness.
27 She looketh well to the ways of her household, and eateth not the bread of idleness.
28 Her children arise up, and call her blessed; her husband also, and he praiseth her.
29 Many daughters have done virtuously, but thou excellest them all.
30 Favour is deceitful, and beauty is vain: but a woman that feareth the Lord, she shall be praised.
31 Give her of the fruit of her hands; and let her own works praise her in the gates.
And then, here are the ever amazing Hebrew findings by Bullinger:
http://www.teleiosministries.com/companion_bible/Old%20Testament/16%20Proverbs%20865-905.pdf
Pr. 31:10-31. The Model Woman. (Extended Alternation.)
O2 | R | S | Pr. 31:10-12. Her husband (aleph - gimel).
T | Pr. 31:13-19. Her occupation (dalet - yod).
U | Pr. 31:20. Her character. Bounty (kaf).
V | Pr. 31:21. Her household (lamed).
W | Pr. 31:22. Herself. Without (mem).
R (italics) | S (italics) | Pr. 31:23. her husband (nun).
T (italics) | Pr. 31:24-25. Her occupation (sameh - ayin).
U (italics) | Pr. 31:20. Her character. Wisdom (pe).
V (italics) | Pr. 31:21. Her household (tzade - qof).
W (italics) | Pr. 31:22. Herself. Within (resh - tav).
Pr. 31:10. Who can find...? This heading is the Fig. Erotesis. Ap. 6. The twenty-two verses which follow, each begin with the twenty-two successive letters of the Hebrew alphabet. The acrostic cannot be reproduced in English, because the letters of the two alphabets vary in their number, order, and equivalents. This is to emphasize the great lesson King Solomon was to learn. Note the (multiple earlier) warnings against foreign women (A, p. 865), which, alas! Solomon failed to heed. This is why the book closes with the eulogy of the model Israelitish matron. See the evidence in Ap. 74: http://www.therain.org/appendixes/app74.html
virtuous. The English use of this word limits it to one kind of excellence. The meaning of the Hebrew is wider: hayil = strong in all moral qualities. Ruth is the only one so called in the O. T. May it not be that we have here Bathsheba's or Solomon's (and David's) commendation of Ruth?
Pr. 31:11. doth... trust in = hath confided in. Heb. batah. Ap. 69. I.
no need = no lack.
Pr. 31:12. evil = mischief. Heb. ra'a. Ap. 44. viii.
Pr. 31:13. willingly with her hands = with her hands' good will.
Pr. 31:15. meat = [live] prey. Put by Fig. Synecdoche (of Species). Ap. 6, for all kinds of food.
Pr. 31:18. candle = lamp.
Pr. 31:20. the poor = a poor one. Heb. 'ani. See note on "poverty", 6:11.
Pr. 31:21. is not = will not.
scarlet = double change of garments.
Pr. 31:23. known. Fig. Metonymy (of Cause), Ap. 6, for the result of that knowledge; viz. respect from all at the city gate, which includes high and low, rich and poor, peasants, laborers and judges.
Pr. 31:25. she shall rejoice... = she laugheth at the future.
Pr. 31:26. wisdom. Heb. chakmah. See note on 1:2.
Pr. 31:28. children = sons.
Pr. 31:30. deceitful = Heb. sheker. See note on 11:18.
the LORD. Heb. Jehovah. Ap. 4. II.
So, this could be a good place to start memorizing the Hebrew "Alefato": https://www.google.com.mx/search?q=Alefato&source=lnms&tbm=isch
Notices: I wish to than R.B.E.S. for being my Nahomi! Please, keep S.I.T. for the future and still unknown very 'Strong Woman' for me! [Link to my original: https://www.facebook.com/TastersOfTheWord/posts/1324700787552354:0]
Pr. 31:10-31
10 Who can find a virtuous woman? for her price is far above rubies.
11 The heart of her husband doth safely trust in her, so that he shall have no need of spoil.
12 She will do him good and not evil all the days of her life.
13 She seeketh wool, and flax, and worketh willingly with her hands.
14 She is like the merchants' ships; she bringeth her food from afar.
15 She riseth also while it is yet night, and giveth meat to her household, and a portion to her maidens.
16 She considereth a field, and buyeth it: with the fruit of her hands she planteth a vineyard.
17 She girdeth her loins with strength, and strengtheneth her arms.
18 She perceiveth that her merchandise is good: her candle goeth not out by night.
19 She layeth her hands to the spindle, and her hands hold the distaff.
20 She stretcheth out her hand to the poor; yea, she reacheth forth her hands to the needy.
21 She is not afraid of the snow for her household: for all her household are clothed with scarlet.
22 She maketh herself coverings of tapestry; her clothing is silk and purple.
23 Her husband is known in the gates, when he sitteth among the elders of the land.
24 She maketh fine linen, and selleth it; and delivereth girdles unto the merchant.
25 Strength and honour are her clothing; and she shall rejoice in time to come.
26 She openeth her mouth with wisdom; and in her tongue is the law of kindness.
27 She looketh well to the ways of her household, and eateth not the bread of idleness.
28 Her children arise up, and call her blessed; her husband also, and he praiseth her.
29 Many daughters have done virtuously, but thou excellest them all.
30 Favour is deceitful, and beauty is vain: but a woman that feareth the Lord, she shall be praised.
31 Give her of the fruit of her hands; and let her own works praise her in the gates.
And then, here are the ever amazing Hebrew findings by Bullinger:
http://www.teleiosministries.com/companion_bible/Old%20Testament/16%20Proverbs%20865-905.pdf
Pr. 31:10-31. The Model Woman. (Extended Alternation.)
O2 | R | S | Pr. 31:10-12. Her husband (aleph - gimel).
T | Pr. 31:13-19. Her occupation (dalet - yod).
U | Pr. 31:20. Her character. Bounty (kaf).
V | Pr. 31:21. Her household (lamed).
W | Pr. 31:22. Herself. Without (mem).
R (italics) | S (italics) | Pr. 31:23. her husband (nun).
T (italics) | Pr. 31:24-25. Her occupation (sameh - ayin).
U (italics) | Pr. 31:20. Her character. Wisdom (pe).
V (italics) | Pr. 31:21. Her household (tzade - qof).
W (italics) | Pr. 31:22. Herself. Within (resh - tav).
Pr. 31:10. Who can find...? This heading is the Fig. Erotesis. Ap. 6. The twenty-two verses which follow, each begin with the twenty-two successive letters of the Hebrew alphabet. The acrostic cannot be reproduced in English, because the letters of the two alphabets vary in their number, order, and equivalents. This is to emphasize the great lesson King Solomon was to learn. Note the (multiple earlier) warnings against foreign women (A, p. 865), which, alas! Solomon failed to heed. This is why the book closes with the eulogy of the model Israelitish matron. See the evidence in Ap. 74: http://www.therain.org/appendixes/app74.html
virtuous. The English use of this word limits it to one kind of excellence. The meaning of the Hebrew is wider: hayil = strong in all moral qualities. Ruth is the only one so called in the O. T. May it not be that we have here Bathsheba's or Solomon's (and David's) commendation of Ruth?
Pr. 31:11. doth... trust in = hath confided in. Heb. batah. Ap. 69. I.
no need = no lack.
Pr. 31:12. evil = mischief. Heb. ra'a. Ap. 44. viii.
Pr. 31:13. willingly with her hands = with her hands' good will.
Pr. 31:15. meat = [live] prey. Put by Fig. Synecdoche (of Species). Ap. 6, for all kinds of food.
Pr. 31:18. candle = lamp.
Pr. 31:20. the poor = a poor one. Heb. 'ani. See note on "poverty", 6:11.
Pr. 31:21. is not = will not.
scarlet = double change of garments.
Pr. 31:23. known. Fig. Metonymy (of Cause), Ap. 6, for the result of that knowledge; viz. respect from all at the city gate, which includes high and low, rich and poor, peasants, laborers and judges.
Pr. 31:25. she shall rejoice... = she laugheth at the future.
Pr. 31:26. wisdom. Heb. chakmah. See note on 1:2.
Pr. 31:28. children = sons.
Pr. 31:30. deceitful = Heb. sheker. See note on 11:18.
the LORD. Heb. Jehovah. Ap. 4. II.
So, this could be a good place to start memorizing the Hebrew "Alefato": https://www.google.com.mx/search?q=Alefato&source=lnms&tbm=isch
Notices: I wish to than R.B.E.S. for being my Nahomi! Please, keep S.I.T. for the future and still unknown very 'Strong Woman' for me! [Link to my original: https://www.facebook.com/TastersOfTheWord/posts/1324700787552354:0]
For this 20th Class inspired by J. J. Arreola, another of his selections to "Read Out Loud", "The Beatitudes":
Matthew 5:1-12 (KJV):
“5 And seeing the multitudes, he went up into a mountain: and when he was set, his disciples came unto him:
2 And he opened his mouth, and taught them, saying,
3 Blessed are the poor in spirit: for theirs is the kingdom of heaven.
4 Blessed are they that mourn: for they shall be comforted.
5 Blessed are the meek: for they shall inherit the earth.
6 Blessed are they which do hunger and thirst after righteousness: for they shall be filled.
7 Blessed are the merciful: for they shall obtain mercy.
8 Blessed are the pure in heart: for they shall see God.
9 Blessed are the peacemakers: for they shall be called the children of God.
10 Blessed are they which are persecuted for righteousness' sake: for theirs is the kingdom of heaven.
11 Blessed are ye, when men shall revile you, and persecute you, and shall say all manner of evil against you falsely, for my sake.
12 Rejoice, and be exceeding glad: for great is your reward in heaven: for so persecuted they the prophets which were before you.”
And then, E. W. Bullinger’s Notes:
http://www.teleiosministries.com/companion_bible/New%20Testament/36%20Matthew%201303-1380.pdf
Mt. 5:1 - 7:29. Disciples Taught. "The Sermon on the Mount". (Introversion.)
Z (italics) | B | Mt. 5:1-2. Introduction.
C | Mt. 5:3-12. Characters. True Happiness.
D | Mt. 5:13-16. True Disciples.
E | Mt. 5:17 - 7:12. The Kingdom. Its Laws.
E (italics) | Mt. 7:13-14. The Kingdom. Entrance into it.
D (italics) | Mt. 7:15-23. False Teachers.
C (italics) | Mt. 7:24-27. Characters. True Wisdom.
B (italics) | Mt. 7:28-29. Conclusion.
Mt. 5:3-12. Characters. (Introversion.)
C | a | Mt. 5:3. Heirs of the Kingdom.
b | Mt. 5:4. Mourners. Reward for Mourners.
c | Mt. 5:5. Inheritance. Earthly.
d | Mt. 5:6. True righteousness.
d (italics) | Mt. 5:7. Fruits of righteousness.
c (italics) | Mt. 5:8. Inheritance. Heavenly.
b (italics) | Mt. 5:9. Peacemakers. Reward for Peacemakers.
a (italics) | Mt. 5:10-12. Heirs of the Kingdom.
Mt. 5:1. a mountain = the mountain. Well known and therefore unnamed, but corresponds with the Mount of Olives in the Structure of the Gospel as a whole! Cp. F and F (italics), p. 1315. There is a reference also to Sinai.
set. The posture of the Oriental teacher today.
disciples. Note this fact in interpreting the member Z.
Mt. 5:2. Opened his mouth. Heb. idiom. Fig. Metonymy (of Adjunct), Ap. 6, for speaking (Job 3:1; Dan. 10:16; Acts 8:35).
taught them. See note on 7:39, and the Structure, above. the Structure is the commentary showing that this teaching is connected with the proclamation of the kingdom (v. 3), and is to be interpreted by it. As the kingdom was rejected and is now in abeyance, so likewise this discourse is in abeyance with all its commands... until "the gospel of the kingdom" is again proclaimed, to herald its drawing nigh. Parts of this address were repeated at different times and on different occasions. Luke nowhere professes to give the whole address in its chronological setting or entirety. Only some thirty separate verses are so repeated by Luke out of 107 verses in Matthew. The later repetitions in Luke were given in "a plain" (Lk. 6:17) and after the calling of the Twelve (Lk. 6:13); here the whole is given before the calling of the Twelve (Mt. 9:9). These are marks of accuracy, not of "discrepancy" as alleged. Modern critics first assume that the two accounts are identical, and they say: "No one now expects to find chronological accuracy in the evangelical records"! For the relation of the Sermon on the Mount to Ps. 15, see Ap. 70; and to the seven "woes" of Ch. 23, see Ap. 126.
Mt. 5:3. Blessed = Happy, representing the Heb. 'ashrey (not "baruk", blessed). 'Ashrey (Fig. Beatitudo, not Benedictio) occurs in nineteen Psalms twenty-six times; elsewhere only in eight books (Dt., 1 Kgs., 2 Chron., Is., Pr., Job, Ecc., and Dan.). The Aramaic equivalent for 'ashrey is tob (sing., pl., or dual). See Ap. 94. III. 3, and Ap. 63. vi. Gr. makarios = happy (not eulogetos, which = blessed, and is used only of God (Mt. 14:61; Lk. 1:68; Rom. 1:25, 9:5; 2 Cor. 1:3, 11:31; Eph. 1:3; 1 Pe. 1:3)).
poor in spirit. The equivalent for the Aramaic (Ap. 94. III. 3, p. 135), 'anaiyim (Heb. anah. See note on Pr. 1:11) = poor in this world (as in Lk. 6:20), in contrast with the promise of the kingdom. Cp. Jas. 2:5.
spirit. Gr. pneuma. See Ap. 114.
heaven = the heavens. See notes on 6:9-10.
Mt. 5:4. Blessed. Note the Fig. Anaphora (Ap. 6). The eight Beatitudes are to be contrasted with and understood by the eight "woes" of 23:13-33. See Ap. 126.
Mt. 5:5. meek. Cp. Ps. 37:11.
the earth: or, the land. Gr. "ge". See Ap. 129. 4.
Mt. 5:6. hunger and thirst... The idiom for a strong desire. Cp. Ps. 42:1-2, 119:103.
Mt. 5:7. merciful = compassionate. Cp. Ps. 41:1.
mercy. Not merely now, but in the manifestation of the kingdom, Jas. 2:13 (cp. Heb. 4:16, 8:12, 10:28).
Mt. 5:8. pure in heart. Cp. Ps. 24:4, 73:1.
God. Ap. 98. I. i. 1.
Mt. 5:9. peacemakers. Cp. Ps. 133:1. Gr. eirenopoios. Occ. only here.
children = sons. Gr. huios, see Ap. 108. III.
Mt. 5:10. are persecuted = have been persecuted. Cp. Pss. 37, 39, 40.
for = on account of.
for righteousness' sake. Not otherwise.
Mt. 5:11. revile = reproach.
evil = harmful thing. Gr. poneros. Ap. 128. IV. 1.
against. Gr. kata. Ap. 104. x. 1.
falsely. This is another condition of the happiness of v. 3.
Mt. 5:12. Rejoice... See 1 Pe. 4:13. Cp. Acts 16:25.
in. Gr. "en". Ap. 104. viii.
for = because. Not the same as in v. 3...
Notices:
My dear sister, and Christ Cristina Tello González, from Spain, asks (sorry again for the delay on translating this to English):
1) Related to the repetitive use of the Aramaic word "Abba" plus the translation into Greek, or English, in which case will accompany the previous one, as: "Abba, Father" (as if repeating twice to the similar person: "Daddy, Father"); and,
2) About the timing of the crucifixion of Christ and a related event one day earlier.
These were my answers:
1) It seems that the best response seems to be that we are dealing with an Eastern Usage (an Idiom or 'Orientalism') in which when something wanted to be emphasized it was repeated twice (such as in all the times that Jesus says: "Amen Amen": "Verily, Verily" I say unto you...), and in this case with a slight variation seen in the Aramaic text: "Abba Aby" (Dad Daddy) in the Aramaic of Mk. 14:36, and "Abba Abun" (Dad Father) in the Aramaic of Romans 8:15 and Galatians 4:6. In the Greek, obviously, it is first put the Aramaic and then its translation to the Greek in a similar way for all the previous cases: "Abba ho Pater" (Dad the Father).
2) It´s advised to read the best book related to the topic: "Jesus Christ our Passover":
https://www.amazon.com/Jesus-Christ-Passover-Victor-Wierwille/dp/0910068305
There, we are able to see the next details:
In pp. 214-215 The Calendar shows for us that two Gospel writers are talking about two different things done in two different days; detailed as follows:
p. 202
John 19:14-15:
“…And it was the preparation of the Passover, and about the sixth hour [noon]: and be saith unto the Jews, Behold your King! But they cried out, Away with him, away with him, crucify him. Pilate saith unto them, Shall I crucify your King? The chief priests answered, We have no king but Caesar.”
p. 203:
“…here in John 19:14 it says that Jesus was before Pilate at noon, the sixth hour, after he had already been on trial before the Sanhedrin earlier in the morning. There is no one who can make any of these events fit chronologically unless he recognizes that this was only Tuesday…”
p. 207
John 19:16:
“Then delivered he him therefore unto them to be crucified. And they took Jesus, and led him away.” “...it was still Tuesday, the thirteenth of Nisan, about noon. Understanding this, the next events must have begun that Tuesday afternoon. Upon leaving Pilate, Jesus was not immediately taken and crucified. He was first taken by the Roman soldiers back into the Praetorium…”
p. 229:
“The time of the crucifixion, as stated in Mark 15:25, was the third hour, about 9 A. M. At this time Jesus was put on the cross and the malefactors were crucified with him.”
So, let´s keep on praying in tongues the ones for the others in order for God to continue surprising us with His Daily Wonders!
In Christ,
Fernando.
Related Links:
Jesus Christ Our Promised Seed:
https://web.archive.org/web/20151206175727/http://www.preteristarchive.com/Books/pdf/1982_promised-seed.pdf
Jesus Christ the Apostle and High Priest:
http://www.biblicalastronomy.com/jesusChristtheapostle.pdf
My Original Link is at: https://www.facebook.com/TastersOfTheWord/posts/1321706281185138:0
Matthew 5:1-12 (KJV):
“5 And seeing the multitudes, he went up into a mountain: and when he was set, his disciples came unto him:
2 And he opened his mouth, and taught them, saying,
3 Blessed are the poor in spirit: for theirs is the kingdom of heaven.
4 Blessed are they that mourn: for they shall be comforted.
5 Blessed are the meek: for they shall inherit the earth.
6 Blessed are they which do hunger and thirst after righteousness: for they shall be filled.
7 Blessed are the merciful: for they shall obtain mercy.
8 Blessed are the pure in heart: for they shall see God.
9 Blessed are the peacemakers: for they shall be called the children of God.
10 Blessed are they which are persecuted for righteousness' sake: for theirs is the kingdom of heaven.
11 Blessed are ye, when men shall revile you, and persecute you, and shall say all manner of evil against you falsely, for my sake.
12 Rejoice, and be exceeding glad: for great is your reward in heaven: for so persecuted they the prophets which were before you.”
And then, E. W. Bullinger’s Notes:
http://www.teleiosministries.com/companion_bible/New%20Testament/36%20Matthew%201303-1380.pdf
Mt. 5:1 - 7:29. Disciples Taught. "The Sermon on the Mount". (Introversion.)
Z (italics) | B | Mt. 5:1-2. Introduction.
C | Mt. 5:3-12. Characters. True Happiness.
D | Mt. 5:13-16. True Disciples.
E | Mt. 5:17 - 7:12. The Kingdom. Its Laws.
E (italics) | Mt. 7:13-14. The Kingdom. Entrance into it.
D (italics) | Mt. 7:15-23. False Teachers.
C (italics) | Mt. 7:24-27. Characters. True Wisdom.
B (italics) | Mt. 7:28-29. Conclusion.
Mt. 5:3-12. Characters. (Introversion.)
C | a | Mt. 5:3. Heirs of the Kingdom.
b | Mt. 5:4. Mourners. Reward for Mourners.
c | Mt. 5:5. Inheritance. Earthly.
d | Mt. 5:6. True righteousness.
d (italics) | Mt. 5:7. Fruits of righteousness.
c (italics) | Mt. 5:8. Inheritance. Heavenly.
b (italics) | Mt. 5:9. Peacemakers. Reward for Peacemakers.
a (italics) | Mt. 5:10-12. Heirs of the Kingdom.
Mt. 5:1. a mountain = the mountain. Well known and therefore unnamed, but corresponds with the Mount of Olives in the Structure of the Gospel as a whole! Cp. F and F (italics), p. 1315. There is a reference also to Sinai.
set. The posture of the Oriental teacher today.
disciples. Note this fact in interpreting the member Z.
Mt. 5:2. Opened his mouth. Heb. idiom. Fig. Metonymy (of Adjunct), Ap. 6, for speaking (Job 3:1; Dan. 10:16; Acts 8:35).
taught them. See note on 7:39, and the Structure, above. the Structure is the commentary showing that this teaching is connected with the proclamation of the kingdom (v. 3), and is to be interpreted by it. As the kingdom was rejected and is now in abeyance, so likewise this discourse is in abeyance with all its commands... until "the gospel of the kingdom" is again proclaimed, to herald its drawing nigh. Parts of this address were repeated at different times and on different occasions. Luke nowhere professes to give the whole address in its chronological setting or entirety. Only some thirty separate verses are so repeated by Luke out of 107 verses in Matthew. The later repetitions in Luke were given in "a plain" (Lk. 6:17) and after the calling of the Twelve (Lk. 6:13); here the whole is given before the calling of the Twelve (Mt. 9:9). These are marks of accuracy, not of "discrepancy" as alleged. Modern critics first assume that the two accounts are identical, and they say: "No one now expects to find chronological accuracy in the evangelical records"! For the relation of the Sermon on the Mount to Ps. 15, see Ap. 70; and to the seven "woes" of Ch. 23, see Ap. 126.
Mt. 5:3. Blessed = Happy, representing the Heb. 'ashrey (not "baruk", blessed). 'Ashrey (Fig. Beatitudo, not Benedictio) occurs in nineteen Psalms twenty-six times; elsewhere only in eight books (Dt., 1 Kgs., 2 Chron., Is., Pr., Job, Ecc., and Dan.). The Aramaic equivalent for 'ashrey is tob (sing., pl., or dual). See Ap. 94. III. 3, and Ap. 63. vi. Gr. makarios = happy (not eulogetos, which = blessed, and is used only of God (Mt. 14:61; Lk. 1:68; Rom. 1:25, 9:5; 2 Cor. 1:3, 11:31; Eph. 1:3; 1 Pe. 1:3)).
poor in spirit. The equivalent for the Aramaic (Ap. 94. III. 3, p. 135), 'anaiyim (Heb. anah. See note on Pr. 1:11) = poor in this world (as in Lk. 6:20), in contrast with the promise of the kingdom. Cp. Jas. 2:5.
spirit. Gr. pneuma. See Ap. 114.
heaven = the heavens. See notes on 6:9-10.
Mt. 5:4. Blessed. Note the Fig. Anaphora (Ap. 6). The eight Beatitudes are to be contrasted with and understood by the eight "woes" of 23:13-33. See Ap. 126.
Mt. 5:5. meek. Cp. Ps. 37:11.
the earth: or, the land. Gr. "ge". See Ap. 129. 4.
Mt. 5:6. hunger and thirst... The idiom for a strong desire. Cp. Ps. 42:1-2, 119:103.
Mt. 5:7. merciful = compassionate. Cp. Ps. 41:1.
mercy. Not merely now, but in the manifestation of the kingdom, Jas. 2:13 (cp. Heb. 4:16, 8:12, 10:28).
Mt. 5:8. pure in heart. Cp. Ps. 24:4, 73:1.
God. Ap. 98. I. i. 1.
Mt. 5:9. peacemakers. Cp. Ps. 133:1. Gr. eirenopoios. Occ. only here.
children = sons. Gr. huios, see Ap. 108. III.
Mt. 5:10. are persecuted = have been persecuted. Cp. Pss. 37, 39, 40.
for = on account of.
for righteousness' sake. Not otherwise.
Mt. 5:11. revile = reproach.
evil = harmful thing. Gr. poneros. Ap. 128. IV. 1.
against. Gr. kata. Ap. 104. x. 1.
falsely. This is another condition of the happiness of v. 3.
Mt. 5:12. Rejoice... See 1 Pe. 4:13. Cp. Acts 16:25.
in. Gr. "en". Ap. 104. viii.
for = because. Not the same as in v. 3...
Notices:
My dear sister, and Christ Cristina Tello González, from Spain, asks (sorry again for the delay on translating this to English):
1) Related to the repetitive use of the Aramaic word "Abba" plus the translation into Greek, or English, in which case will accompany the previous one, as: "Abba, Father" (as if repeating twice to the similar person: "Daddy, Father"); and,
2) About the timing of the crucifixion of Christ and a related event one day earlier.
These were my answers:
1) It seems that the best response seems to be that we are dealing with an Eastern Usage (an Idiom or 'Orientalism') in which when something wanted to be emphasized it was repeated twice (such as in all the times that Jesus says: "Amen Amen": "Verily, Verily" I say unto you...), and in this case with a slight variation seen in the Aramaic text: "Abba Aby" (Dad Daddy) in the Aramaic of Mk. 14:36, and "Abba Abun" (Dad Father) in the Aramaic of Romans 8:15 and Galatians 4:6. In the Greek, obviously, it is first put the Aramaic and then its translation to the Greek in a similar way for all the previous cases: "Abba ho Pater" (Dad the Father).
2) It´s advised to read the best book related to the topic: "Jesus Christ our Passover":
https://www.amazon.com/Jesus-Christ-Passover-Victor-Wierwille/dp/0910068305
There, we are able to see the next details:
In pp. 214-215 The Calendar shows for us that two Gospel writers are talking about two different things done in two different days; detailed as follows:
p. 202
John 19:14-15:
“…And it was the preparation of the Passover, and about the sixth hour [noon]: and be saith unto the Jews, Behold your King! But they cried out, Away with him, away with him, crucify him. Pilate saith unto them, Shall I crucify your King? The chief priests answered, We have no king but Caesar.”
p. 203:
“…here in John 19:14 it says that Jesus was before Pilate at noon, the sixth hour, after he had already been on trial before the Sanhedrin earlier in the morning. There is no one who can make any of these events fit chronologically unless he recognizes that this was only Tuesday…”
p. 207
John 19:16:
“Then delivered he him therefore unto them to be crucified. And they took Jesus, and led him away.” “...it was still Tuesday, the thirteenth of Nisan, about noon. Understanding this, the next events must have begun that Tuesday afternoon. Upon leaving Pilate, Jesus was not immediately taken and crucified. He was first taken by the Roman soldiers back into the Praetorium…”
p. 229:
“The time of the crucifixion, as stated in Mark 15:25, was the third hour, about 9 A. M. At this time Jesus was put on the cross and the malefactors were crucified with him.”
So, let´s keep on praying in tongues the ones for the others in order for God to continue surprising us with His Daily Wonders!
In Christ,
Fernando.
Related Links:
Jesus Christ Our Promised Seed:
https://web.archive.org/web/20151206175727/http://www.preteristarchive.com/Books/pdf/1982_promised-seed.pdf
Jesus Christ the Apostle and High Priest:
http://www.biblicalastronomy.com/jesusChristtheapostle.pdf
My Original Link is at: https://www.facebook.com/TastersOfTheWord/posts/1321706281185138:0
For this 19th Class of the "Arreola's Chair" in English, I wish to include another of his Biblical selections for his Edited book: "Reading Out Loud", from the Gospel of Luke, "Against Greed":
Lk. 12:16-31 (KJV)
"16 And he spake a parable unto them, saying, The ground of a certain rich man brought forth plentifully:
17 And he thought within himself, saying, What shall I do, because I have no room where to bestow my fruits?
18 And he said, This will I do: I will pull down my barns, and build greater; and there will I bestow all my fruits and my goods.
19 And I will say to my soul, Soul, thou hast much goods laid up for many years; take thine ease, eat, drink, and be merry.
20 But God said unto him, Thou fool, this night thy soul shall be required of thee: then whose shall those things be, which thou hast provided?
21 So is he that layeth up treasure for himself, and is not rich toward God.
22 And he said unto his disciples, Therefore I say unto you, Take no thought for your life, what ye shall eat; neither for the body, what ye shall put on.
23 The life is more than meat, and the body is more than raiment.
24 Consider the ravens: for they neither sow nor reap; which neither have storehouse nor barn; and God feedeth them: how much more are ye better than the fowls?
25 And which of you with taking thought can add to his stature one cubit?
26 If ye then be not able to do that thing which is least, why take ye thought for the rest?
27 Consider the lilies how they grow: they toil not, they spin not; and yet I say unto you, that Solomon in all his glory was not arrayed like one of these.
28 If then God so clothe the grass, which is to day in the field, and to morrow is cast into the oven; how much more will he clothe you, O ye of little faith?
29 And seek not ye what ye shall eat, or what ye shall drink, neither be ye of doubtful mind.
30 For all these things do the nations of the world seek after: and your Father knoweth that ye have need of these things.
31 But rather seek ye the kingdom of God; and all these things shall be added unto you."
And then, the Structures and Notes by Bullinger:
http://www.teleiosministries.com/…/38%20Luke%201427-1509.pdf
Lk. 12:13-21. To The People (Introversion)
L | e | Lk. 12:13-14. A Man's request. Made.
f | Lk. 12:15. Covetousness. Warning.
f (italics) | Lk. 12:16-20. Covetousness. Parable.
e (italics) | Lk. 12:21. The Man's request. Application.
Lk. 12:22-53. To The Disciples (Alternation)
K | O | Lk. 12:22-31. Solicitude. Discouraged. [Negative.]
P | Lk. 12:32. Fear of Man. Discouraged. [Negative.]
O (italics) | Lk. 12:33-34. Liberality. Encouraged. [Positive.]
P (italics) | Lk. 12:35-53. Watchfulness for the Lord. [Positive.]
Lk. 12:22-31. Solicitude. Discouraged. (Introversion and Alternation)
O | Q | Lk. 12:22-23. Solicitude. Dehortation.
R | g | Lk. 12:24-. Ravens.
h | Lk. 12:-24-26. Application.
R (italics) | g (italics) | Lk. 12:27. Lilies.
h (italics) | Lk. 12:28. Application.
Q (italics) | Lk. 12:29-31. Solicitude. Dehortation.
Lk. 12:16. ground = estate. Gr. chora.
brought forth plentifully. Gr. euphoreo. Occ. only here.
Lk. 12:17. thought = was reasoning.
within. Gr. "en". Ap. 104. viii.
no = not. Gr. "ou". Ap. 105. I.
bestow = gather together, or lay up.
Lk. 12:18. barns = granaries.
fruits = produce. Not the same word as in v. 17. Tr., WH, R, read: "the corn".
goods = good things.
Lk. 12:19. my soul. Idiom for "myself". Gr. mou psuche.. See Ap. 13. VI. 18, Ap. 110, and note on Jer. 17:21.
soul = psuche. See Ap. 110. IV. 1.
laid up = laid by.
for (Gr. "eis". Ap. 104. vi) many years. Cp. Pr. 27:1.
Lk. 12:20. this night = this very night.
thy soul = thy life. Ap. 110. III. 2.
shall be required = they demand. Only here and 6:30. Tr., A, WH, read: "is required". But both are impersonal, carry out God's judgments or Satan's will. Cp. Ps. 49:15; Job 4:19, 18:18, 19:26, 34:20. In a good sense cp. Is. 60:11.
which... In the Gr. this clause is emphatic, standing before the question "then whose"...
provided = prepared.
Lk. 12:21. toward. Gr. "eis". Ap. 104. vi.
Lk. 12:22. Therefore = On (Gr. dia. Ap. 104. v. 3) this [account].
Take no thought... This saying is repeated from Mt. 6:25, where it says: "be not careful"; i.e., full of care, or over anxious. Cp. vv. 27,28,31,34.
life. Gr. psuche. See Ap. 110. III. 1. It is what can "eat".
Lk. 12:23. The. [L], T, Tr, A, WH, R, read: "For the"...
meat = food. Cp. Mt. 6:25-34.
Lk. 12:24. Consider... See note on Mt. 7:3.
ravens. See Job 38:41. Ps. 147:9. Occ. only here in N.T.
neither sow = sow not (Gr. "ou". Ap. 105. I).
nor. Gr. "oude".
neither have = have not, as above.
storehouse. Same as "closet" in v. 3.
barn = granary.
fowls = birds.
Lk. 12:25. to. Gr. "epi". Ap. 104. ix. 3.
stature = age, as in Jn. 9:21,23; Heb. 11:11, referring to fullness of growth, hence rendered "stature" (Lk. 19:3; Eph. 4:13). A "cubit" could not be "the least" of v. 26. It must therefore be put by Fig. "Metonymy" (of Subject). Ap. 6, for "length" generally: either the least measure (as inch) to his height, or a moment to his age (or life). Gr. helikia. Occ. elsewhere in Lk. 2:52 and Mt. 6:27.
Lk. 12:26. If ye... Assuming the hypothesis as a fact. See Ap. 118. 2a.
not. Compound of "ou". Ap. 105. I.
least. This determines the meaning of "cubit" in v. 25, or it would nullify the Lord's argument.
for. Gr. peri. Ap. 104. xiii. 1.
Lk. 12:27. they grow. T, Tr., A, WH, m., omit, and read "how they toil not"...
toil not, they spin not = neither toil nor spin. T, A, WH, m., read "neither spin nor weave".
Solomon ...was not = not even Solomon was. ! Kgs. 3:13, 10:1-29; Song 3:6-11.
Lk. 12:28. grass... Cp. Is. 40:6; 1 Pe. 1:24; Jas. 1:10-11.
cast : i.e., for fuel "oven" being put by Fig. Metonymy (of Adjunct), Ap. 6, for the furnace; as we say: "the kettle boils" or "light the fire".
O ye of little faith. Gr. oligopistos. See all the five occ. in note on Mt. 6:30.
Lk. 12:29. neither = and not. Gr. me. Ap. 104. II.
of doubt of mind = excited. Occ. only here in N. T.
Lk. 12:30. world. Gr. kosmos. Ap. 129. 1.
knoweth. Gr. oida. Ap. 132. I. i.
Lk. 12:31. the kingdom of God. See Ap. 114.
Notices:
I wish to thank also in English, with a little delay (I'm sorry!) the question by my dear sister in Christ Patty Diaz Squindo, from Peru: What is the meaning of all those letters (referring to the ordering of lines in the Biblical Structures discovered by E. W. Bullinger). This was my response (originally in Spanish): Patty, Thanks for your question! I gladly answer, E. W. Büllinger was a researcher at the end of the 19th Century in England who did the discovery that the same God Almighty who designed the Universe, did reveal Hs Word with the same logic and symmetry, the monumental work by Ethelbert William is "The Companion Bible", and can be freely downloaded complete in PDF or other formats, from the "Archive": https://archive.org/details/CompanionBible.Bullinger.1901-Haywood.2005
Or book by book separately, through Teleios Min.:
http://www.teleiosministries.com/companion_bible
In Christ,
Fernando.
P.S. Sitio del nexo original:
https://www.facebook.com/TastersOfTheWord/posts/1320787104610389:0
Lk. 12:16-31 (KJV)
"16 And he spake a parable unto them, saying, The ground of a certain rich man brought forth plentifully:
17 And he thought within himself, saying, What shall I do, because I have no room where to bestow my fruits?
18 And he said, This will I do: I will pull down my barns, and build greater; and there will I bestow all my fruits and my goods.
19 And I will say to my soul, Soul, thou hast much goods laid up for many years; take thine ease, eat, drink, and be merry.
20 But God said unto him, Thou fool, this night thy soul shall be required of thee: then whose shall those things be, which thou hast provided?
21 So is he that layeth up treasure for himself, and is not rich toward God.
22 And he said unto his disciples, Therefore I say unto you, Take no thought for your life, what ye shall eat; neither for the body, what ye shall put on.
23 The life is more than meat, and the body is more than raiment.
24 Consider the ravens: for they neither sow nor reap; which neither have storehouse nor barn; and God feedeth them: how much more are ye better than the fowls?
25 And which of you with taking thought can add to his stature one cubit?
26 If ye then be not able to do that thing which is least, why take ye thought for the rest?
27 Consider the lilies how they grow: they toil not, they spin not; and yet I say unto you, that Solomon in all his glory was not arrayed like one of these.
28 If then God so clothe the grass, which is to day in the field, and to morrow is cast into the oven; how much more will he clothe you, O ye of little faith?
29 And seek not ye what ye shall eat, or what ye shall drink, neither be ye of doubtful mind.
30 For all these things do the nations of the world seek after: and your Father knoweth that ye have need of these things.
31 But rather seek ye the kingdom of God; and all these things shall be added unto you."
And then, the Structures and Notes by Bullinger:
http://www.teleiosministries.com/…/38%20Luke%201427-1509.pdf
Lk. 12:13-21. To The People (Introversion)
L | e | Lk. 12:13-14. A Man's request. Made.
f | Lk. 12:15. Covetousness. Warning.
f (italics) | Lk. 12:16-20. Covetousness. Parable.
e (italics) | Lk. 12:21. The Man's request. Application.
Lk. 12:22-53. To The Disciples (Alternation)
K | O | Lk. 12:22-31. Solicitude. Discouraged. [Negative.]
P | Lk. 12:32. Fear of Man. Discouraged. [Negative.]
O (italics) | Lk. 12:33-34. Liberality. Encouraged. [Positive.]
P (italics) | Lk. 12:35-53. Watchfulness for the Lord. [Positive.]
Lk. 12:22-31. Solicitude. Discouraged. (Introversion and Alternation)
O | Q | Lk. 12:22-23. Solicitude. Dehortation.
R | g | Lk. 12:24-. Ravens.
h | Lk. 12:-24-26. Application.
R (italics) | g (italics) | Lk. 12:27. Lilies.
h (italics) | Lk. 12:28. Application.
Q (italics) | Lk. 12:29-31. Solicitude. Dehortation.
Lk. 12:16. ground = estate. Gr. chora.
brought forth plentifully. Gr. euphoreo. Occ. only here.
Lk. 12:17. thought = was reasoning.
within. Gr. "en". Ap. 104. viii.
no = not. Gr. "ou". Ap. 105. I.
bestow = gather together, or lay up.
Lk. 12:18. barns = granaries.
fruits = produce. Not the same word as in v. 17. Tr., WH, R, read: "the corn".
goods = good things.
Lk. 12:19. my soul. Idiom for "myself". Gr. mou psuche.. See Ap. 13. VI. 18, Ap. 110, and note on Jer. 17:21.
soul = psuche. See Ap. 110. IV. 1.
laid up = laid by.
for (Gr. "eis". Ap. 104. vi) many years. Cp. Pr. 27:1.
Lk. 12:20. this night = this very night.
thy soul = thy life. Ap. 110. III. 2.
shall be required = they demand. Only here and 6:30. Tr., A, WH, read: "is required". But both are impersonal, carry out God's judgments or Satan's will. Cp. Ps. 49:15; Job 4:19, 18:18, 19:26, 34:20. In a good sense cp. Is. 60:11.
which... In the Gr. this clause is emphatic, standing before the question "then whose"...
provided = prepared.
Lk. 12:21. toward. Gr. "eis". Ap. 104. vi.
Lk. 12:22. Therefore = On (Gr. dia. Ap. 104. v. 3) this [account].
Take no thought... This saying is repeated from Mt. 6:25, where it says: "be not careful"; i.e., full of care, or over anxious. Cp. vv. 27,28,31,34.
life. Gr. psuche. See Ap. 110. III. 1. It is what can "eat".
Lk. 12:23. The. [L], T, Tr, A, WH, R, read: "For the"...
meat = food. Cp. Mt. 6:25-34.
Lk. 12:24. Consider... See note on Mt. 7:3.
ravens. See Job 38:41. Ps. 147:9. Occ. only here in N.T.
neither sow = sow not (Gr. "ou". Ap. 105. I).
nor. Gr. "oude".
neither have = have not, as above.
storehouse. Same as "closet" in v. 3.
barn = granary.
fowls = birds.
Lk. 12:25. to. Gr. "epi". Ap. 104. ix. 3.
stature = age, as in Jn. 9:21,23; Heb. 11:11, referring to fullness of growth, hence rendered "stature" (Lk. 19:3; Eph. 4:13). A "cubit" could not be "the least" of v. 26. It must therefore be put by Fig. "Metonymy" (of Subject). Ap. 6, for "length" generally: either the least measure (as inch) to his height, or a moment to his age (or life). Gr. helikia. Occ. elsewhere in Lk. 2:52 and Mt. 6:27.
Lk. 12:26. If ye... Assuming the hypothesis as a fact. See Ap. 118. 2a.
not. Compound of "ou". Ap. 105. I.
least. This determines the meaning of "cubit" in v. 25, or it would nullify the Lord's argument.
for. Gr. peri. Ap. 104. xiii. 1.
Lk. 12:27. they grow. T, Tr., A, WH, m., omit, and read "how they toil not"...
toil not, they spin not = neither toil nor spin. T, A, WH, m., read "neither spin nor weave".
Solomon ...was not = not even Solomon was. ! Kgs. 3:13, 10:1-29; Song 3:6-11.
Lk. 12:28. grass... Cp. Is. 40:6; 1 Pe. 1:24; Jas. 1:10-11.
cast : i.e., for fuel "oven" being put by Fig. Metonymy (of Adjunct), Ap. 6, for the furnace; as we say: "the kettle boils" or "light the fire".
O ye of little faith. Gr. oligopistos. See all the five occ. in note on Mt. 6:30.
Lk. 12:29. neither = and not. Gr. me. Ap. 104. II.
of doubt of mind = excited. Occ. only here in N. T.
Lk. 12:30. world. Gr. kosmos. Ap. 129. 1.
knoweth. Gr. oida. Ap. 132. I. i.
Lk. 12:31. the kingdom of God. See Ap. 114.
Notices:
I wish to thank also in English, with a little delay (I'm sorry!) the question by my dear sister in Christ Patty Diaz Squindo, from Peru: What is the meaning of all those letters (referring to the ordering of lines in the Biblical Structures discovered by E. W. Bullinger). This was my response (originally in Spanish): Patty, Thanks for your question! I gladly answer, E. W. Büllinger was a researcher at the end of the 19th Century in England who did the discovery that the same God Almighty who designed the Universe, did reveal Hs Word with the same logic and symmetry, the monumental work by Ethelbert William is "The Companion Bible", and can be freely downloaded complete in PDF or other formats, from the "Archive": https://archive.org/details/CompanionBible.Bullinger.1901-Haywood.2005
Or book by book separately, through Teleios Min.:
http://www.teleiosministries.com/companion_bible
In Christ,
Fernando.
P.S. Sitio del nexo original:
https://www.facebook.com/TastersOfTheWord/posts/1320787104610389:0
For this 18th Class by Arreola: https://www.facebook.com/TastersOfTheWord/posts/1319947538027679:0, the fourth principle that we will see this week is that it´s very important (if we can) to be able to read out loud!
Arreola even Edited a full book with the writings that inspired him to be a writer, the ones that frequently he used to read out loud, and one of them is the next one:
1 Corinthians 13 (KJV)
13 Though I speak with the tongues of men and of angels, and have not charity, I am become as sounding brass, or a tinkling cymbal.
2 And though I have the gift of prophecy, and understand all mysteries, and all knowledge; and though I have all faith, so that I could remove mountains, and have not charity, I am nothing.
3 And though I bestow all my goods to feed the poor, and though I give my body to be burned, and have not charity, it profiteth me nothing.
4 Charity suffereth long, and is kind; charity envieth not; charity vaunteth not itself, is not puffed up,
5 Doth not behave itself unseemly, seeketh not her own, is not easily provoked, thinketh no evil;
6 Rejoiceth not in iniquity, but rejoiceth in the truth;
7 Beareth all things, believeth all things, hopeth all things, endureth all things.
8 Charity never faileth: but whether there be prophecies, they shall fail; whether there be tongues, they shall cease; whether there be knowledge, it shall vanish away.
9 For we know in part, and we prophesy in part.
10 But when that which is perfect is come, then that which is in part shall be done away.
11 When I was a child, I spake as a child, I understood as a child, I thought as a child: but when I became a man, I put away childish things.
12 For now we see through a glass, darkly; but then face to face: now I know in part; but then shall I know even as also I am known.
13 And now abideth faith, hope, charity, these three; but the greatest of these is charity.
And again, taken from "The Companion Bible":
http://www.teleiosministries.com/companion_bible/New%20Testament/42%20Corinthians%20I%20&%20II%201695-1747.pdf
1 Cor. 13:1-13. Love More Excellent Than Gifts (Alternation)
E | h | 1 Cor. 13:1-3. Love the pre-eminent grace.
i | 1 Cor. 13:4-8-. Its characteristics.
h (italics) | 1 Cor. 13:-8-12. Gifts only transient.
i (italics) | 1 Cor. 13:13. Love abides and is supreme.
1 Cor. 13:1. Though = If (Ap. 118. 1. b.)
charity = love. Ap. 135. II. 1.
sounding. Greek echeo. Only here and Luke 21:25. Elsewhere, Mr. 6:8; 12:41... (money).
tinkling. Gr. alalazo. Only here and Mr. 5:38. An onomatopoeic word. Frequent in the Sept. of the battle shout: Josh. 6:20; Judges 15:14; 1 Sam. 17:20,52, etc...
cymbal. Gr. kumbalon. Only here, but frequent in the Sept.
1 Cor. 13:2. understand = know. Ap. 132. I. i.
remove. Gr. methistemi. See Acts 13:22.
nothing. Gr. oudeis.
1 Cor. 13:3. bestow = give away in doles. Gr. psomizo. Only here and Rom. 12:20, Cp. "sop", Jn. 13:26.
goods = the things belonging (huparcho, Lk. 9:48) to me.
give = deliver up. Gr. paradidomi. See Jn. 19:30.
to be = in order that (Gr. hina) it may be.
It profiteth... = I am nothing profited.
1 Cor. 13:4. is kind. Gr. chresteuomai. Only here. Cp. Ap. 184. III. Note the Fig. Asyndeton in these vv. 4-8.
envieth. Gr. zeloo. See Acts 7:9.
vaunteth. Gr. perpereuomai. Only here.
is... puffed up. See 4:6.
1 Cor. 13:5. Doth... behave... Gr. aschemoneo. Only here and 7:36.
is... easily provoked = is... roused to anger. Gr. paroxunomai. Only here and Acts 17:16. there is no word for "easily". The statement is absolute.
thinketh no evil = reckons not (Gr. ou) the evil (done to it).
1 Cor. 13:6. in = upon, or at. Ap. 104. ix. 2.
iniquity = unrighteousness. Ap. 128. VII. 1.
rejoiceth in the truth = rejoices with (as in 12:26) the truth, i.e. as it wins its way, truth being personified.
1 Cor. 13:7. Beareth. Gr. stego. See 9:12. Here it means "is forbearing in all provocations".
1 Cor. 13:8. never. Gr. oudepote.
faileth. All the texts read "falleth", falls.
whether. Gr. eite.
fail = be brought to nought. Gr. katargeo. See Rom. 3:3.
vanish away. Same as "fail".
1 Cor. 13:9. know. Ap. 132. I. ii.
in part. Gr. “ek” (Ap. 104. vii) merous.
1 Cor. 13:10. perfect. Ap. 125. 1.
done away. Same as "fail", v. 8.
1 Cor. 13:11. child. Ap. 108. vii.
thought = reasoned. gr. logizomai.
put away = did away with. Gr. katargeo, as in vv. 8, 10.
1 Cor. 13:12. glass = mirror. Gr. esoptron. Only here and James 1:23.
darkly. Lit. in (Gr. "en") a riddle. Gr. ainigma. Only here in N. T. In the Sept., Num. 12:8; 1 Kings 10:1; Prov. 1:6...
know = fully know
even as... = even as I was fully known also (note by the Scribe: so the perfect is Christ, to whom we, the born again ones, will see face to face at his return for us).
1 Cor. 13:13. abideth. Gr. meno. See p. 1511.
Here is the complete list in Spanish of the selection by Arreola for the students to read out loud (“Sepan Cuantos” 103, “Lectura en Voz Alta”, edited by Juan José Arreola): https://web.archive.org/web/20161026143928/http://biblio.upmx.mx/indices/78763.pdf
This is the brief recap of the four principles to be a good writer that the brain of a writer such as Arreola´s could teach to us:
1. To be a good writer we need to be good readers.
2. To write properly investigative articles we need to be able to go to the original language of the writing.
3. To write with impact we need to be able to discern between what is literal from what is literary.
4. To perceive the strength of what we write, we need to be good out loud readers.
Notices:
I wish to thank Adri Acuña, for contacting me from La Pampa Argentina. The closest to the Hebrew of the Book of Job is by Büllinger in English: https://ia802701.us.archive.org/12/items/bookofjob00bull/bookofjob00bull.pdf and
http://www.teleiosministries.com/companion_bible/Old%20Testament/14%20Job%20665-719.pdf
And in the interlinear Heb. - Eng.: http://biblehub.com/interlinear/job/1.htm
Or in a Spanish interlinear Heb. - Spa.: https://elmundobiblicodigital.wordpress.com/2015/03/29/antiguo-testamento-interlineal-hebreo-espanol-vol-i-pentateuco/ (vol. 3).
God did put limits to the Adversary in order for Job not to die, God knew about the fears of Job, places where the Adversary was able to be introduced in his life, but God also knew the unbreakable belief of Job in that God was able to rescue him, even when Job was wrong in other points... The Adversary is an Archangel, and God says that his callings are irrevocable, including that, and as far as I know, only him is able to cross to the place where God organizes his meetings with His hosts, but even that is going to be forbidden to Satan in the days of the Apocalypse (narrated in the book of Revelation). We are learning that God is Love and not even to one of His rebellious creatures can He swat like a fly, leaving him with freedom of choice ...being able ourselves to know now the prophetic end of the story because of his foolishness... I remember that one of the more intense songs in those future days of the Apocalypse, is when we will sing from heaven, together with Christ, that Satan finally has been cast down from heaven in order to never again go back to accuse our brethren!!! I hope one day in the far future to be able to read the Book of Job directly from the Hebrew into Spanish, incorporating all those beautiful linguistic observations by Bullinger, in Christ, Fernando.
Arreola even Edited a full book with the writings that inspired him to be a writer, the ones that frequently he used to read out loud, and one of them is the next one:
1 Corinthians 13 (KJV)
13 Though I speak with the tongues of men and of angels, and have not charity, I am become as sounding brass, or a tinkling cymbal.
2 And though I have the gift of prophecy, and understand all mysteries, and all knowledge; and though I have all faith, so that I could remove mountains, and have not charity, I am nothing.
3 And though I bestow all my goods to feed the poor, and though I give my body to be burned, and have not charity, it profiteth me nothing.
4 Charity suffereth long, and is kind; charity envieth not; charity vaunteth not itself, is not puffed up,
5 Doth not behave itself unseemly, seeketh not her own, is not easily provoked, thinketh no evil;
6 Rejoiceth not in iniquity, but rejoiceth in the truth;
7 Beareth all things, believeth all things, hopeth all things, endureth all things.
8 Charity never faileth: but whether there be prophecies, they shall fail; whether there be tongues, they shall cease; whether there be knowledge, it shall vanish away.
9 For we know in part, and we prophesy in part.
10 But when that which is perfect is come, then that which is in part shall be done away.
11 When I was a child, I spake as a child, I understood as a child, I thought as a child: but when I became a man, I put away childish things.
12 For now we see through a glass, darkly; but then face to face: now I know in part; but then shall I know even as also I am known.
13 And now abideth faith, hope, charity, these three; but the greatest of these is charity.
And again, taken from "The Companion Bible":
http://www.teleiosministries.com/companion_bible/New%20Testament/42%20Corinthians%20I%20&%20II%201695-1747.pdf
1 Cor. 13:1-13. Love More Excellent Than Gifts (Alternation)
E | h | 1 Cor. 13:1-3. Love the pre-eminent grace.
i | 1 Cor. 13:4-8-. Its characteristics.
h (italics) | 1 Cor. 13:-8-12. Gifts only transient.
i (italics) | 1 Cor. 13:13. Love abides and is supreme.
1 Cor. 13:1. Though = If (Ap. 118. 1. b.)
charity = love. Ap. 135. II. 1.
sounding. Greek echeo. Only here and Luke 21:25. Elsewhere, Mr. 6:8; 12:41... (money).
tinkling. Gr. alalazo. Only here and Mr. 5:38. An onomatopoeic word. Frequent in the Sept. of the battle shout: Josh. 6:20; Judges 15:14; 1 Sam. 17:20,52, etc...
cymbal. Gr. kumbalon. Only here, but frequent in the Sept.
1 Cor. 13:2. understand = know. Ap. 132. I. i.
remove. Gr. methistemi. See Acts 13:22.
nothing. Gr. oudeis.
1 Cor. 13:3. bestow = give away in doles. Gr. psomizo. Only here and Rom. 12:20, Cp. "sop", Jn. 13:26.
goods = the things belonging (huparcho, Lk. 9:48) to me.
give = deliver up. Gr. paradidomi. See Jn. 19:30.
to be = in order that (Gr. hina) it may be.
It profiteth... = I am nothing profited.
1 Cor. 13:4. is kind. Gr. chresteuomai. Only here. Cp. Ap. 184. III. Note the Fig. Asyndeton in these vv. 4-8.
envieth. Gr. zeloo. See Acts 7:9.
vaunteth. Gr. perpereuomai. Only here.
is... puffed up. See 4:6.
1 Cor. 13:5. Doth... behave... Gr. aschemoneo. Only here and 7:36.
is... easily provoked = is... roused to anger. Gr. paroxunomai. Only here and Acts 17:16. there is no word for "easily". The statement is absolute.
thinketh no evil = reckons not (Gr. ou) the evil (done to it).
1 Cor. 13:6. in = upon, or at. Ap. 104. ix. 2.
iniquity = unrighteousness. Ap. 128. VII. 1.
rejoiceth in the truth = rejoices with (as in 12:26) the truth, i.e. as it wins its way, truth being personified.
1 Cor. 13:7. Beareth. Gr. stego. See 9:12. Here it means "is forbearing in all provocations".
1 Cor. 13:8. never. Gr. oudepote.
faileth. All the texts read "falleth", falls.
whether. Gr. eite.
fail = be brought to nought. Gr. katargeo. See Rom. 3:3.
vanish away. Same as "fail".
1 Cor. 13:9. know. Ap. 132. I. ii.
in part. Gr. “ek” (Ap. 104. vii) merous.
1 Cor. 13:10. perfect. Ap. 125. 1.
done away. Same as "fail", v. 8.
1 Cor. 13:11. child. Ap. 108. vii.
thought = reasoned. gr. logizomai.
put away = did away with. Gr. katargeo, as in vv. 8, 10.
1 Cor. 13:12. glass = mirror. Gr. esoptron. Only here and James 1:23.
darkly. Lit. in (Gr. "en") a riddle. Gr. ainigma. Only here in N. T. In the Sept., Num. 12:8; 1 Kings 10:1; Prov. 1:6...
know = fully know
even as... = even as I was fully known also (note by the Scribe: so the perfect is Christ, to whom we, the born again ones, will see face to face at his return for us).
1 Cor. 13:13. abideth. Gr. meno. See p. 1511.
Here is the complete list in Spanish of the selection by Arreola for the students to read out loud (“Sepan Cuantos” 103, “Lectura en Voz Alta”, edited by Juan José Arreola): https://web.archive.org/web/20161026143928/http://biblio.upmx.mx/indices/78763.pdf
This is the brief recap of the four principles to be a good writer that the brain of a writer such as Arreola´s could teach to us:
1. To be a good writer we need to be good readers.
2. To write properly investigative articles we need to be able to go to the original language of the writing.
3. To write with impact we need to be able to discern between what is literal from what is literary.
4. To perceive the strength of what we write, we need to be good out loud readers.
Notices:
I wish to thank Adri Acuña, for contacting me from La Pampa Argentina. The closest to the Hebrew of the Book of Job is by Büllinger in English: https://ia802701.us.archive.org/12/items/bookofjob00bull/bookofjob00bull.pdf and
http://www.teleiosministries.com/companion_bible/Old%20Testament/14%20Job%20665-719.pdf
And in the interlinear Heb. - Eng.: http://biblehub.com/interlinear/job/1.htm
Or in a Spanish interlinear Heb. - Spa.: https://elmundobiblicodigital.wordpress.com/2015/03/29/antiguo-testamento-interlineal-hebreo-espanol-vol-i-pentateuco/ (vol. 3).
God did put limits to the Adversary in order for Job not to die, God knew about the fears of Job, places where the Adversary was able to be introduced in his life, but God also knew the unbreakable belief of Job in that God was able to rescue him, even when Job was wrong in other points... The Adversary is an Archangel, and God says that his callings are irrevocable, including that, and as far as I know, only him is able to cross to the place where God organizes his meetings with His hosts, but even that is going to be forbidden to Satan in the days of the Apocalypse (narrated in the book of Revelation). We are learning that God is Love and not even to one of His rebellious creatures can He swat like a fly, leaving him with freedom of choice ...being able ourselves to know now the prophetic end of the story because of his foolishness... I remember that one of the more intense songs in those future days of the Apocalypse, is when we will sing from heaven, together with Christ, that Satan finally has been cast down from heaven in order to never again go back to accuse our brethren!!! I hope one day in the far future to be able to read the Book of Job directly from the Hebrew into Spanish, incorporating all those beautiful linguistic observations by Bullinger, in Christ, Fernando.
For this 17th class related to Arreola: https://www.facebook.com/TastersOfTheWord/posts/1319072098115223:0, I couldn't resist the temptation to include Arreola's Short Story "From L'Osservatore"... (Before going back to the textbook). Here he speaks of 'Rome' having lost 'the keys of the kingdom of the heavens' from the very beginning, 15 Centuries (until a more real Christianity based in the Scriptures as its foundation started to emerge, independently of Rome)... Here's the translation:
From L'Osservatore,
by Juan José Arreola.
At the beginning of our Age, the keys of Saint Peter got lost in the suburbs of the Roman Empire. We beseech the person who finds them, to have the good will to return them immediately to the reigning Pope, as for more than fifteen centuries the doors of the Kingdom of Heaven have not been able to be forced with pick-locks.
The pertinent Biblical Scripture is:
Mt. 16:15-20 (KJV).
"15 He saith unto them, But whom say ye that I am?
16 And Simon Peter answered and said, Thou art the Christ, the Son of the living God.
17 And Jesus answered and said unto him, Blessed art thou, Simon Barjona: for flesh and blood hath not revealed it unto thee, but my Father which is in heaven.
18 And I say also unto thee, That thou art Peter, and upon this rock I will build my church; and the gates of hell shall not prevail against it.
19 And I will give unto thee the keys of the kingdom of heaven: and whatsoever thou shalt bind on earth shall be bound in heaven: and whatsoever thou shalt loose on earth shall be loosed in heaven.
20 Then charged he his disciples that they should tell no man that he was Jesus the Christ."
And the research by Bullinger to explain it from its Source:
http://www.teleiosministries.com/companion_bible/New%20Testament/36%20Matthew%201303-1380.pdf
Pages 43 and 44 here a brief excerpt, for the beginning of your own research on the topic:
Mt. 16:17-20 Jesus, the Messiah Declared. witness and Evidences. Ended (Introversion).
L | e | Mt. 16:17. Divine Revelation.
f | Mt. 16:18-. The Foundation Itself: Peter's Confession.
f (italics) | Mt. 16:-18-19. The Foundation. To be Built On.
e (italics) | Mt. 16:20. Divine Injunction.
In "Simon son of Jonah (Bar-Jonah in Hebrew)" the Lord uses his human name and parentage in contrast with the divine origin of the revelation made to him.
"Heaven" is in plural with adjective, emphatic: "The Heavens!"
In "I say also" the Lord is saying "I Also say (meaning, as well as the Father is saying)"; this is, looking back to a preceding Agent (God) with Whom the Lord associates himself (as a son in an intimate communion with his Father).
"Peter" is in Greek "petros", a stone (loose and movable), as in Jn. 1:42.
"upon", is in Greek "epi".
"this" is very emphatic, as though Jesus were pointing to himself (see 'The Companion Bible' notes on Jn. 2:19 and 6:58). One of three important passages where "this" stands for the speaker.
"This rock" = Greek "petra" is a Feminine word, and therefore could not refer to Peter; but, if it refers to Peter's confession, then it would agree with the word "homologia" (which is also Feminine), and is rendered "confession" in 1 Tim. 6:13, and "profession" in 1 Tim. 6:12; Heb. 3:1, 4:14, 10:23; compare with 2 Cor. 9:13. Whether we are to understand it (even with Augustine and with Jerome) as implying "thou hast said [it]" (see Appendix 147), or "thou art Peter", most Protestants as well as these ancient "Fathers" agree that Peter's "confession" is the foundation to which Christ referred, and NOT to Peter himself.
Peter was neither the foundation nor the builder (that will be a poor builder, verse 23) - but Christ alone!, whom Peter had confessed (1 Cor. 3:11). Thus ends the great subject of this second portion of the Lord's service or ministry (See Appendix 119). "Petra" is a rock (in situ) immovable: The Messiah, as being "The son of the living God", who is the foretold "foundation-stone" (this declaration by Peter, who spoke directly inspired by God, is fulfilling the prophecy of Is. 28:16); and the rejected stone (Ps. 118:22).
"Will" is "Shall", therefore then future, as in Hos. 1:10, 2:23.
"Church" = "Assembly", defined as "Israel", and the "Remnant" (Rom. 9:25-27). Not the "Ekklesia" of the secret (translated 'mystery') revealed until Ephesians; but rather, being that referred to in Ps. 22:22,25, etc.
"The gates...". Put by Fig. "Metonymy" (of Adjunct, Ap. 6), for power.
"...of hell" = "hell" here is the Greek word "Hades" = 'The Grave' denoting the power of the grave to retain, as in Is. 38:10; Job 38:17 (Septuagint); Ps. 9:13, 107:19.
Link to this Short Story: http://tinyurl.com/losservatorearreolano
From L'Osservatore,
by Juan José Arreola.
At the beginning of our Age, the keys of Saint Peter got lost in the suburbs of the Roman Empire. We beseech the person who finds them, to have the good will to return them immediately to the reigning Pope, as for more than fifteen centuries the doors of the Kingdom of Heaven have not been able to be forced with pick-locks.
The pertinent Biblical Scripture is:
Mt. 16:15-20 (KJV).
"15 He saith unto them, But whom say ye that I am?
16 And Simon Peter answered and said, Thou art the Christ, the Son of the living God.
17 And Jesus answered and said unto him, Blessed art thou, Simon Barjona: for flesh and blood hath not revealed it unto thee, but my Father which is in heaven.
18 And I say also unto thee, That thou art Peter, and upon this rock I will build my church; and the gates of hell shall not prevail against it.
19 And I will give unto thee the keys of the kingdom of heaven: and whatsoever thou shalt bind on earth shall be bound in heaven: and whatsoever thou shalt loose on earth shall be loosed in heaven.
20 Then charged he his disciples that they should tell no man that he was Jesus the Christ."
And the research by Bullinger to explain it from its Source:
http://www.teleiosministries.com/companion_bible/New%20Testament/36%20Matthew%201303-1380.pdf
Pages 43 and 44 here a brief excerpt, for the beginning of your own research on the topic:
Mt. 16:17-20 Jesus, the Messiah Declared. witness and Evidences. Ended (Introversion).
L | e | Mt. 16:17. Divine Revelation.
f | Mt. 16:18-. The Foundation Itself: Peter's Confession.
f (italics) | Mt. 16:-18-19. The Foundation. To be Built On.
e (italics) | Mt. 16:20. Divine Injunction.
In "Simon son of Jonah (Bar-Jonah in Hebrew)" the Lord uses his human name and parentage in contrast with the divine origin of the revelation made to him.
"Heaven" is in plural with adjective, emphatic: "The Heavens!"
In "I say also" the Lord is saying "I Also say (meaning, as well as the Father is saying)"; this is, looking back to a preceding Agent (God) with Whom the Lord associates himself (as a son in an intimate communion with his Father).
"Peter" is in Greek "petros", a stone (loose and movable), as in Jn. 1:42.
"upon", is in Greek "epi".
"this" is very emphatic, as though Jesus were pointing to himself (see 'The Companion Bible' notes on Jn. 2:19 and 6:58). One of three important passages where "this" stands for the speaker.
"This rock" = Greek "petra" is a Feminine word, and therefore could not refer to Peter; but, if it refers to Peter's confession, then it would agree with the word "homologia" (which is also Feminine), and is rendered "confession" in 1 Tim. 6:13, and "profession" in 1 Tim. 6:12; Heb. 3:1, 4:14, 10:23; compare with 2 Cor. 9:13. Whether we are to understand it (even with Augustine and with Jerome) as implying "thou hast said [it]" (see Appendix 147), or "thou art Peter", most Protestants as well as these ancient "Fathers" agree that Peter's "confession" is the foundation to which Christ referred, and NOT to Peter himself.
Peter was neither the foundation nor the builder (that will be a poor builder, verse 23) - but Christ alone!, whom Peter had confessed (1 Cor. 3:11). Thus ends the great subject of this second portion of the Lord's service or ministry (See Appendix 119). "Petra" is a rock (in situ) immovable: The Messiah, as being "The son of the living God", who is the foretold "foundation-stone" (this declaration by Peter, who spoke directly inspired by God, is fulfilling the prophecy of Is. 28:16); and the rejected stone (Ps. 118:22).
"Will" is "Shall", therefore then future, as in Hos. 1:10, 2:23.
"Church" = "Assembly", defined as "Israel", and the "Remnant" (Rom. 9:25-27). Not the "Ekklesia" of the secret (translated 'mystery') revealed until Ephesians; but rather, being that referred to in Ps. 22:22,25, etc.
"The gates...". Put by Fig. "Metonymy" (of Adjunct, Ap. 6), for power.
"...of hell" = "hell" here is the Greek word "Hades" = 'The Grave' denoting the power of the grave to retain, as in Is. 38:10; Job 38:17 (Septuagint); Ps. 9:13, 107:19.
Link to this Short Story: http://tinyurl.com/losservatorearreolano
Dedicated to my beloved and so admired translator Pam... https://www.facebook.com/TastersOfTheWord/posts/1318170331538733:0 For this 16th class I wish to start exploring, still out of the textbook, some of the comedic references to the New Testament that J. J. Arreola does, in this case he explores for fun the erroneous, both literal translation and interpretation of one of the great sentences by Jesus the Christ (Mt. 19:23-26, Mk. 10:23-27...): ... It is easier for a camel to go through the eye of a needle than for a rich man [who places his faith in wealth or status] to enter the kingdom of God”... This is the fragment by Arreola of his short story "Verily, I Say unto You" ('En Verdad os Digo', in Spanish):
"...the possibility of a failure is even more flattering. If Arpad Niklaus is a manufacturer of chimaeras and after his dead follows a whole line of impostors, his humanitarian work will only increase in greatness as a geometric progression, or as a chicken's tissue cultured by Carrel. Nothing will prevent him from passing to history as the glorious founder of the universal disintegration of stocks. And the rich, serially impoverished by the extenuating investments, will easily enter into the kingdom of heaven through the narrow gate (the eye of the needle), even if a camel couldn't pass."
And of course, as Biblical Scholars we know that "the eye of the needle" was a specific and small Architectural designed door in the Middle East put in the City Walls for men to go through, so for a camel, to pass through it, it will be needed to take away first all the load that he is carrying on its hump, in order for the camel to pass through it, almost bent on its knees! But it can pass! It can be done! (Oh you, rich of this world...) [To see more, go to my upper link.]
Notices: I wish to thank my beautiful sister in Christ Lita Cruz who this morning sent to me the reminder of taking our cross (Cruz, in Spanish) to keep on following Jesus, so I responded in an Arreola's style: "But if the cross (Cruz, in Spanish) that I wanted to take is already married I will keep on looking!!!" to which she kindly responded: "Yes, my husband has his double cross: me, Lita Cruz (cross), and Christ's". Thank you!
Links (in Spa.):
Story:
http://ciudadseva.com/texto/en-verdad-os-digo/
Comment: https://lecturaserrantes.blogspot.mx/2012/11/en-verdad-os-digo-de-juan-jose-arreola.html Music to accompany this class: https://www.youtube.com/watch?v=Ti6qhk3tX2s
"...the possibility of a failure is even more flattering. If Arpad Niklaus is a manufacturer of chimaeras and after his dead follows a whole line of impostors, his humanitarian work will only increase in greatness as a geometric progression, or as a chicken's tissue cultured by Carrel. Nothing will prevent him from passing to history as the glorious founder of the universal disintegration of stocks. And the rich, serially impoverished by the extenuating investments, will easily enter into the kingdom of heaven through the narrow gate (the eye of the needle), even if a camel couldn't pass."
And of course, as Biblical Scholars we know that "the eye of the needle" was a specific and small Architectural designed door in the Middle East put in the City Walls for men to go through, so for a camel, to pass through it, it will be needed to take away first all the load that he is carrying on its hump, in order for the camel to pass through it, almost bent on its knees! But it can pass! It can be done! (Oh you, rich of this world...) [To see more, go to my upper link.]
Notices: I wish to thank my beautiful sister in Christ Lita Cruz who this morning sent to me the reminder of taking our cross (Cruz, in Spanish) to keep on following Jesus, so I responded in an Arreola's style: "But if the cross (Cruz, in Spanish) that I wanted to take is already married I will keep on looking!!!" to which she kindly responded: "Yes, my husband has his double cross: me, Lita Cruz (cross), and Christ's". Thank you!
Links (in Spa.):
Story:
http://ciudadseva.com/texto/en-verdad-os-digo/
Comment: https://lecturaserrantes.blogspot.mx/2012/11/en-verdad-os-digo-de-juan-jose-arreola.html Music to accompany this class: https://www.youtube.com/watch?v=Ti6qhk3tX2s
Lectores Benditos, Portada y nexo a uno de mis trabajos con 15 genes humanos: https://github.com/fdocc/ProyectoHumanidadGenesMasEstudiados En Cristo, Fernando.
Continuando con las clases que daba Juan José Arreola acerca de su primer punto, aquel de que para ser buenos escritores hay que ser buenos lectores, y que la fuente número uno de lectura e inspiración de él, y de muchos otros escritores que se distinguieron, era la Biblia, tanto por su información como por su insuperable estilo artístico en sus estructuras y diseños... Aquí, Arreola presenta una conferencia a las tan admiradas damas, la que él tituló: "La Implantación del espíritu"; aquí podemos ver su convicción en la veracidad histórica de la caída del hombre, así como en los literales seis mil años Bíblicos para la existencia del ser humano como tal sobre la tierra. Esta clase yo la presento primeramente en inglés, para dar a conocer internacionalmente las glorias de la literatura de mi tierra, reconociendo al profesor que me enseñó los fundamentos de lo que sé, y de lo que quisiera llegar a ser, gracias: https://www.facebook.com/TastersOfTheWord Fuente: https://books.google.com.mx/books?id=J3__DAAAQBAJ
Here's the detail with my best friend, my father, the only real friend that I have on this earth right now, from last Thursday's evening (10/06/16; photo by J.R.R.B, from http://www.zapotlangrafico.com/)
Updated Oct 9, 2016, 4:25 PM
Aquí están mis papás disfrutando de la "Feria de Zapotlán 2016", con sus eventos culturales de alta calidad; aquí escuchaban el martes pasado a la "Orquesta Sinfónica de El Grullo, Jalisco": https://youtu.be/YcFkSvb34UA
Beautiful Girls reading this, While I seek for a companion for the rest of my days, I remember this cool melody of Classic Rock: https://youtu.be/20qVro3bcJI , while I work on the literary page of the classes given by J. J. Arreola (here below, in English for you!). Beautiful woman, please, feel yourself with confidence to communicate with me, Thanks! Fernando. Bellas Lectoras, Mientras busco compañera para el resto de mis días, recuerdo esta bella melodía de Rock Clásico mientras trabajo en la página literaria de las clases recibidas de J. J. Arreola (aquí abajo). Mujer hermosa, ¡siéntete con confianza para comunicarte conmigo, gracias! Fernando.
Updated Sep 27, 2016, 8:32 PM
Y a la porra blanca se le recuerda ponerle "me gusta" a todas las fotos de Adriana (darle tiempo hasta que aparezca la foto sola): https://m.facebook.com/Feria.Zapotlan/photos/a.366969763377510.83696.366344456773374/1109163245824821 , https://m.facebook.com/Feria.Zapotlan/photos/a.366969763377510.83696.366344456773374/1129743763766769 , https://m.facebook.com/Feria.Zapotlan/photos/a.366969763377510.83696.366344456773374/1124371944303951 , https://m.facebook.com/Feria.Zapotlan/photos/a.366969763377510.83696.366344456773374/1113367282071084 , https://m.facebook.com/Feria.Zapotlan/photos/a.366969763377510.83696.366344456773374/1106677506073395 , https://m.facebook.com/Feria.Zapotlan/photos/a.1106682502739562.1073741856.366344456773374/1106682556072890 Gracias.
Updated Sep 25, 2016, 2:08 PM
Aquí estoy leyendo un libro escrito por el fundador de eHarmony antes de eso, en aquel tiempo recomendado e impreso por 'Focus on the Family', a mis espaldas se encuentra la bella Adriiana Ramirez, de Zapotlán el Grande, Jalsico, MX. Atte., Fernando.
De las melodías que me gustan, aparte de "Gracias a Dios" (más abajo), compuestas por el fallecido compositor y cantante mexicano Juan Gabriel (de sus últimas), es la que canta con Laura Pausini, "Abrázame": https://youtu.be/meMIJGfx-no
Updated Sep 4, 2016, 10:29 PM
Aquí está el 'Eclesiastés' del hebreo: https://youtu.be/4qCfu6l01jc (o Koheleth en hebreo, "Convocador" en español), que se leía durante los siete días de la "Fiesta de los Tabernáculos", escrito por Salomón, y conteniendo una maravillosa 'Estructura Fractal' inspirada por 'El Gran Elohim': "El Dios que con sus Huestes en Justicia Controla al Universo": En este libro, entre muchas otras cosas, se observa claramente que en realidad la palabra para referirse a Dios como "El Creador" es otra palabra hebrea bien definida (presente en Ecl. 12:1): "Bowreka" (Creador), derivada de la raíz "Bara" (Creó, Gén. 1:1). La otra fiesta que también duraba 7 días y en los cuales también se leía otro libro de Salomón, "El Cantar de los Cantares", era la "Fiesta de los Panes Sin Levadura" o "Pascua": https://youtu.be/z2oJxAGeAyM, mientras que en el "Día de Pentecostés" se leía el libro de "Rut", la Tatarabuela de Salomón: https://youtu.be/zee-VkOV8_s ¡Qué gran privilegio para el hombre más sabio que existió en el Antiguo Testamento, Salomón, el haber estado involucrado de una forma u otra en los escritos importantes de las tres fiestas obligatorias para todo varón hebreo! Y de ninguna manera fue perfecto sino que cayó en errores muy graves, pero a pesar de eso, ¡nunca perdió su conexión con Dios! ("nunca me dejó la Sabiduría", diría él). Alabado sea Dios por la Era de Gracia en la que con mayor razón tenemos el constante acceso a Dios y una mayor sabiduría de la que tuvo Salomón, ¡pues mayor que él es el Cristo que mora en nosotros! Tan sólo platiquemos con él, ¡y él mismo nos garantiza que recibiremos!
Aquí mi cabeza, completando la que no se le ve al “Hombre de Fuego” :) Recordando: …Mi maestra Emma Godoy tenía destellos de la inspiración divina, y ella nos dijo inspirada que "El Hombre de Fuego" pintado por José Clemente Orozco era profecía pictórica, representando el destino del hombre, quien transformado en espíritu inmortal semejante a Cristo, se convierte en un fuego consumidor que nunca se consume (cuya sombra o "probadita" de ello nos ha sido dada hoy desde las lenguas de fuego sobre los Apóstoles, y aún más atrás, desde aquel árbol que ardía sin consumirse). Ella nos dice, en su intrigante obra: "La Sixtina de América" (refiriéndose al "Hospicio Cabañas", lugar donde Clemente Orozco plasmó la cumbre de su obra maestra) que Dios inspiró a Miguel Ángel a representar el origen del ser humano (en el 'Viejo Continente'), y a Clemente Orozco: ¡El destino final del ser humano! (en el 'Nuevo Continente') Emma también, en uno de sus poemas (sin ser investigadora Bíblica ni nada de eso), dijo inspirada que el ministerio completo de Jesús, ¡había durado 70 semanas! Ella dice, en su "Poema del Vencido y Poema del Glorioso", parte 2: "Siembras tu eternidad en setenta semanas de martirio..." (y de inmediato termina: "...para volcar después mis ojos grandes en la faz del Altísimo"). Por nuestra parte, nosotros aprendemos desde la profecía de Dn. 9:24, que: "Setenta semanas están determinadas... para... ungir al Santo de los santos"; los que según nuestros estudios, transcurren desde su bautizo en el Jordán hasta que él envía espíritu santo en el día de Pentecostés a sus 12 Apóstoles, que constituyen, junto con todo el Cuerpo de Cristo que sigue en construcción: ¡"el Santo de los santos"!; es decir: !El lugar santísimo!): https://youtu.be/MFDueUuA9ps + https://youtu.be/934ps7kMBHA + https://youtu.be/sH0Ds-djk1E
Fernando Castro-Chavez wrote on Eduardo Azuri Miranda's timeline.
Felicidades ahora y siempre!!!
Amadas Santas y Santos, Ésta es mi lectura del libro de Rut del Hebreo, libro que se leía el día de Pentecostés, dedicada a aquella que será mi mujer, sea quien esta fuere: https://youtu.be/zee-VkOV8_s [Y el que se leía en la Pascua: https://youtu.be/zee-VkOV8_s] En Cristo, Su Fer.
Fernando Castro-Chavez wrote on Jessica Ramírez Anaya's timeline.
Felicidades Biotecnológicas!!!
Ésta es otra de esas hermosas historias que atesoro en el corazón: Mi hermana mayor se fue a un retiro de fin de semana cuando estaba en Primero de Secundaria en el "Instituto de la Vera Cruz". Regresando, ese mismo domingo por la noche, me dijo algo así como: "Jesús dio su vida por ti, para que tú puedas ser salvo para siempre al aceptarlo como tu Señor, al aceptar el sacrificio que él hizo por ti y para ti". Y desde ese momento, a mis nueve años de edad, acepté a Jesús como el Señor de mi vida y como el substituto por mis faltas, ¡y nada ni nadie han podido, ni podrán, apartarme de él, ni de ésta profunda convicción que llevo en el corazón! Y gracias a Dios, las que fueran sus más íntimas amigas desde ese entonces, ¡son mis amigas también!, y me cuidan como cuando niño, aún deseándome lo mejor de lo mejor, ¡y la mejor mujer para mí también!; ¡Gracias de corazón doy a Dios, por las valiosas vidas de Lety y de Gaby!. ¡En Cristo, les Amo!
Fernando Castro-Chavez added a new photo to a timeline.
Jul 25, 2016, 9:49 AM
Fernando Castro-Chavez added a new photo to a timeline.
Jul 24, 2016, 11:27 AM
Santos Benditos, Aquí estamos en mi viaje a Guadalajara compartiendo las maravillas de Dios con nuestro amado hermano en Cristo Estéfano y familia, Alicia y Christopher, esperábamos a dos jóvenes, ¡que llegaron hasta otro día por la gracia Divina! Con ellos compartimos todo lo que Dios nos inspiró y se fueron muy bendecidos (seguimos orando, y yo en lenguas, por Elder Uribe, de Cancún y Elder Gámez de San Luis Potosí), ¡alabado seas Dios! En ese Cristo que nos Consuela, Fernando!
Para mi Amada: Ahora, el nuevo "Cantar de los Cantares del Hebreo": https://youtu.be/z2oJxAGeAyM Aquí con su parte clave tomada del hebreo. Con Todo el Amor, Fernando.
Para mi amada, hoy fui a la Biblioteca Pública del Estado de Jalisco "Juan José Arreola", frente al CUCEA, buscando en su hemeroteca algunos de mis antiguos artículos perdidos... Te ama, Fernando.
Y aquí estamos, Estéfano y yo, a la entrada de la Biblioteca del Centro Universitario (C. U.) de la Universidad Autónoma de Guadalajara (U.A.G.), donde se encuentra una pareja de Mamuts excavados en Jalisco. Platicábamos el fin de semana, de cómo la segunda glaciación, que fue parcial, en tiempos del diluvio de Noé, arrasó con los grandes mamíferos de todo el mundo; para ver mi estudio Bíblico acerca de esto, favor de dirigirse a, "Las Aguas Arriba ' 2": https://youtu.be/VMzndWIMLD8
En blanca flor, cual Jazmín la juventud a mis 17, Chinchachoma me dedicó éstas palabras en la Biblia Nácar de mi hermana mayor; desde entonces, tal ha sido la dedicación principal de mi vida, independientemente de denominación religiosa alguna: "Que la Palabra de Dios sea tu Luz, y tu Fernando, Luz de la Palabra." Alejandro García-Durán.
Santos Amados, ..."Y como decíamos ayer" *, Mateo, el Apóstol y Evangelista, escribe de una forma temática que de ninguna manera es cronológica, como sí lo son Lucas y Juan, lo que hace que muchos de sus pasajes sean mal entendidos si no se aprecian desde esta perspectiva temática. Como se ve en el gráfico, aún los que elaboran interlineales "críticos" (aunque a su favor diré que aparece "encorchetada"), la versión Reina Valera, y aún la King James inglesa, al no entender este aspecto, han agregado deliberadamente una frase que no se encuentra en los textos más antiguos (los que iremos viendo poco a poco), y que lo único que hace es confundir a aquellos que buscamos exactitud matemática en la precisión cronológica de las Escrituras (aquí se puede apreciar claramente que las versiones cristianas, tanto en español como en inglés, no se pusieron de acuerdo en ese agregado falso y "abominable", ya que una lo pone al final de un versículo (la RV), y la otra al principio del siguiente (la KJV), cuando en realidad, ¡no aparece por ningún lado en los textos "originales"!); curiosamente, hay versiones católicas que no agregan esa frase ajena a las Escrituras, aún cuando tampoco entienden lo que leen... Porque, básicamente, la escena que vemos en Mt. 28:9-10, sucedió en la noche en que comenzaba el segundo día de trabajo de Jesús (que para nosotros seguía siendo domingo), ¡cuando por primera vez se les presenta a sus Apóstoles (exceptuando Tomás, quien estaba ausente), y a discípulos, y a discípulas suyos, los cuales todos se encontraban a puertas cerradas por miedo a los judeanos! * Glosando al valiente, al menos por un tiempo, traductor temprano al español del libro del "Cantar de los Cantares", y de "Job", entre otros, directamente del hebreo... ¿Quién fue?... En El Cristo Vivo y Amado, Fernando.
Updated Jul 6, 2016, 10:13 AM
Amados, ¡Gracias a las oraciones, al apoyo espiritual, y hasta financiero de mis muy amados santos, con eso me ha sido posible continuar con mis investigaciones Bíblicas!, ¡muchas gracias amados de Dios y de Cristo por su gran apoyo! Y gracias al valioso alumno y a su novia por su tiempo que compartimos hoy, y por su gran corazón para con Dios, oro por ustedes, y doy gracias por orar por mí por esa íntima necesidad del corazón que los más cercanos conocen. En Cristo, Fernando. P.D. Aquí les presento, para servirles, mi primera versión cronológica de la Resurrección de Jesús y algunos eventos relacionados. Poco a poco las exploraremos de una por una (y más) de los interlineales más antiguos. Y de Nuevo, ¡Muchas Gracias!
Amados, Hoy me gozo, y quisiera celebrar una vez más con ustedes la bendita resurrección de nuestro amado Señor Jesucristo, esta vez mediante la historia de las especias que nunca se usaron, lo cual corrobora por su cuenta el hecho de que Jesús estuvo muerto tres días y tres noches para rescatarnos de la muerte: http://fdocc.ucoz.com/3/fdocc_especias.pdf; tomado del inglés: http://tinyurl.com/spices-ladies, Fernando. P.D.: http://fdocc.ucoz.com/3/espeias_amen.jpg.
Updated Jun 16, 2016, 10:01 PM
Otra gran verdad que me maravilló, es que nuestro Señor Jesús estuvo muerto en la tumba de José durante 3 días y 3 noches; es decir: ¡72 horas!, las 3 noches que fueron del 14, 15 y 16 de Nisán del año 28 D.C., que en nuestro calendario cayeron un miércoles, jueves y viernes; y los 3 días fueron el del 15, 16 y 17, correspondientes al jueves, viernes y sábado, levantándolo Dios al atardecer del Sabbat semanal. Escritura clave en este estudio es lo que dijo Jesús en Mt. 12:40, donde Cristo repite 2 veces lo de los 3 días y las 3 noches, dejándolo establecido, ¡al tiempo que valida la historia de Jonás como algo que realmente sucedió! Tan cierto fue eso como la sepultura de Jesús durante 72 horas, dejando completamente estableciendo (24 x 3) ¡que Jesús estuvo totalmente muerto!; esto aún sorprende a los cristianos que la escuchan por primera vez (como a mi amada hermana en Cristo de Tuxpan). Fragmento del Codex Vaticanus (S. IV): http://www.csntm.org/manuscript/View/GA_03?OSIS=Matt.12.40
¡mmm... desde que llegué a Zapotlán he estado comiendo deliciosas 'pitayas' heladas!: http://tinyurl.com/mmm-pitayas
Otra tremenda verdad poco conocida por la cristiandad en general son los textos antiguos de Jn. 19:18, y que al juntar los cuatro Evangelios, ¡vemos sorprendidos que fueron cuatro los crucificados con Jesús! La importancia de ello es que los cuatro Evangelios son como cuatro piezas complementarias de un mural hermoso, en los que se ve el énfasis dado por cada uno: Por ejemplo en Mateo, los dos ladrones (duo lestai) que él describe, ambos blasfemaban en contra Jesús, y ambos fueron llevados a última hora, aún después de que los soldados ya se habían repartido la túnica de Jesús y habían puesto su letrero "acusatorio" en tres idiomas, mientras que antes, junto con Jesús, Lucas describe que habían llegado al Calvario dos malhechores (duo kakourgoi), de los cuales uno habló en contra de Jesús, mientras que el otro le tapó la boca a éste al decir que ellos sí merecían dicho castigo pero no Jesús, y al decirle a Jesús que se acordara de él: "cuando VINIERA en gloria en su Reino", a lo que Jesús le respondió al estilo de un Rey: En verdad te digo hoy: Estarás conmigo en el Paraíso, que por el contexto es sobre la tierra, restaurado, en los Mil Años del reinado de Jesucristo. Juan corrobora ésto al decir que había: ¡dos crucificados a cada lado de Jesús! Lo que se observa en el interlineal que he preparado para ustedes, de nuevo tomado del Codex Vaticanus del S. IV: http://www.csntm.org/manuscript/View/GA_03?OSIS=John.19.18 (más evidencia dada también por Juan y tomada de este MS UNCIAL se verá más adelante...)
¡Nuestros muertos duermen!: https://web.archive.org/web/20091027120153/http://www.geocities.com/fdocc3/duermen.htm; recordando que Jesús mismo estuvo bien muerto durante 72 horas (del atardecer del miércoles 14 al atardecer del sábado 17 de Nisan del año 28 D.C.); y por ejemplo, vemos que el malhechor (el "Kakourgoi" en gr.) que creyó, le dice a Jesús: "Señor, acuérdate de mí cuando vengas con gloria en tu reino"; es decir, ¡él ya estaba creyendo en el futuro regreso triunfal de Jesús! Y es en ese contexto que Jesús le responde: "¡En verdad ("¡Amén!", en gr.) te digo hoy!: ¡Estarás conmigo en el Paraíso!"; Jesús enfatizó su respuesta en ese instante (el "¡hoy!"), diciéndole que a futuro, en su retorno a la tierra, ¡también el malhechor que creyó en eso volvería a vivir!, ¡y que estaría con Jesús en el Paraíso sobre esta tierra (el reino de los mil años de Jesús)! He elaborado un breve interlineal que anexo para que vean la directa equivalencia con el español del griego UNCIAL ("untado", todo en mayúsculas sin signos de puntuación ni espacios) del S. IV, el "Codex Vaticanus": http://www.csntm.org/manuscript/View/GA_03?OSIS=Luke.23.43 (Ver dos evidencias adicionales más abajo, del S. III, el Papiro Bodmer; del S. V, el Codex Washingtonianus; del S. IX, el Leccionario de Atenas...
Abriendo mi baúl de los recuerdos, me encuentro con que uno de mis más gratos es cuando tuve el privilegio de estar en el apartamento de Fede, leyendo la Biblia y alabando a Dios; todo comenzó cuando en Guadalajara leí un artículo en el que su amada hermana menciona lo que aquí yo anexo (Siglo 21, Suplemento Minerva, 21, Sept., 1996, págs. 10-11)...
Entre las dedicatorias que aún conservo, tengo la del artista fotógrafo y arquitecto Armando Salas Portugal: http://www.lopezquiroga.com/artistas/detalle/18 Su bella obra se puede ver en imágenes: http://tinyurl.com/armandosalas
Pues como Instagram no me dejó seguir subiendo fotos, y a mí me urge, hoy aquí estoy usando la de "Picasa", en donde anexé fotos en blanco y negro, como esta de mi mamita a sus 18 años (hay que picarle al siguiente nexo, y de allí buscar el índice, donde dice "Home"): http://tinyurl.com/cristybella
Updated May 17, 2016, 4:39 PM
Comencé a subir las fotos de mi familia al "Instagram" para evitar que se pierdan; la primera me la dió el tío @[100006724698094:2048:Valentin Chavez] y es del primo Rafa, su hijo, y yo: https://www.instagram.com/p/BFZVs1lBua8 Nota: Y yo quería subir más de 100 por día, pero así, ¿se te congela la cuenta para siempre?... ¡Oh! Mi dirección allí es: https://www.instagram.com/fdocc2 (Bah, he removido la mayoría de mis fotos de allí y las he metido a mi Picasa, ver otro nexo).
Updated May 15, 2016, 6:15 PM
Aquí, entrevistaba yo a Juan José Arreola, celebridad fallecida de Ciudad Guzmán, para un ensayo colectivo de mi prepa acerca de: "La Juventud"; él me decía que su obra y su vida eran críticas, con tintes de sarcasmo, como se observa en su curioso "Baby H.P." que leíamos en la escuela: http://www.ciudadseva.com/textos/cuentos/esp/arreola/baby_h_p.htm Y luego, con mi primo Chentito (Vicente Castro), subíamos a su casa para platicar con él cuando lo veíamos pasar en su Vespa, con su capa de héroe, con su cachucha, sus botitas y sus lentes (siendo él todo un excéntrico): https://en.wikipedia.org/wiki/Juan_José_Arreola
Fernando with mother and high-school "good-father" (https://es.wikipedia.org/wiki/Guillermo_Cañedo_de_la_Bárcena)
Fernando Castro-Chavez updated his status.
Nota Breve: Por razones de familia no he podido conectarme por el Skype, por lo pronto puedo continuar mediante el FB y el YT.
En búsqueda de toda mi familia espiritual, ayer estuve en una reunión juvenil de los Ministerios "La Llave"; con mis palabras, el mensaje de la profeta fue: Que al confesar a Jesús como Señor, ¡recibimos todo el poder de Dios!; pero, ¡que a nosotros mismos nos toca el buscar establecer una viva y vital relación con él!; y de hecho, ¡ésto también él busca con fervor!, ¡ésto es lo que Ambos nos ruegan que les demos! (Lo que me recuerda que Dios mismo anda buscando verdaderos adoradores en espíritu; ¡es decir, Dios sigue buscando a aquellos que Le adoremos y que Le hablemos en lenguas! Y así mismo nos responde Él mediante Sus Secretos Divinos, ¡mientras nosotros mismos hablamos en lenguas!) Tuve la dicha de acompañar a Jazmiin Rodriguez. [La foto es del mensaje de recibimiento que pegaron a mi camisa, y ahora recuerdo que me lo pegaron a la altura de mi corazón, del tamaño del mismo; es decir, ¡¡¡Dear Ladies, Cristo es el único que posee la llave de mi corazón!!!].
Lo más reciente que he leído: https://youtu.be/zxMCZ_sp_Kk Acerca de: "Idolatrías Comunes entre las Ruinas de los Pueblos Mesoamericanos y las de Canaán". En la foto, prehispánicos "ángeles caídos" descendiendo ("Baales") sobre mujeres. Izq.: uno que desciende, de esculturas de Tulum, Cobá, etc. Der.: De “México a Través de los Siglos”, Vol. 1, de Riva-Palacio.
Doña Lania nos recomienda los siguientes videos matemáticos (otra forma en la que Nuestro Gran Magnífico Dios también habla): https://youtu.be/jej8qlzlAGw
Updated May 1, 2016, 9:49 PM
And also today, in Mire's house we saw the next Christian movie: http://www.flywheelthemovie.com/ (some of its clips at the right side)
Esto escrito, en grande, lo anunciaron los Jóvenes del Ministerio IDP ("Soy Joven") hoy durante la tade hasta casi el anochecer (cada que se ponía en rojo el semáforo). Los felicité, ¡y pude percibir el poder, gozo y paz del don de espíritu santo dentro de todos ellos!
Algunas de las Cosas de Roma y sus Costumbres - Parte 1 https://youtu.be/WdavMVgZS2w
Algunas de las Cosas de Roma y sus Costumbres - Parte 2
https://youtu.be/oZLGGueAd0M
Algunas de las Cosas de Roma y sus Costumbres - Parte 2
https://youtu.be/oZLGGueAd0M
Fernando Castro-Chavez updated his status.
Mi Amada en Cristo Breege Corrigan comparte lo que aquí traduzco: "¿Y entonces, en qué consiste una conexión viviente con Dios? Simplemente, en mantener las líneas de comunicación abiertas entre los dos. Significa el moverte en tus diarias actividades de forma tal que siempre estés disponible para escuchar lo que procede del cielo. Piensa tan sólo, ¡que la clave verdadera a una consistente victoria es una cosa solamente! No tienes porqué memorizar una lista de cosas por hacer y cosas por no hacer. Todo lo que necesitas hacer es el mantener ese flujo de continuo contacto con Dios. ¡Él está continuamente hablando Sus Palabras a nuestros corazones mediante Su don de espíritu santo que mora dentro nuestro!"
Santos, Ayer fui a ver la película "Dios NO está Muerto, Parte Dos": https://youtu.be/vtgzVw_7Y50 Este "Trailer" tiene incluso mejores subtítulos, ¡"Dios no está muerto, está vivo en tu interior, rugiendo como un león"! (por "The Newsboys"); fui con Iván, Luis, Jesús, Salvador y Paula. Se las recomiendo. En Jesucristo, Fernando.
Updated Apr 25, 2016, 10:03 AM
Fernando Castro-Chavez updated his status.
El estudio básico del Gran Secreto revelado al Cuerpo de Cristo desde los días del Apóstol Pablo: https://youtu.be/iVrsaFieIaI
Y ahora, un poco de lo que escuchaba en mi adolescencia: https://youtu.be/4Ym6MOaKbsw
Updated Apr 19, 2016, 8:21 PM
Santos, Con Iván hemos estado estudiando aceca del tremendo compartir en inglés desde Singapur de nuestro hermano en Cristo Joseph Prince: https://www.youtube.com/user/JosephPrinceOnline Dios nos inspira el video a seleccionar, y yo lo traduzco. En Cristo, Fernando.
Updated Apr 18, 2016, 10:49 AM
Jesús nos dice: "¡Vayan y hagan discípulos por todas las naciones en mi nombre!" Mt. 28:19: https://youtu.be/dlr5hG0WYU8
Agradezco al Dios Altísimo la publicación de mi más reciente artículo: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4828969 Aquí presento una foto del mismo (en la que la portada de mi página se inspira):
Santos Poderosos, ¡¡¡Nosotros Tenemos Lo que Detiene y Al que Detiene al Anticristo Sobre La Tierra!!! https://youtu.be/eDybPUjba9Q ¡¡¡Y ya podemos arrojar una y otra vez a sus huestes ahora mismo!!! Les aman Fernando e Iván, sus incansables colaboradores en Cristo!
Updated Apr 7, 2016, 2:58 PM
Aventándome en el puente de "El Zaetal", Actopan, Veracruz... (Gracias a Cecy por tomar el video)... |
Aventándome en el puente de "El Zaetal", Actopan, Veracruz... (Gracias a Cecy por tomar el video)...
Éste es el capítulo que escribí para el libro sobre la Obesidad: https://books.google.com.mx/books?id=7holCgAAQBAJ&pg=PA39
Amados colegas Cristo y Dios, En agradecimiento a mis santos amados de habla hispana que están orando por mí y velando por mi bien, aquí les he leído algo tremendo de lo que tuvo que pasar Casiodoro de Reina, para pder ver impresa su traducción de la Biblia al español, y verla llegando a almas hambrientas, semejantes a ese oso que puso en la portada; por lo que su primera edición de 1569 fue conocida como "La Biblia del Oso": https://youtu.be/a0BrqrPRp8k ¡Orando por la santa comunión de los santos! En Ustedes, Fernando.
Amados Santos, Los que anhelen compartir 'La Santa Comunión', será el próximo viernes (03/25/2016) a las 7:30 PM (hora de Houston, TX); y como siempre, la dirigirá Cristo, coordinará nuestra amada @[1090311196:2048:Leyda Hediger]; ella les va a llamar, por si desean estar presentes la contacten, y le den su clave y lugar de Skype; @[100000111834717:2048:Alejandro Heredia] compartirá la esencia de este memorial tan bello, en que el pan es para nuestra sanidad física, y la copa para el perdón de todos nuestros pecados recientes (¡muchas gracias por tu perdón!). En Cristo, Fernando. @[1412271270:2048:Joni Bijou] nos ha dado el nexo a información preliminar: Texto: http://tinyurl.com/cuerpoysangre, y Audio: http://tinyurl.com/cuerpoysangre-a [1 Cor. 10:16-17,21,31; 11:18-30,33]: http://fdocc.ucoz.com/biblia/7/46_011.htm Nota Nueva: Aquellos que lo deseen, por favor tengan a la mano pan y algo para beber.
Updated Mar 18, 2016, 9:21 PM
Amados Santos, Aquí presento esto que he leído de:
Jesucristo, el Sumo Sacerdote en un Año Bisiesto Hebreo:
https://www.youtube.com/watch?v=sH0Ds-djk1E
http://fdocc.ucoz.com/3/07_jc_sumo_sac_heb_adar2a.pdf y
https://www.youtube.com/watch?v=934ps7kMBHA
http://fdocc.ucoz.com/3/07_jc_sumo_sac_heb_adar2b.pdf
Continuando lo que comenzamos a ver el año pasado:
Jesucristo, el Apóstol en un Año Sabático:
https://www.youtube.com/watch?v=MFDueUuA9ps
http://fdocc.ucoz.com/2/01_cronos_cristos.pdf
Esperando les bendiga como lo hizo conmigo.
En Cristo, Fernando. P.D. Y si alguien anhela compartir de Dios acerca de la Santa Comunión hoy viernes, 3-18-2016 por la noche (7:30PM hora de Houston, por Skype), adelante!
Jesucristo, el Sumo Sacerdote en un Año Bisiesto Hebreo:
https://www.youtube.com/watch?v=sH0Ds-djk1E
http://fdocc.ucoz.com/3/07_jc_sumo_sac_heb_adar2a.pdf y
https://www.youtube.com/watch?v=934ps7kMBHA
http://fdocc.ucoz.com/3/07_jc_sumo_sac_heb_adar2b.pdf
Continuando lo que comenzamos a ver el año pasado:
Jesucristo, el Apóstol en un Año Sabático:
https://www.youtube.com/watch?v=MFDueUuA9ps
http://fdocc.ucoz.com/2/01_cronos_cristos.pdf
Esperando les bendiga como lo hizo conmigo.
En Cristo, Fernando. P.D. Y si alguien anhela compartir de Dios acerca de la Santa Comunión hoy viernes, 3-18-2016 por la noche (7:30PM hora de Houston, por Skype), adelante!
Updated Mar 18, 2016, 11:16 AM
Fernando Castro-Chavez updated his status.
Santos Amados que caminan con un corazón puro, De nuevo se ha suscitado con un creyente el divisivo tema de que: ¿Es acaso "lenguas con interpretación" solamente para adoración y alabanza?; es decir, que ¿sólo y siempre es en segunda persona de nuestra parte para con Dios? El problema espiritual aquí es que seres humanos muy inteligentes, con sus muy limitados cerebros, en comparación con Dios mismo, quien nos dio Su don, están decidiendo limitar el ilimitado alcance de las lenguas espirituales que han recibido. Es bastante triste que tal pensar, es uno que ha demostrado ser muy divisivo, uno que está limitando a Dios en las vidas y en las familias, tanto físicas como espirituales, de los que piensan de tal manera, y que están dividiendo al Cuerpo de Cristo. Como ya lo hemos visto antes, el primer uso del hablar en lenguas se encuentra en Isaías (y recordemos que el primer uso de algo en la Biblia es vital, ya que determina la pauta central para el resto de sus usos); esta profecía de Isaías para los días del Apocalipsis (semejante a la de Joel que Pedro recitó y expandió en el día de Pentecostés), fue también adaptada para "la Era de Gracia" que ahora vivimos por nuestro amado hermano Pablo, y en ella Dios nos está diciendo: "En otras lenguas y con otros labios Yo Hablaré, más ni aún así me oirán" (y esto es lo que éstos creyentes renacidos, cómo el Israel apóstata del Apocalipsis, están dejando de escuchar hoy mismo al creer que ya lo saben todo; es decir, que están rechazando el escuchar a Dios mismo comunicándose con ellos mediante el "hablar en lenguas con interpretación"); y aún hay más: ¡Cristo mismo habla con nosotros mediante nuestro hablar en lenguas!, ya que: ¡"El Espíritu es el Señor y donde está el Espíritu, allí hay libertad"!; y también, hablando acerca de Cristo siendo llamado "el Espíritu" (que fuera algo descubierto por Schoenheit mismo): "Y el Espíritu nos ayuda en nuestra debilidad, ya que ni siquiera sabemos cómo es que hemos de pedir correctamente, pero el Espíritu mismo intercede por nosotros con gemidos indecibles" (es decir, mediante sus lenguas dirigidas a nosotros, que son su respuesta a nuestras peticiones, cuando nosotros hablamos en lenguas). Es decir, que cuando oramos en espíritu (y "orar" siempre es una conversación de ida y vuelta), ellos, ¡tanto Dios como Cristo Jesús mismo, éstos dos directamente nos responden revelándonos Sus divinos secretos! Y hay mucho más que decir acerca de esto, cómo que el "glorificar a Dios" y el "magnificar a Dios" de las lenguas del principio de la Era de Gracia fueron algo específico que ni siquiera necesitó de interpretación, ya que fue entendido por las múltiples naciones que estaban allí representadas en esos lugares (¡la reversión espiritual divina de lo sucedido en Babel!); pero mi más ferviente oración siempre es que Dios mismo revele directamente a los que desean las verdaderas respuestas de Dios mismo acerca de estas cosas, por el bien y por la salud de las familias de los creyentes, tanto físicas como espirituales, ¡y especialmente por nuestros bebés! En Cristo, Fernando.
Santos del Cielo, Estudiando las Escrituras: De que "espíritu santo" es un don y no una "persona" independiente de nuestro Amado Padre Celestial:
Parte 1:
https://www.youtube.com/watch?v=jOYHwRRgqmE
Parte 2:
https://www.youtube.com/watch?v=bX4jq41dNYQ
Parte 3:
https://www.youtube.com/watch?v=iNzilDVILiY
Parte 4:
https://www.youtube.com/watch?v=WlGpYal-Hgk
Gracias por su perdón, amor y comprensión, por su andar en un amor incondicional como el que Jesús nos enseñó! Les ama en Cristo, Fernando.
Parte 1:
https://www.youtube.com/watch?v=jOYHwRRgqmE
Parte 2:
https://www.youtube.com/watch?v=bX4jq41dNYQ
Parte 3:
https://www.youtube.com/watch?v=iNzilDVILiY
Parte 4:
https://www.youtube.com/watch?v=WlGpYal-Hgk
Gracias por su perdón, amor y comprensión, por su andar en un amor incondicional como el que Jesús nos enseñó! Les ama en Cristo, Fernando.
Updated Mar 4, 2016, 11:08 PM
Santos Incomparables, Es con gran satisfacción para mí el anunciar que este Viernes (4 de marzo del 2016) a las 7:30 PM hora de Houston, Texas, nos vamos a reunir mediante el Skype (mi cuenta es fdocc2, desde Houston) con nuestro amado hermano que trabaja poderosamente para Cristo: Sangat Bains con Richard Small, quienes van a compartirnos lo que Dios está depositando en sus corazones. ¡Allí nos vemos! En Cristo, Fernando. P.D. Los que quieran seguir el evento fuera del aire, lo pueden escuchar en: https://www.youtube.com/c/catadoresdelapalabra1
Amados Santos, Ésta es mi presentación acerca de la Biblia y la Genética: https://youtu.be/k1BUw5U80h8 Las maravillas de Dios se reflejan en la compatibilidad de organismos, en la belleza de las diferencias entre hombre y mujer, su prohibición de entremezclar diferentes tipos genéticos (min), y la preciosa concepción de Jesucristo con los genes perfectos dominantes formados por Dios (incluyendo al cromosoma Y), para cubrir a los genes imperfectos recesivos presentes en el óvulo de María, profetizando molecularmente la misión futura de nuestro salvador! En Cristo, Fernando.
Updated Feb 29, 2016, 1:38 PM
Santos del Cielo, Esto que nos compartió Tom Darragh lo ha leído nuestra amada hermana Claudia Juárez Garbalena: https://www.youtube.com/watch?v=QEn9dqvDSSw Tom dice: "Es muy importante mirar a Dios, tener nuestros ojos mirando hacia Él. La Escritura nos dice que Dios va a acercarse a todos aquellos que se acercan a Él, ¿qué es lo que significa cuando dice que Él se va a acercar a nosotros?, eso significa que ahora tenemos todo Su poder a nuestra disposición, significa que Él realmente responde a nuestras oraciones y que Sus respuestas vienen rápido. Es realmente muy importante para nosotros que nos demos tiempo para platicar con Él. Es muy semejante a las relaciones humanas en la tierra. Cuando tú hablas con tus amigos o con tus parientes, tú estás al día con ellos, tú tienes familiaridad con lo que ellos tienen en sus vidas, lo que está atravesando por sus cabezas; por eso, es muy fácil el saber qué esperar de ellos. Lo mismo es con Dios, Él es como un amigo, es como un pariente muy cercano de hecho ¡Él es nuestro Padre!"
Updated Feb 26, 2016, 8:05 PM
Fernando Castro-Chavez updated his status.
Amados santos, por razones de fuerza mayor, la reunión con Sal Arico se ha suspendido, pero nuestra reunión sigue en pie. Va a ser por el Skype a las 6:30 PM como estaba acordado y no será grabada en el YouTube. DIOS LES BENDIGA!!!" Fernando y Claudia.
Santos Preciosos, Éstas son las primeras composiciones que escuché de Sal Arico hace muchos años: https://youtu.be/ULb_oFejouI (Ilustradas con mis fotos). ¡Alabado Dios Quien Permite Éstas Cosas! En el Cristo vivo que nos dirige, Fernando.
Updated Feb 26, 2016, 8:35 AM
Agradezco a mis amados santos por sus oraciones incondicionales, lo que ha hecho posible el presentar la segunda parte de mi estudio "...Y los ángeles de abajo", relacionada con el origen de los Neandertales y seres semejantes según la Biblia: https://youtu.be/cBpVuTgrOdA Este servicio es en Amor al Cuerpo de Cristo, cumpliendo fielmente con la función para la que he sido colocado en él por Cristo. ¡Qué nadie imponga a otro hermano cosa alguna sino el amarnos en Cristo los unos a los otros! Y eso de "en Cristo", es bajo su guía divina, ayudándonos unos a otros, y no señoreándonos unos de otros. Fernando. P.D. Y desde luego, es un tema para audiencias adultas.
Updated Feb 25, 2016, 2:18 PM
Para el próximo viernes (26 de Febrero del 2016 a las 6:30 PM tiempo de Houston, Texas); tendremos el honor de escuchar en vivo una reunión musical de Sal Arico y de los santos con él, ¡alabando a Dios! Su reciente, "God is on our Side": https://www.youtube.com/watch?v=s24G0jOWwe8 "¡Dios pelea nuestras batallas!, ¡abre nuestros ojos para ver nuestro ejército espiritual!, ¡y nos da la victoria final en Cristo! ¡"Ni pelea ni batalla puede jamás ser más fuerte que Él, ya que es Cristo quien reina dentro nuestro"!" Novedad: Aparentemente, la primera parte se escuchará solamente por el YouTube ya que nos añadiremos al grupo de Sal que incluye a creyentes que hablan inglés: https://www.youtube.com/c/catadoresdelapalabra1 (¡Dios, que todo funcione bien, que nuestros amados santos se conecten checando que su audio funcione bien, y que apaguen sus micrófonos! Porque entonces, al final parece que será posible conectarse en vivo por el Skype para interactuar con nuestro amado hermano Sal)
Updated Feb 19, 2016, 9:35 PM
Recordando a los nuevos santos que acaban de aceptar a Cristo a que si lo desean se conecten con nosotros hoy viernes 19 de febrero a las 7 de la tarde por el Skype (fdocc2, Houston, TX), para que con confianza comienzen a manifestar ese tremendo poder espiritual que ya llevan por dentro. Lo voy a poner dentro del grupo "El Cristo Sin Barreras", nos vemos en una hora!
Fernando Castro-Chavez updated his status.
Santos Muy Amados, A solicitud de Ivan Colorado, mañana viernes (Feb./19/2016) tenemos reunión mediante el Skype (7:00 PM, tiempo de Houston, si desean estar, para que lo soliciten, si son nuevos, busquen mi cuenta: fdocc2, Houston, TX) esta reunión es principalmente para que los nuevos santos desarrollen confianza en su andar con Cristo, para que pregunten, participen, y para la mutua edificación del Cuerpo de Cristo!!! El director de esta reunión es Cristo mismo! En su magnífico nombre, Fernando.
¡Tremendas cosas están sucediendo mediante aquellos que realmente creen que tenemos el santo espíritu para poder hacer lo que Cristo hizo, y más! https://youtu.be/i510m9wjBAw
Updated Feb 18, 2016, 10:53 AM
This is my presentation on how I do it, in response to dear Ashley and to dear Jeremiah, and many that may benefit from it: https://youtu.be/pAioCelJRQE
Updated Feb 16, 2016, 7:03 PM
Hoy (2/12/16) en la noche, 7:50 PM desde Houston por YouTube comparto mi último estudio en vivo, acerca de el Arca de Noé; los que deseen estar desde las 7:30 PM, y posteriormente para la sobremesa, búsquenme en el Skype: fdocc2, Houston, TX (Fernando Castro), hay solamente 25 lugares dando preferencia a los nuevos (la regla de Iván). Tenemos la bendición de contar con la presencia de nuestro amado hermano en Cristo Tom Darragh quien va a dirigir a los santos lo que Dios deposite en su corazón! (Yo traduzco). YouTube: https://www.youtube.com/c/catadoresdelapalabra1
You tagged Santos Macedonio Mis Ay
Santos Amados, Las maravillas del saber de Dios, fragmentos del Arca de Noé siguen en existencia hasta el día de hoy; es notable el ver que dos reductos del cataclismo anterior (o era glacial primera, total), que destruyó a los dinosaurios, fueron solicitados por Dios a Noé como evidencia profética: 1) Madera Petrificada y 2) Betún de Petróleo! Profética para este segundo cataclismo (o era glacial segunda, parcial) que destruyó a los grandes mamíferos. Oh riquezas de la sabiduría Divina! Esto lo veremos con mayor claridad mañana! En Cristo, Fernando.
La evidencia científica que demuestra que el Monte Everest estaba presente en los días del diluvio de Noé es la gran cantidad de sedimentos marinos en su cima; mientras que el Monte Ararat (en singular) no existía en ese entonces, siendo de emergencia reciente, y por tanto careciendo de sedimentos marinos. La Biblia dice que el Arca de Noé se asentó en los Montes de Ararat (en plural). Esto lo veremos este viernes en nuestro estudio (YouTube: https://www.youtube.com/c/CatadoresDeLaPalabra1, 7:50 PM).
Santos Amados, Este viernes, con la ayuda de Dios, vamos a ver la segunda parte de las "Aguas de Arriba", acerca del diluvio de Noé y el más probable lugar en donde aún se encuentran los restos de esa arca... comenzamos a las 7:50 PM, hora de Houston, TX por el YouTube: https://www.youtube.com/c/catadoresdelapalabra1 (como Santa Claudia sabiamente nos sugiriera desde el principio), y desde las 7:30 PM y después por el Skype para la sobremesa (para aquellos en los que el Señor ponga en su corazón el acompañarnos), allá nos vemos!!! En Cristo, Fernando.
Santos, Nuestra amada hermana en Cristo, Claudia Juárez Garbalena nos comparte lo siguiente: https://www.youtube.com/watch?v=U5DEfLeUx9w (Coherederos de la Gracia de la Vida) Otras lecturas de Claudia: https://www.youtube.com/channel/UCCbLi9UnKI1lZUEiVOGvFqA Cuyas recientes entradas incluyen:
Cinco palabras para vivir a través de ellas: "La batalla es del Señor".
Un hombre en quien está el espíritu de Dios.
La finalidad del Evangelio.
Jesucristo: La Palabra de Dios Encarnada.
¿Ves esta mujer? (Lucas 7:44).
Liberación de sus prisiones.
Sobre el Libro de Cantares.
Sobre el Salmo 23.
Un Reposo para el Pueblo de Dios.
Cristo en ti, la Tierra Prometida (1 y 2).
Los Beneficios de Dios. Breve estudio de Salmos 103, etc…
Gracias Claudia por tu labor incondicional de AMOR! En Cristo, Fernando.
Cinco palabras para vivir a través de ellas: "La batalla es del Señor".
Un hombre en quien está el espíritu de Dios.
La finalidad del Evangelio.
Jesucristo: La Palabra de Dios Encarnada.
¿Ves esta mujer? (Lucas 7:44).
Liberación de sus prisiones.
Sobre el Libro de Cantares.
Sobre el Salmo 23.
Un Reposo para el Pueblo de Dios.
Cristo en ti, la Tierra Prometida (1 y 2).
Los Beneficios de Dios. Breve estudio de Salmos 103, etc…
Gracias Claudia por tu labor incondicional de AMOR! En Cristo, Fernando.
Dear Saints, This was my last presentation on "Word & Science": 'Activating the Gifts of Service!': https://www.youtube.com/watch?v=3J9RClh7cKI and its slides: http://fdocc.ucoz.com/3/01_activating_5_gifts_of_service_brief.pdf God bless y'all! In Christ, Fernando.
Updated Feb 6, 2016, 10:10 PM
Muy Amados Santos, Ayer leí la tercera parte de mi estudio acerca del ir por nuestra libre voluntad, una vez renacidos: "Activando los Cinco Dones de Servicio - Parte 3"
https://www.youtube.com/watch?v=ZjQSklK0JyE"
Las dos partes anteriores se encuentran en:
Activando los Cinco Dones de Servicio - Parte 1 [En vivo con los santos]
https://www.youtube.com/watch?v=-hwLsUQVO8w
Activando los Cinco Dones de Servicio - Parte 2
https://www.youtube.com/watch?v=orrZPMigoQI
Espero les bendiga para que gozen conmigo del crecimiento que da Dios, una vez activados estos Cinco Dones de Servicio en cada grupo Cristiano de hoy, con Cristo como la cabeza que nos guía. Dejemos que Dios y Cristo nos impresionen con su trabajo una vez que nosotros decidimos activar en nuestras reuniones lo que ellos ya nos han dado, lo que le costó la vida a Jesús, y lo que él derramó desde Pentecostés! En Cristo, Fernando!
https://www.youtube.com/watch?v=ZjQSklK0JyE"
Las dos partes anteriores se encuentran en:
Activando los Cinco Dones de Servicio - Parte 1 [En vivo con los santos]
https://www.youtube.com/watch?v=-hwLsUQVO8w
Activando los Cinco Dones de Servicio - Parte 2
https://www.youtube.com/watch?v=orrZPMigoQI
Espero les bendiga para que gozen conmigo del crecimiento que da Dios, una vez activados estos Cinco Dones de Servicio en cada grupo Cristiano de hoy, con Cristo como la cabeza que nos guía. Dejemos que Dios y Cristo nos impresionen con su trabajo una vez que nosotros decidimos activar en nuestras reuniones lo que ellos ya nos han dado, lo que le costó la vida a Jesús, y lo que él derramó desde Pentecostés! En Cristo, Fernando!
So, tonight we´ll see that using “Anatomical Mnemonics”, the inner man, which is Christ in us, which is the anointing of the gift of holy spirit within ourselves, has a perfect correspondence to the members of the outer man, and each born again believer that accepted Jesus as Living Lord has them all! And is already enabled to receive messages of wisdom, knowledge, to have the faith of Christ, to produce gifts of healing, workings of miracles, to prophecy, to have discernings (yes the original is plural) of spirits, to speak in tongues and to interpret those tongues in the Ekklesia. In Christ, Fernando.
Fernando Castro-Chavez wrote on Gustavo Enrique Barrera Campaña's timeline.
Gustavo Enrique, qué gusto, Dios te bendice abundantemente! Qué bueno que podemos comunicarnos también por este medio! Saludos y Salud! En Cristo, Fernando Castro-Chavez.
You tagged Stacy Hart
Bajo la iniciativa de Ivan Colorado, hoy (Feb. 5, 2015) nos vamos a reunir mediante el Skype a las 7:00 PM, hora de Houston (chequen sus horarios), y por el YouTube. Tom West vertirá su corazón, con Stacy Hart traduciéndo y también compartiendo. Si se quieren anexar por el Skype, busquen mi cuenta, es fdocc2 de Houston, TX. Soy Fernando Castro en Skype. Allá nos vemos!!! Dirección YT: https://www.youtube.com/c/catadoresdelapalabra1
God gave to us the natural five senses to grow healthily physically, mentally and spiritually. Will He do less for His beloved Body of Christ on earth? No! He gave to it the Five Spiritual Senses: Five Gifts of Service so He could provide the GROWTH! I ask: Is your fellowship dying? A man sits in front of you all the time and you are only warming his seats? Are all the believers with big needs, sick, dying, lonely, jobless, filled with sadness and frustration? Is your leader never telling you to go and ask directly to God? Does he deny you the right to share a Study that God inspired you to present? Has he only called you once in 16 years, and that only to condemn you but never to ask if you need something or to pray with you for something? Are the believers "second rate" when compared to your own earthly family? Does your leader pride himself that he´s serving God for more than 30 years and don´t even notice or care that there is not real growth in his group, not in numbers, or not even spiritually for the ones already “trapped by him”? Response: This is because that body of believers has not claimed what already belongs to them: The Five Gifts of Service! Given already (in past tense) by God since Pentecost!!! But you are here, asking God, how to surrender the lead of your group to Christ, the head, the legitimate owner and leader of those saints! God, I pray that every reader reading this, really wanting to do Your Will, repents of his carnally guided fellowship group and delivers to Christ the full control of the meetings and not to his feeble and biased human imagination! Really ask God how to surrender the lead of your group to Chris (his saints are not your property!). In Christ, Amen.
Saints, Further evidence that a bad translation has made the five gifts of service to look as something sporadic, occasional or rare, when in reality, as we have seen earlier, it's something fully ingrained in each born again believer from the beginning! Here the "ous" has been mistranslated as "some" when most of the times it's translated as "whom", which is a match with the previous Scriptures that we have considered (see below). We'll see this and more at my house this Saturday at Seven PM. And for the far away saints: https://www.youtube.com/c/catadoresdelapalabra1 In Christ, Fernando!
Like Paul could have said it: To me, the most insignificant and wretched sinner, God decided to show through His Scriptures that the Five Gifts of Service are already contained within "every spiritual blessing" that God deposited within us since the day of our new birth! Bad translations have blurred this simple reality; here, preconceived ideas translated the Greek "tous" as "some", when most of the 740 times it is translated: "THE", indicating that all born again believers, willing to serve for the equipping of his fellow saints, and for the building-up of the Body of Christ, can serve in love as needed; it says in Greek that: 'he (Christ) gave the assuredly apostles, the also prophets, the also evangelists, the also shepherds and teachers', and we see in individual committed believers here and then, all of these functions as needed! We saw them all in Jesus, in Paul, in Peter, etc. It´s even absurd to think that for so many years there is not a single group of Christians deliberately activating all of them gifts!, but crafty is the Adversary... to whom we are defeating today in the Body of Christ all over the world, raising up as a sleeping giant to destroy every work of evil!!! In Christ, Fernando.
Activating the Five Gifts of SERVICE: Apostles, Prophets, Evangelists, Pastors (Shepherds) and Teachers. Like the Five Human Senses, these allow the Body of Christ to Grow Healthy with the Growth Given by God. Each Born Again Believer has them all spiritually weaved within himself! Now we just need to have the Earnest Desire to use them in love for the growth of the believers within the Body of Christ! We'll see the introduction to this practical topic highly misunderstood this Saturday, Feb., 6th, 2016, at our home.
Santos, en esta Escritura vemos que Dios nos da una revelación directa, según las necesidades y circunstancias particulares (es ese “heteros”), del grupo o del individuo a quien servimos de corazón (y me doy cuenta que a veces hay que ser "duros" aunque nos duela)! Los que SIRVEN, siendo ese el verdadero sentido del “Diakonos”, mal traducido: “Ministro”, palabra que propicia envanecimientos sin fin, ya que dicen: Viene el “Ministro”, o peor aún: viene el “Reverendo” (y encuéntrenme esa palabrita en la Biblia en su contexto exacto por favor), y todos le hacen caravanas y “le besan los pies”, ¡¡¡cuando en realidad, él debería de ser el que se los lavara a todos!!! Por eso, la Biblia dice que es: ¡Ya viene el SERVIDOR! Por ejemplo, mi vida hoy se está recuperando de estar en una parálisis espiritual, y en ruinas profundas debido a que en el pasado, a aquellos líderes carnales que consulté, lo que ellos me habían enseñado era acudir a ellos, y/o ir a la Biblia, sin jamás enseñarme a acudir PRIMERO y DIRECTAMENTE y con todo mi corazón: ¡A la verdadera Fuente Viviente Quien es DIOS! ¡Ellos mismos no esperan las respuestas DIRECTAS en su corazón, depositadas allí mismo por Cristo! ¿Es mi culpa el haber confiado en ellos? Pero, ¡no más! Exhorto ahora a que cada SERVIDOR vaya directamente a Cristo a preguntarle cómo puede REALMENTE bendecir al Cuerpo de Cristo, del que ellos forman parte en sus áreas de influencia. En Cristo, Fernando.
Es importante cuanto antes activar los Cinco Dones de Ministerio para el sano crecimiento del Cuerpo de Cristo, para evitar cosas como que los Judas, Ananías y Safiras de hoy controlen las finanzas que legalmente le corresponden a TODO el Cuerpo de Cristo, y para evitar que lobos rapaces intenten diezmar los corazones de los santos, o que personas se auto-engañen en "visiones" y "profecías" que no aprovechan. Por ejemplo, aquí presento un mensaje que le escribí a un creyente, pero si hubiera un equipo de profetas dentro del Cuerpo, en grupo se diría aún con mayor precisión y amor, ¡como plata refinada siete veces!: “Con humildad recomiendo que tú mismo te presentes con toda humildad y mansedumbre ante los demás. Cualquier luz verdadera que pudiéramos recibir es de lo alto, y ésta nos edifica y nos llena de gozo, y no de confusión. Dios Mismo es el Único que Revela Sus Secretos Divinos a los humildes, y esto está en plural, no solamente a uno sólo, ya que uno sólo pudiera fallar, sino en plural, y nos dice: ¡A Sus Santos Apóstoles y Profetas! ¡No es bueno jactarse de nada! Solamente Dios es quien nos exalta, no nosotros a nosotros mismos, eso cae de peso. En México decimos que: "Cae primero un hablador que un cojo". ¡Hemos aprendido que no importa quien cante, lo importante es que la canción se cante! Esto es como un ejercicio de humildad. Espero que no me tomes a mal lo que te digo, pero en mi espíritu confío en que es por tu bien el decirte que necesitas presentarte con una humildad genuina, y no con altivez para que tus palabras sean recibidas por los santos. Si me equivoco, por favor házmelo saber. En Cristo, Fernando.”
Otros versículos mal entendidos (1 Cor. 12:29-30) han evitado la plena manifestación de los Cinco Dones de Ministerio para el grupo Cristiano, y ¡aún han evitado la plena manifestación del Don de espíritu santo para el individuo Cristiano! La respuesta es afirmativa para las últimas 4 preguntas que Pablo hace, ¡y también lo es para sus primeras 3 preguntas! El griego usa exactamente la misma forma en ambos casos. Una traducción más precisa es: "¿No son todos apóstoles?, ¿no son todos profetas?, ¿no son todos maestros?, ¿no pueden todos hacer obras de milagros?, ¿no tienen todos dones de sanaciones?, ¿no pueden todos hablar en lenguas?, ¿no pueden todos interpretar?" El caso que Pablo establece es que a pesar de que todos pueden hacerlo todo, que la forma de hacerlo ha de ser en orden, y, luego nos dice que: ¡en AMOR! ¿Acaso los santos siguen en espera erróneamente de que Cristo mismo descienda y les apunte con su dedo que es lo que ya son? ¡No, no es así como funciona! Jesús ya nos lo dio TODO a partir de Pentecostés: ¡TODA la plenitud de TODA potencia espiritual!, lo que incluye a ¡TODOS los Dones de Ministerio dentro de cada creyente! Lo curioso es que aunque el interlineal en inglés está correcto y el interlineal en español está erróneo, ni en grupos Cristianos de habla inglesa o hispana se ha desatado deliberadamente el uso los Cinco Dones de Ministerio por parte del Cuerpo de Cristo, los santos en grupo son los responsables de su activación, ¡Jesús ya se los ha dado a cada uno! De nuevo culpo a los líderes por no motivar a los santos de sus grupos a "anhelar manifestar ardientemente todo asunto espiritual", ¡que precisamente es la frase que sigue y con la que comienza el capítulo 14! ¡Ya es tiempo de que esto cambie con su creyente corazón de servicio, por favor, oh santos! ¡Yo no me quiero morir sin haber gozado de todo esto por culpa de los malsanos líderes! ¡Por favor!!! Interlineal Español: http://tinyurl.com/nt-interlin-lacueva e Inglés: http://biblehub.com/interlinear/1_corinthians/12.htm
La foto de abajo es evidencia adicional de que una mala traducción limita la plenitud de la verdad escrita, en este caso, es la palabra griega "tous", que se ha mal traducido como "algunos" y "otros" en relación con los Dones de Ministerio, pero que la gran mayoría de las 740 veces que aparece se traduce como "LOS", lo que indicaría que todo creyente renacido, según sea necesario, puede ejercer, si tiene en su corazón el servir y no el ser servido, los Cinco Dones de Ministerio que son los Cinco Sentidos del Cuerpo de Cristo! Ninguno de nosotros al nacer carece de ellos, verdad? Y acaso es posible el pensar que Dios ha hecho menos por nosotros, el Cuerpo de Su amado hijo sobre la tierra hoy? Imaginen que absurdo sería pensar que Dios es capaz de rechazarte y de decirte: “Lo siento mucho, tú no puedes usar los Dones de Ministerio, no sirves para ninguno de ellos”! Pues por más raro que parezca, esto es lo que un liderazgo envanecido y egoísta ha estado asumiendo hasta hoy! Malos pastores de las ovejas del Cristo, su tiempo se ha agotado, es tiempo de que el Cuerpo mismo de los creyentes se apodere de los Dones que les pertenecen, sin importar la opinión de líderes vanos!!! [Herramientas en inglés lo demuestran: http://biblehub.com/interlinear/ephesians/4.htm]
Saints, Alert! Today, some wretched soul used the identity of one of my Facebook friends to try to commit a scam against me! As soon as I exposed him (I suppose it's a "him"), he deleted that account, but he had already stolen the picture and the cover image of the person that he was mimicking, and had befriended twice several of the common friends. Be aware of such kind of scam and do not fall for these deceptions (like second accounts from the same person, better ask the person first)! In Christ, Fernando. P.S. In the image here the genuine one is above and the false one after being exposed (and the scammer deleting the account), is below it.
Y Santos muy Amados, ¡Si llevan muchos años bajo un grupo cristiano carente del crecimiento directo que Cristo da, y aquí en los Estados Unidos, ¡aún la mayoría de los líderes, después de más de 30 años de servir, aún se extrañan mucho de que pueden consultar directamente con Cristo, lo que se refleja en grupos sin espíritu que ni crecen, o peor aún, que desaparecen!; por lo que, aún cuando la enseñanza de la Biblia sea correcta allí, los que enseñan, se den cuenta o no, están siendo usados por las astutas estratagemas del Adversario, por sus propias mentes y sus debilidades de vanidad, evitando siempre llegar al centro de nuestra era de gracia: ¡Que cada creyente puede comunicarse directamente con Cristo, la cabeza, de forma tal que cumpla con su función en el Cuerpo de Cristo al usar los Cinco Dones de Ministerio, y el resto de los Dones de Servicio, según Cristo mismo lo guíe, para un verdadero crecimiento conforme a Cristo, y no conforme a líderes plagados de debilidades carnales, y yo me incluyo!
Santos Renacidos: ¿Y cómo proteger a los miembros del maravilloso Cuerpo de Cristo de sus propias debilidades humanas, y esto incluyendo desde luego a TODOS los líderes? Respuesta: ¡Mediante el deliberado uso de los Cinco Dones del Ministerio de Reconciliación!; ¡Conviene que haya grupos de profetas en cada comunidad Cristiana para que digan las cosas tal y como Dios las ve (mirando incluso a los líderes a los ojos)!; ¡Conviene que haya grupos de pastores que cuiden de las necesidades espirituales, emocionales, físicas y materiales de TODOS los creyentes de cada grupo Cristiano y no sólo de los líderes!; ¡Conviene que haya apóstoles que confronten y exhorten a los santos como Pablo en sus Epístolas, e incluso como lo hizo con Pedro, (y no que simplemente le den la espalda a otros)!; ¡Conviene que haya evangelistas que reconcilien, es decir, que conecten directamente a la gente con Dios para que Dios mismo responda a todos!; ¡Conviene que haya maestros que con toda mansedumbre y autoridad presenten las cosas de forma tal que los oyentes abran sus ojos ante la faz de Jesucristo, y no ante malos líderes amadores de sus propios vientres!
Y, Santos muy Amados de toda denominación que aceptan a Jesucristo como su Señor y Salvador Viviente, es decir: Como ¡su único Líder Verdadero!, el descubrir que a nosotros nos toca activar, como grupos del Cuerpo de Cristo, los Cinco Dones del Ministerio de la Reconciliación ¡es algo que proviene directamente de lo Alto, y que ha estado frente a nosotros disponible desde el día de Pentecostés! La arrogancia y vanidad de líderes humanos que anhelan ser el centro y hacerlo todo a "su manera" lo tenía "atorado" hasta hoy, pero gracias al depender directo de Dios en Cristo, ustedes activarán bajo Su guía el poder más enorme que el Universo ha conocido hasta ahora, bajo el consejo de ¡Cristo Jesús, nuestra cabeza única! Fernando. P.D. N.T. Interlineal: http://tinyurl.com/nt-interlin-lacueva
Santos Amados, Hoy llegó mi amigo FB # 3000: "Biblia Santa Valera"!!! A éste y a todos ustedes, santos de todos los colores y sabores, comento con toda humildad y mansedumbre que hoy investigo acerca de la consciente y deliberada activación de los 5 Dones del Ministerio de la Reconciliación por parte de los miembros de cada grupo del Cuerpo de Cristo! Herramientas que uso para capturar lo que dice la Escritura acerca de cada Don de Servicio: http://www.lcoggt.org/Wescott-Hort-Robinson-GreekNT.pdf , https://elmundobiblicodigital.files.wordpress.com/2015/03/252784253-nuevo-testamento-interlineal-griego-espanol-de-francisco-lacueva-barcelona-editorial-clie-1984-version-completa-y-optimizada-pdf.pdf , http://biblehub.com/interlinear/ephesians/4.htm Y, extra, los interlineales del A.T.: https://elmundobiblicodigital.files.wordpress.com/2014/02/a-t-interlineal-hebreo-espac3b1ol-vol-i.pdf , https://elmundobiblicodigital.files.wordpress.com/2014/02/a-t-interlineal-hebreo-espanol-vol-ii-pdf.pdf , https://elmundobiblicodigital.files.wordpress.com/2014/02/a-t-interlineal-hebreo-espanol-vol-iii-pdf.pdf , https://elmundobiblicodigital.files.wordpress.com/2014/02/a-t-interlineal-hebreo-espanol-vol-iv-pdf.pdf Amándoles mucho en Cristo con un Amor Incondicional, Fernando Castro-Chavez!
Fertile Eggs of Axólotl on Sale! http://texasaxolotls.com/ Huevecillos fértiles del Axólotl en venta! Fue mi mascota por 15 años, regenera de forma natural; la nueva variedad fluoresce de verde en la obscuridad; en la Prepa, los colectamos de Pátzcuaro con Azouri, Baruqui, y Torres con su papá, quien nos llevó. Ganamos el segundo lugar del "Método Científico" en la Varonil de la UAG: https://web.archive.org/web/20071212130540/http://www.geocities.com/fcastrocha/regen.htm
Estudiando las Escrituas: Dones de ministerio: Profetas! https://www.youtube.com/watch?v=0pvhM-tKTpo Mi oración en espíritu y entendimiento es que cada coordinador de grupo de creyentes Cristianos estimule el desarrollo de los, ya dados por Cristo, Dones de ministerio para tener un grupo saludable y creciendo con el crecimiento que da Dios: Vista: Apóstoles; Oído: Profetas; Tacto: Evangelistas; Olfato: Pastores; Gusto: Maestros.
Otra transparencia que veremos esta noche acerca de las "Aguas de Arriba", muestra que es maravilloso que en las Escrituras, "los Cielos de los Cielos" corresponden al Espacio Exterior dentro del Universo, pero "las aguas que están por encima de esos Cielos" son las que rodean al Universo entero, formando "El Círculo sobre la Faz del Abismo"; y más allá de todo esto, es a donde nosotros vamos! Oh maravillas de la Sabiduría de Dios! Comenzamos por YT a las 7:50 PM: https://www.youtube.com/c/CatadoresDeLaPalabra1
Amados míos, con la gran alegría de haber podido continuar los estudios acerca de las Escrituras (parte 16), en este caso comenzando con los Dones de ministerio, y de entre ellos, con el de Profecía! Sirviéndoles incondicionalmente en Cristo, Fernando. P.D: El nexo es: Estudiando las Escrituras: Dones de ministerio: Profecía!: https://www.youtube.com/c/catadoresdelapalabra1
Recordando a los santos que lo deseen el acompañarnos el viernes a las 7:50 PM: https://www.youtube.com/c/CatadoresDeLaPalabra1 El tema es "Las Aguas de Arriba", previamente anexado en PDF, una transparencia del mismo se anexa. Los que deseen, o no, estar en el Skype desde las 7:30 PM para asuntos más íntimos y personales del Cuerpo de Cristo y para la sobremesa, por favor, háganmelo saber mandándome en mensaje personal sus datos del Skype. En Cristo, Fernando!
Fernando Castro-Chavez updated his status.
Saints, Today I applied for a job at "LifeWay Christian Resources" (which includes its Christian Bookstore at Katy, TX), and in the last page for my signature I gladly found the statement: "I acknowledge I place my faith in Jesus Christ alone as Savior and Lord for the forgiveness of my sin." And I may say, I'm already working full time for him!; so, I place my faith in him alone to open the wide doors for my income! In him, Fernando.
Y muy amados santos de todos lados; Estamos listos para glorificar a Dios en su maravillosa Creación! Este viernes 8 de enero del 2016, a las 7:50 P.M. hora de Houston, Texas (Central Time), vamos a ver: "Las Aguas de Arriba - 1" Desde: https://www.youtube.com/c/catadoresdelapalabra1 Y manifestando espíritu santo. Aquí están las transparencias: http://fdocc.ucoz.com/2/01.aguas.de.arriba1.pdf Y para aquellos deseosos de oraciones, testimonios, etc., comenzamos desde las 7:30 PM por el Skype, y para la sobremesa después! En Cristo, Fernando!
Updated Jan 2, 2016, 10:37 AM
Dear Saints, This was my last presentation of the year 2015: https://www.youtube.com/watch?v=K3WuklJB4_w Have a great 2016!!! In Christ, Fernando.
Updated Dec 31, 2015, 1:21 AM
Dear Saints, This was my last presentation of the year 2015: https://www.youtube.com/watch?v=K3WuklJB4_w Have a great 2016!!! In Christ, Fernando.
Updated Dec 31, 2015, 1:21 AM
Fernando Castro-Chavez shared a link to the event: Not Event for this Saturday the Second of January 2016!!!
Dear Saints, This is my current recording of my presentation done at the beginning of the month: https://www.youtube.com/watch?v=K3WuklJB4_w and its slides http://fdocc.ucoz.com/3/08_that_s_in_the_bible_2015.pdf And in the "Playlists", under "Word & Science", you can find all my presentations thus far for you to improve and made better! https://www.youtube.com/c/catadoresdelapalabra1 In Christ, Fernando. P.S. In the head picture, a real fireplace in Alamogordo where my wife Tracy is!
Dear Saints, This is my current recording of my presentation done at the beginning of the month: https://www.youtube.com/watch?v=K3WuklJB4_w and its slides http://fdocc.ucoz.com/3/08_that_s_in_the_bible_2015.pdf And in the "Playlists", under "Word & Science", you can find all my presentations thus far for you to improve and made better! https://www.youtube.com/c/catadoresdelapalabra1 In Christ, Fernando. P.S. In the head picture, a real fireplace in Alamogordo where my wife Tracy is!
Updated Dec 30, 2015, 3:27 PM
¡Andad en Amor y seréis sanados! ¡Oh riqueza de la Sabiduría y Presciencia Divinas!: https://www.youtube.com/watch?v=9-EcBMbt9bc El Dios eterno quiso revelar que el conocimiento en amor llega al corazón del creyente ya que por pura gracia divina aprendimos que Jesús nació al principio del año judío, Rosh Hashanah del año 3 A.C., que entonces equivalió a nuestro 11 de septiembre al atardecer; los paganos celebraban el solsticio de Invierno en el día que actualmente se celebra la Navidad, y quienes llegaron en este día de la Navidad fueron los Astrónomos de Persia, cuando Jesús ya tendría unos 15 meses de edad; fue por esto que el malvado Herodes mandó matar a los niños de 2 años para abajo, según él para no errar. En Cristo, Fernando. P.D. Los otros dos estudios relacionados son: https://www.youtube.com/watch?v=oleazr2Javc y https://www.youtube.com/watch?v=Loz0fFZOU2Y&index=22 y https://www.youtube.com/watch?v=MFDueUuA9ps&index=4
Updated Dec 25, 2015, 12:09 PM
A good piano theme: https://www.youtube.com/watch?v=9P4Wkwu1nTo
Updated Dec 23, 2015, 8:42 PM
Further studies of our Great Lord and Savior Jesus Christ!:
Eastern Customs at the Time of Jesus:
https://www.youtube.com/watch?v=IAZt945KHQk
Jesus Christ the Apostle in a Sabbatical Year!
1
https://www.youtube.com/watch?v=DDhC2FnUG04
2
https://www.youtube.com/watch?v=lq-NMESo0fM
3
https://www.youtube.com/watch?v=dJwGIzWssIA
4 - Appendix
https://www.youtube.com/watch?v=Nbem_1Gq26M
The Tabernacle and the Temple:
https://www.youtube.com/watch?v=DB7pZwA0QnQ
Here we learn from its Eastern Customs and Chronology, to the tremendous spiritual place and power that God has given to us today as members of the Body of Christ, the Most Holy Place [The "Naon Hagion"] being built right now by Christ, our head, with our help!!!
Eastern Customs at the Time of Jesus:
https://www.youtube.com/watch?v=IAZt945KHQk
Jesus Christ the Apostle in a Sabbatical Year!
1
https://www.youtube.com/watch?v=DDhC2FnUG04
2
https://www.youtube.com/watch?v=lq-NMESo0fM
3
https://www.youtube.com/watch?v=dJwGIzWssIA
4 - Appendix
https://www.youtube.com/watch?v=Nbem_1Gq26M
The Tabernacle and the Temple:
https://www.youtube.com/watch?v=DB7pZwA0QnQ
Here we learn from its Eastern Customs and Chronology, to the tremendous spiritual place and power that God has given to us today as members of the Body of Christ, the Most Holy Place [The "Naon Hagion"] being built right now by Christ, our head, with our help!!!
Updated Dec 18, 2015, 6:15 PM
El regalo de Jesús, para mis amados amigos de habla hispana! Incluyendo a los nuevos de mi familia espiritual Colombiana y de Ciudad Guzmán!:
https://www.youtube.com/watch?v=9-EcBMbt9bc
The Astronomy of the Birth of Jesus in English (2015):
https://www.youtube.com/watch?v=SzkSJKLyOAU
And as presented live in 2014:
1
https://www.youtube.com/watch?v=XDNtWcmAbAI
2
https://youtu.be/sYNuCvWkCog
3
https://www.youtube.com/watch?v=ZfGUvqW6xzc
4
https://www.youtube.com/watch?v=yr4QLVv7YnA
5
https://youtu.be/_oe1Sl6trw0
https://www.youtube.com/watch?v=9-EcBMbt9bc
The Astronomy of the Birth of Jesus in English (2015):
https://www.youtube.com/watch?v=SzkSJKLyOAU
And as presented live in 2014:
1
https://www.youtube.com/watch?v=XDNtWcmAbAI
2
https://youtu.be/sYNuCvWkCog
3
https://www.youtube.com/watch?v=ZfGUvqW6xzc
4
https://www.youtube.com/watch?v=yr4QLVv7YnA
5
https://youtu.be/_oe1Sl6trw0
Updated Dec 17, 2015, 12:03 PM
Here's my 2015 Year in Review!
Aquí está mi revisión pictórica del año 2015 que termina!
See yours at facebook.com/yearinreview.
Aquí está mi revisión pictórica del año 2015 que termina!
See yours at facebook.com/yearinreview.
Updated Dec 16, 2015, 2:53 PM
The Witness of the Stars:
https://youtu.be/6jqocfGVThw
https://www.youtube.com/watch?v=nOHqt4KGRwU
https://www.youtube.com/watch?v=IZv_LTdiJFs
https://www.youtube.com/watch?v=CiAOEOm2htE
https://www.youtube.com/watch?v=ET_KHliA8_I
https://youtu.be/ZtheK69r13A
Rejoice that your names are written in heaven and that your place is at the right hand of God, where Christ is, above every name that is named!
https://youtu.be/6jqocfGVThw
https://www.youtube.com/watch?v=nOHqt4KGRwU
https://www.youtube.com/watch?v=IZv_LTdiJFs
https://www.youtube.com/watch?v=CiAOEOm2htE
https://www.youtube.com/watch?v=ET_KHliA8_I
https://youtu.be/ZtheK69r13A
Rejoice that your names are written in heaven and that your place is at the right hand of God, where Christ is, above every name that is named!
Updated Dec 16, 2015, 8:40 AM
From finalists of "The Voice" in the U.S.:
Emily Ann Roberts (in a previous show) sings: "In the Garden":
https://www.youtube.com/watch?v=3yYWVizHslY
Jordan Smith sings: "Mary Did You Know":
https://www.youtube.com/watch?v=M7Ux80jK3bI
Barrett Baber sings "Silent Night":
https://www.youtube.com/watch?v=VMqZwgtqpFI
Emily Ann Roberts (in a previous show) sings: "In the Garden":
https://www.youtube.com/watch?v=3yYWVizHslY
Jordan Smith sings: "Mary Did You Know":
https://www.youtube.com/watch?v=M7Ux80jK3bI
Barrett Baber sings "Silent Night":
https://www.youtube.com/watch?v=VMqZwgtqpFI
Updated Dec 15, 2015, 8:18 AM
The Promised Seed in the Constellations!:
https://www.youtube.com/watch?v=fFrPuuzrL7g
https://www.youtube.com/watch?v=RT1JcCJpkiY
https://www.youtube.com/watch?v=cIA_s5cBkJM
https://www.youtube.com/watch?v=7DZBqbThpoE
https://www.youtube.com/watch?v=o19_YrA7Ps8
https://www.youtube.com/watch?v=OdZq1rOH1PI
For my beloved saints in Christ! Fernando.
https://www.youtube.com/watch?v=fFrPuuzrL7g
https://www.youtube.com/watch?v=RT1JcCJpkiY
https://www.youtube.com/watch?v=cIA_s5cBkJM
https://www.youtube.com/watch?v=7DZBqbThpoE
https://www.youtube.com/watch?v=o19_YrA7Ps8
https://www.youtube.com/watch?v=OdZq1rOH1PI
For my beloved saints in Christ! Fernando.
Updated Dec 14, 2015, 1:10 PM
Recordando a los santos amados, como puse antes, que hoy a las 7:30 PM comenzamos nuestra reunión por Skype, que continuamos por YouTube con sobremesa después para manifestar espíritu santo y deleitarnos en Dios! En la foto, la batalla espiritual profetizada en los cielos desde la creación de Adán: Sol y Luna en Virgo (concepción virginal), en donde Venus (Cristo), en conjunción con la Spica (el Renuevo humano), está rodeado por Marte (Miguel) a la izquierda, y por Mercurio (Gabriel) a la derecha; En Aries (el Rey y Cordero de Dios), Júpiter (la Justicia de Dios), al centro del evento de la Espada que Desciende del Cielo (el "pescado" de la izquierda), se clava en el corazón de Cetus (el "hombre" de pecado). Por otro lado e intentando usurpar el poder divino, en Leo (el Rey de Reyes) Neptuno (el "espíritu" del Anticristo), en conjunción con Régulo (el Cetro del Rey), está flanqueado por Urano (el "espíritu" del Falso Profeta) a su izquierda, y Saturno (Satanás) a su derecha!
A petición de muy amados creyentes, ésta es la presentación sobre el "Hablar en Lenguas con Interpretación" que presenté bilingüe el mes pasado pero esta vez solamente en español:
https://www.youtube.com/watch?v=BR01CQNi7jM
Y lo mismo con otra semejante sobre "La manifestación del espíritu":
https://www.youtube.com/watch?v=PC5ebLjSmwE
Temas básicos tales como el ir "Estudiando las Escrituras" se indexan en:
http://fdocc.ucoz.com/index/estudiando_escrituras/0-137
Y otros Estudios Bíblicos (los que están en español están a la derecha) en:
http://fdocc.ucoz.com/index/0-124 En Cristo, Fernando.
https://www.youtube.com/watch?v=BR01CQNi7jM
Y lo mismo con otra semejante sobre "La manifestación del espíritu":
https://www.youtube.com/watch?v=PC5ebLjSmwE
Temas básicos tales como el ir "Estudiando las Escrituras" se indexan en:
http://fdocc.ucoz.com/index/estudiando_escrituras/0-137
Y otros Estudios Bíblicos (los que están en español están a la derecha) en:
http://fdocc.ucoz.com/index/0-124 En Cristo, Fernando.
Dear Saints, Here are two of my favorite studies of last year, for the glory of God!: The Bible and Genetics (2014):
https://www.youtube.com/watch?v=h1h4a1wUuPs
https://www.youtube.com/watch?v=zvbemLfMQv8
https://www.youtube.com/watch?v=ApfSOOU2N3s
https://www.youtube.com/watch?v=SEZDjy9OeXo
https://www.youtube.com/watch?v=YQtkX2pc2Tw
Fall and Restoration (2014):
https://www.youtube.com/watch?v=zQpo7nSkGL8
https://www.youtube.com/watch?v=QiJuhRY34Kw
https://www.youtube.com/watch?v=5yurU6LTSI4
https://www.youtube.com/watch?v=sw8XxeG4mrw
https://youtu.be/6TaS-8Y22As
https://www.youtube.com/watch?v=vd2epmdKmBo
https://www.youtube.com/watch?v=h1h4a1wUuPs
https://www.youtube.com/watch?v=zvbemLfMQv8
https://www.youtube.com/watch?v=ApfSOOU2N3s
https://www.youtube.com/watch?v=SEZDjy9OeXo
https://www.youtube.com/watch?v=YQtkX2pc2Tw
Fall and Restoration (2014):
https://www.youtube.com/watch?v=zQpo7nSkGL8
https://www.youtube.com/watch?v=QiJuhRY34Kw
https://www.youtube.com/watch?v=5yurU6LTSI4
https://www.youtube.com/watch?v=sw8XxeG4mrw
https://youtu.be/6TaS-8Y22As
https://www.youtube.com/watch?v=vd2epmdKmBo
Amados santos, primeramente Dios vamos a ver el tremendo tema de la Simiente Prometida en las Constelaciones para este viernes 11 de diciembre, comenzando a las 7:50 PM: https://www.youtube.com/c/catadoresdelapalabra1 con el ir manifestando espíritu santo después del tema, y con oraciones y salutaciones comenzando desde las 7:30 PM mediante Skype; las transparencias son: http://fdocc.ucoz.com/3/08_simiente_constelaciones.pdf En Cristo, Fernando.
Here we see how Jesus himself is carrying our load today with his declaration that the "eye for an eye" statement is something that "has been said" by somebody but not by God! Jesus puts that statement in the same category of the most erroneous "hate thine enemy"! Contrasting these two with Giving and with Loving!, respectively.
Saints, "Is that in the Bible?" is the title of my presentation for tomorrow at 7:00 PM CT: https://www.youtube.com/c/catadoresdelapalabra1 Every detail of the law was fulfilled in Christ! Even that of the goat for the sacrifice versus the scapegoat ("escape goat", Lev. 16) was consummated in Jesus Christ vs "Jesus Barabbas", the way in which that name appears in the Greek of Mt. 27:17! In Christ, Fernando.
Fernando Castro-Chavez posted in WORD & SCIENCE.
In the next text, I'm using the 20 expressions taken from the Bible that we'll see; can you find them?: "I don’t want my left hand knowing what my right hand is doing! I was living in my ivory tower when suddenly I heard a deceitful one saying something like, he that is not with us is against us, and then he applied an eye for an eye strategy to attack pre-selected targets as his scapegoats, being himself controlled by the worldly “powers that be”; and knowing that the love of money is the root of all evil, one of my studies was to follow the money trail; What I found left me at my wits' end and beside myself, holding my tongue, because I saw the handwriting on the wall and the sign of the times, knowing that if the blind leads the blind, both fall into a ditch. I do not want to be blind in the scientific, political or artistic fields and I do not want to give lip-service to God! So, “physician, heal thyself" was what I did with the help of God, hoping that at least I could escape with the skin of my teeth, wishing to be worth my weight in gold, and that we, all the born again believers, with wisdom, could be the real shinning city upon a hill, so that if we yield up the ghost, we may have the certainty to have made it to the land flowing with milk and honey!" [And in the image, Christopher Plummer as "King Lear", where Shakespeare uses one of 'em! Which one?]
Este es el trabajo de amor de Sangat, transcrito por Élida, traducido y leído por mí: https://youtu.be/qL_zPHbKVnI ¡Qué la visión de ustedes sea aquella que tiene Dios; ya se encuentra en tu nueva naturaleza espiritual el percibirla!
Updated Nov 24, 2015, 12:54 PM
Estoy muy bendecido al bendecir a mis amados creyentes de Chile!!! Comparto algo acerca del cómo de la "Investigación Bíblica", manifestamos espíritu santo, Alfredo nos comparte su poderoso testimonio de la milagrosa recuperación de su hijo después de su accidente en moto en el que los doctores pensaban que ya no viviría, etc.: https://www.youtube.com/watch?v=IR7bzRB-NxY Felicitaciones en su boda de mañana para Eduardo y Lidia!!!
"The unique connections in your brain mean no one like you has ever existed or will ever exist again" = 'Las conexiones únicas en tu cerebro significan que nadie como tú ha existido ni existirá jamás' From: http://video.pbs.org/program/brain-david-eagleman/ [First Part - Whose free viewing expires tomorrow!]
Este fue el compartir de Sangat Bains para aquellos que deseen servir a otros (a los líderes en servicio): https://youtu.be/sOytyvGULOc
Updated Nov 17, 2015, 4:18 PM
Divinos Santos Amados: Es con gran satisfacción que comparto las transparencias de mi presentación de mañana a las 7:50 PM: http://fdocc.ucoz.com/3/PC_b_7_h_e_l_con_interp.pdf Por el YT: https://www.youtube.com/c/CatadoresDeLaPalabra1 Después de esto, Sangat Bains nos comparte de su corazón; los que deseen estar desde antes para oraciones especiales y manifestar, mándenme en mensaje personal su identidad para encontrarlos a través del Skype y anexarlos. En Cristo, Fernando.
En preparación a este viernes que viene (el 13 de Nov. del 2015), en el que tendremos una dulce charla con Sangat Bains, y para más allá, los siguientes episodios de mi ir "Estudiando las Escrituras": https://www.youtube.com/watch?v=3VTJK4aLFcw , https://www.youtube.com/watch?v=pu8Kp9frf1w , y https://www.youtube.com/watch?v=MYjVEw4Ilf0
Updated Nov 9, 2015, 2:27 PM
You tagged Lidia Ruiz Gomez and Alfredo Alexi Palma Becerra
Es gran bendición el poder anunciar que en una semana, el próximo viernes 13 de Noviembre vamos a tener, a petición de los santos de Chile, la grata compañía de nuestro amado Sangat Bains desde la India. Comenzamos a las 7:30 PM con la manifestación de espíritu santo por Skype y por YouTube a las 7:50 PM, comparto el "hablar en lenguas con interpretación" como nos lo enseñan la Biblia y el espíritu que llevamos dentro! Luego, Sangat nos comparte acerca de lo que Dios deposite en su corazón para darnos: https://www.youtube.com/c/CatadoresDeLaPalabra1 (mañana comienzo leyendo allí algo relacionado).
En la visita que hice a la casa-museo familiar de mis papitos, me encontré con esta foto de cuando recibí a Guillermo Cañedo de la Bárcena, quien fuera el padrino de nuestra generación de la Preparatoria de la Escuela Varonil de la Universidad Autónoma de Guadalajara. Abajo pongo el resto de la larga foto para que si alguno de ustedes se reconoce, si quiere y tiene el tiempo, pueda poner su nombre y coordenadas donde se encuentra en la foto (yo estoy con mi saco azul, al mero centro de la primera fila con Guillermo, en paz descanse).
Fernando Castro-Chavez shared a memory.
9 Years Ago
Fernando Castro-Chavez added a new photo.
Nov 4, 2011, 7:09 PM
And Jesus did sow the gift of holy spirit, some seeds fell on good ground; Yahoo! Those kept it with honesty producing spiritual fruit! But, those amongst the rocks had joy for a little while, but as soon as the pressures appeared, those were stronger than their will to grow in the use of holy spirit.
Updated Nov 4, 2015, 9:09 AM
Fernando Castro-Chavez wrote on Elba Vargas's timeline.
Feliz cumpleaños a mi prima tan guapa e inteligente que acabo de conocer!
Below, the opposing person refusing to support my unemployment, who was at the other side of the line [Temp. to be removed upon receiving the results].
Updated Nov 1, 2015, 10:00 PM
A todos los parientes y amigos que les interese, gracias a Dios mi papá salió bien de la http://images.slideplayer.es/1/94423/slides/slide_14.jpg
To all interested relatives and frients, thank God my father came out good of the surgery!
To all interested relatives and frients, thank God my father came out good of the surgery!
Updated Oct 26, 2015, 1:27 PM
Mi amado hermano en Cristo @[100002097835390:2048:Cristobal Capote Pizarro] me preguntó acerca de un estudio sistemático para manifestar la plenitud de Dios, en ésta lista de "Estudiando las Escrituras" se hace este esfuerzo; aquí abajo, y del segmento 10-a en delante comienza la intermedia, aquí en su formato traducido actual: fdocc.ucoz.com/3/1_intermedia.pdf ¡Dios les de direcamente el entendimiento en todo para que manifiesten la plenitud del Poder de Dios en sus vidas hoy mismo! En Cristo, Fernando.
Updated Oct 16, 2015, 10:51 PM
For the hardcore "Bible Researcher", the Strong's Exhaustive Concordance of 1890: https://archive.org/details/exhaustiveconcor1890stro [very big file in all its formats; takes a while to download] Found while searching something for my next presentation! In Christ!
Recordando que mañana viernes 9 de octubre a las 7:50 PM voy a presentar por YouTube: https://www.youtube.com/c/catadoresdelapalabra1 El Testimonio de las Estrellas 2. Estamos profundamente agradecidos con el trabajo de Büllinger y de otros en los que él se basó (Dr. Seiss, Miss Frances Rolleston, etc.), pero, amados míos, no hemos de quedarnos allí, sino que hemos de ir más adelante bajo la guía divina...
Updated Oct 6, 2015, 9:03 AM
Con gusto presento este viernes (9 de oct., 2015) a las 7:50 PM de la noche mi estudio del “Testimonio de las Estrellas 2”: http://fdocc.ucoz.com/3/PC_7_02_testimonio_de_las_estrellas_2015.pdf Se verán 7 Signos del Zodiaco (de Leo a Acuario) según la Biblia. Aparecerá en el canal: https://www.youtube.com/c/catadoresdelapalabra1 (donde queda grabado), y desde antes, por el Skype desde las 7:30 PM para oraciones y manifestar espíritu santo, y después, esta vez para breve sobremesa...
Today at Seven PM the Witness of the Stars 2, here is the set of slides: http://fdocc.ucoz.com/3/WS_3_02_witness_of_the_stars_2015.pdf In the image the superhighway (the Ecliptic of the sun, moon and planets)!
This Saturday (10/03/15), at 7:00 PM, by the sheer grace of God, I'll be sharing at home: "The Witness of the Stars 2", it can be followed online at the site: https://www.youtube.com/c/CatadoresDeLaPalabra1 Ps. 119:89 was found in Houk's class. Our love for God is beyond anything else! Not because of ourselves, but because of Him and only Him!!! One week later, God willing, Friday night (10/09/15) will be presented in Spanish at 7:50 PM, see you here, there, or in the air!!!
A petición de santos hermanos en Cristo como @[1295941374:2048:Claudia Juárez Garbalena] y @[100001586518633:2048:Ramon Segundo Gimenez Adam] entre otros, he dividido mis videos en tres: https://www.youtube.com/channel/UCGgi7H6CT_ALYhT4jHRu_8w/playlists ¡Dios los Bendiga y les ilumine! ¡Ustedes son lo mejor de Dios! Pueden usar, editar y mejorar los originales que he leído de la clase: "Estudiando las Escrituras": Por favor, siéntanse libres de usar esta clase sin fines de lucro (de gracia recibimos): http://fdocc.ucoz.com/clase.zip (1.87 MB)
Updated Sep 30, 2015, 7:39 AM
El índice de estos estudios básicos es: http://fdocc.ucoz.com/index/0-137
"Estudiando las Escrituras"
"Estudiando las Escrituras"
Estos temas completan la clase de "Estudiando las Escrituras":
La Armoniosa Perfección de las Escrituras - Estudio e Investigación 4
https://www.youtube.com/watch?v=r31pKQkLHCw
Estudio e Investigación Bíblica - 5
https://www.youtube.com/watch?v=HViGPE7czRs
GÉNESIS!
https://www.youtube.com/watch?v=6OZXdvFQ5bM
Adán y Eva:
https://www.youtube.com/watch?v=9Dbe3kGYyoY
La Armoniosa Perfección de las Escrituras - Estudio e Investigación 4
https://www.youtube.com/watch?v=r31pKQkLHCw
Estudio e Investigación Bíblica - 5
https://www.youtube.com/watch?v=HViGPE7czRs
GÉNESIS!
https://www.youtube.com/watch?v=6OZXdvFQ5bM
Adán y Eva:
https://www.youtube.com/watch?v=9Dbe3kGYyoY
Continúna el estudio de las Escrituras de la Biblia en el trabajo de nuestro amado hermano en Cristo Houk Hitchcock, aquí traducido al español:
Estudiando Las Escrituras:
https://www.youtube.com/watch?v=vREp2w-7UBM
¡Escudriñad las Escrituras!
https://www.youtube.com/watch?v=y-k55XwXii4
Las Promesas de Dios
Primera Parte
https://www.youtube.com/watch?v=xUCJp_S-7yw
Segunda Parte
https://www.youtube.com/watch?v=xPqFc1Ii3qU
Estudio e Investigación Bíblica
Primera Parte
https://www.youtube.com/watch?v=8u0Wx7B2cTo
Segunda Parte
https://www.youtube.com/watch?v=YWRbVcy3V94
Tercera Parte
https://www.youtube.com/watch?v=cVikPH3s7Y0
Y aún hay más....!!!!
Estudiando Las Escrituras:
https://www.youtube.com/watch?v=vREp2w-7UBM
¡Escudriñad las Escrituras!
https://www.youtube.com/watch?v=y-k55XwXii4
Las Promesas de Dios
Primera Parte
https://www.youtube.com/watch?v=xUCJp_S-7yw
Segunda Parte
https://www.youtube.com/watch?v=xPqFc1Ii3qU
Estudio e Investigación Bíblica
Primera Parte
https://www.youtube.com/watch?v=8u0Wx7B2cTo
Segunda Parte
https://www.youtube.com/watch?v=YWRbVcy3V94
Tercera Parte
https://www.youtube.com/watch?v=cVikPH3s7Y0
Y aún hay más....!!!!
Hoy que tanta falsedad y dolor rondan por el mundo, ¡la luz del Cristo alumbra entendiminetos y sana corazones!:
Jesucristo Nuestro Redentor:
https://www.youtube.com/watch?v=oc7z0rIQ00k
La Concepción de la Simiente Prometida:
https://www.youtube.com/watch?v=VWhwosjrhto
Jesucristo, el Redentor – El Propósito de Jesucristo:
https://www.youtube.com/watch?v=5uJUV3snpEs
Jesucristo Nuestro Redentor:
https://www.youtube.com/watch?v=oc7z0rIQ00k
La Concepción de la Simiente Prometida:
https://www.youtube.com/watch?v=VWhwosjrhto
Jesucristo, el Redentor – El Propósito de Jesucristo:
https://www.youtube.com/watch?v=5uJUV3snpEs
Conforme avanzamos en nuestro andar con Dios, aprendemos lo que tenemos, y ¡entonces comenzamos a usarlo, siriviendo a otros que anhelan conocer y crecer en el Dios verdadero!:
Filiación: Romanos – ¡Nuestra Redención!
https://www.youtube.com/watch?v=HZD5l6ixJoQ
El Ministerio de la Reconciliación
https://www.youtube.com/watch?v=8DYUJgBzbDo
Filiación: Romanos – ¡Nuestra Redención!
https://www.youtube.com/watch?v=HZD5l6ixJoQ
El Ministerio de la Reconciliación
https://www.youtube.com/watch?v=8DYUJgBzbDo
Por la gracia divina, los estudios del poder de Dios hoy, continúan:
La Administración del Secreto Revelado, Administración de la Gracia de Dios:
https://www.youtube.com/watch?v=qTGj2-dyoSI
Caminando en el Nuevo Nacimiento: A) Recibiendo Revelación, B) Renovando la Mente:
https://www.youtube.com/watch?v=Y1sFL66NaEo
La Administración del Secreto Revelado, Administración de la Gracia de Dios:
https://www.youtube.com/watch?v=qTGj2-dyoSI
Caminando en el Nuevo Nacimiento: A) Recibiendo Revelación, B) Renovando la Mente:
https://www.youtube.com/watch?v=Y1sFL66NaEo
Sirviendo incondicionalmente en amor a los santos de habla hispana, usando las tecnologías de hoy para Dios, aquí está mi traducción del final de la clase "Estudiando las Escrituras" que desde Houston preparó Houk Hitchcock, basada en la clase del "Poder Para la Vida Abundante" (con mis observaciones y comentarios):
Manifestando espíritu santo mediante el hablar en lenguas
https://www.youtube.com/watch?v=rA_HA0Aacvc
El Libro de Hechos: Creyentes caminando por el espíritu de Dios
https://www.youtube.com/watch?v=otOgsMUm2zw
Manifestando espíritu santo: La manifestación del espíritu
https://www.youtube.com/watch?v=RxsMABGoelU
Según las fuerzas de Dios en Cristo en mí seguiré presentando el resto, pero me gusta comenzar con impartirles a los creyentes la plenitud del poder del don de espíritu santo desde el principio!!!
En Cristo,
Fernando.
Manifestando espíritu santo mediante el hablar en lenguas
https://www.youtube.com/watch?v=rA_HA0Aacvc
El Libro de Hechos: Creyentes caminando por el espíritu de Dios
https://www.youtube.com/watch?v=otOgsMUm2zw
Manifestando espíritu santo: La manifestación del espíritu
https://www.youtube.com/watch?v=RxsMABGoelU
Según las fuerzas de Dios en Cristo en mí seguiré presentando el resto, pero me gusta comenzar con impartirles a los creyentes la plenitud del poder del don de espíritu santo desde el principio!!!
En Cristo,
Fernando.
Updated Sep 21, 2015, 3:31 PM
Fernando Castro-Chavez updated his status.
Amados Santos, Así de que, perdí mi trabajo desde el 18 de agosto del 2015, después de solicitar un aumento en mi salario, basado en mi reporte anual que después de tres meses y medio nunca fue revisado por la gerente o por el dueño, hoy es el primer día (09/21/2015) que recibo una oferta para trabajar de regreso a mi campo de PhD (ofrecido por el nexo de abajo); se ubica en Cleveland, OH. Ora a Dios para trabajar poderosamente, ¡cómo Él siempre lo hace! Quiero seguir trabajando para Dios, y para Dios solamente! Haciendo mis estudios de la Palabra y la Ciencia en inglés y español, traduciendo al español La Biblia Compañera (The Companion Bible, un trabajo plenamente demandante que aún si lo trabajara de tiempo completo se llevaría al menos unos 25 años), etc... ¡Pero suficiente de hablar acerca de mí! Dios, ¿qué es lo que quieres que el Cuerpo de Tu hijo sobre la tierra continúe haciendo en esta y en toda situación? En Cristo, Fernando.
Dear Saints, So, I lost my job since the 18th of August, 2015, after requesting an increase in my salary, based in my annual report that after three months and a half was never reviewed by the manager or the owner, having all the support of my wife at that time, @[1218645485:2048:Tracy Duncan] (currently ex-wife), today is the first day (09/21/2015) that I receive a job offer to work back in my PhD field (offered by http://sciunite.com/); it's in Cleveland, OH. Pray for GOD to work mightiliy, as He always do! I wish to continue working for God, and for God only! Doing my W&S studies in English and Spanish, translating into Spanish The Companion Bible (a fully demanding job that even if working full time on it it will at least take some 25 years), etc... But enough talking about me! God what do You want the Body of Your son on earth to continue doing in this and in every situation? In Christ, Fernando.
Updated Sep 21, 2015, 3:08 PM
Recientes estudios y lecturas edificantes por Claudia Juárez Garbalena:
https://www.youtube.com/channel/UCCbLi9UnKI1lZUEiVOGvFqA
1.
“OLOR FRAGANTE, SACRIFICIO ACEPTO, AGRADABLE A DIOS” UN BREVE ESTUDIO SOBRE LAS OFRENDAS.
2.
POR LAS LLAGAS DE CRISTO FUIMOS CURADOS. PRIMERA PARTE
3.
POR LAS LLAGAS DE CRISTO FUIMOS CURADOS. SEGUNDA PARTE.
4.
POR LAS LLAGAS DE CRISTO FUIMOS CURADOS TERCERA PARTE
5.
EN SU BONDAD. De Michelle Perry.
6.
¡LA PARÁBOLA DEL PADRE INCREÍBLE! Un Padre Como Ningún Otro. Por Wayne Jacobsen
7.
EPÍSTOLA A LOS FILIPENSES
8.
LA FORMA DE VIVIR - Por Wayne Jacobsen.
9.
EL LLAMADO DEL PASTOR (JESUCRISTO). En palabras de Wayne Jacobsen.
https://www.youtube.com/channel/UCCbLi9UnKI1lZUEiVOGvFqA
1.
“OLOR FRAGANTE, SACRIFICIO ACEPTO, AGRADABLE A DIOS” UN BREVE ESTUDIO SOBRE LAS OFRENDAS.
2.
POR LAS LLAGAS DE CRISTO FUIMOS CURADOS. PRIMERA PARTE
3.
POR LAS LLAGAS DE CRISTO FUIMOS CURADOS. SEGUNDA PARTE.
4.
POR LAS LLAGAS DE CRISTO FUIMOS CURADOS TERCERA PARTE
5.
EN SU BONDAD. De Michelle Perry.
6.
¡LA PARÁBOLA DEL PADRE INCREÍBLE! Un Padre Como Ningún Otro. Por Wayne Jacobsen
7.
EPÍSTOLA A LOS FILIPENSES
8.
LA FORMA DE VIVIR - Por Wayne Jacobsen.
9.
EL LLAMADO DEL PASTOR (JESUCRISTO). En palabras de Wayne Jacobsen.
Updated Sep 18, 2015, 8:24 AM
Mi muy valioso y estimado ex-alumno, el Dr. @[1603471017:2048:Everardo Lopez Padilla], me hizo recordar algunas de las cosas que enseñaba cuando daba clases de Biología Molecular a los Doctores en el C.U.C. de Puerto Vallarta, lo que he presentado en inglés también por acá en mi casa en Houston. Espero a su debido tiempo poder traducirlo y presentarlo también en español (favor de picarle al nexo de aquí abajo, en PDF): http://fdocc.ucoz.com/2/10_bio.pdf
Updated Sep 15, 2015, 9:19 AM
Fernando Castro-Chavez shared a link to the event: WORD AND SCIENCE.
Today Saturday 09/05/15 at 7:00 PM we'll study the astounding 'Astronomy of the Birth of Jesus', also possible to be seen at: https://www.youtube.com/c/CatadoresDeLaPalabra1 (live and afterwards); and its slides: http://fdocc.ucoz.com/2/03_star_bethlehem_1_2015.pdf (the same info. will be shared in Spanish next Friday 11 at 7:50 PM) See ya!!!
Today Saturday 09/05/15 at 7:00 PM we'll study the astounding 'Astronomy of the Birth of Jesus', also possible to be seen at: https://www.youtube.com/c/CatadoresDeLaPalabra1 (live and afterwards); and its slides: http://fdocc.ucoz.com/2/03_star_bethlehem_1_2015.pdf (the same info. will be shared in Spanish next Friday 11 at 7:50 PM) See ya!!!
Updated Sep 5, 2015, 11:03 AM
Fernando Castro-Chavez wrote on Rosa de Niño's timeline.
Felicidades!!! Gracias por tus oraciones que siempre son aroma agradable a Dios. Saludos a la familia y que Dios siga abriendo puertas!
Our dear sister in Christ @[690447370:2048:Ashley Oldmixon] shares with us the next amazing study related to the future days of "The Thousand Years" (The Millenium) of the Kingdom of our Lord Jesus on earth! Also thanks to @[100001044585850:2048:Charis Knights] (who originally posted it) and to @[100006113955157:2048:Cha Bean], for liking the post! Certainly, we'll include this important information in a future "Hope" study! Keep your Hope high!!! He is Coming!!!
Updated Aug 26, 2015, 2:41 PM
Y uno más relacionado con el orden tanto cronológico como divino de las Epístolas del Apóstol Pablo, un clásico para nosotros, el Cuerpo de Cristo: 1) las que enseñan, principalmente a los gentiles: Rom. (a creer), Ef. (a amar), 1 y 2 Tes. (a esperar); 2) las que reprenden: 1 y 2 Cor. (por no creer), Fil. (por no amar), y 3) las que corrigen: Gál. (a creer de nuevo), Col. (a amar de nuevo), 4) las de líderes: 1 y 2 Tim., Tito, Filem. y 5) la que enseña, reprende y corrige a los judíos: Hebreos: http://fdocc.ucoz.com/biblia/ewb/192.htm Con todo el amor en Cristo, Fernando.
Updated Aug 25, 2015, 7:20 PM
Fernando Castro-Chavez posted in WORD AND SCIENCE.
The first Saturday of September at Seven, this time, we'll continue keeping alive the ancient knowledge of the prophetical Astronomy of the Birth of Jesus, our dear Lord and Savior! [In the photo we see Jupiter aligned with Venus, the key planets of Jesus].
Para los amados santos de habla hispana, este es el más reciente Apéndice (el 47) que he traducido, mostrando la asombrosa continuidad en las Escrituras del Antiguo Testamento, en este caso cuando el "Libro de la Ley" se menciona, desde el Éx. hasta Malaq., lo cual se opone claramente a las opiniones de los incrédulos: http://fdocc.ucoz.com/biblia/ewb/047.htm
Updated Aug 24, 2015, 3:58 PM
Next is an awesome video shared by my brother in Christ Robert Mitchell Jr .: http://youtu.be/sn7YQOzNuSc In it you will see how Bryan Enderle, at U. C. Davis, shows that the more we know about physics, the more we see the evidence of a very intelligent Creator behind it all! He presents the evidence that shows that light is beyond and above time, with the experiment done in the 70's showing that time moved slightly slower within an airplane when compared with time on the land, this is the relativity of time.
Updated Aug 20, 2015, 10:28 PM
El siguiente es el audio de una presentación de mi estimado sobrino Roy Gtz. Castro: https://soundcloud.com/inteligencia-movimiento/sue-os-realidad-mtro-roy
Updated Aug 16, 2015, 5:37 PM
You tagged Clau JGarb
@[1295941374:2048:Claudia Juárez Garbalena] nos comparte las siguientes lecturas:
1.
EL LLAMADO DEL PASTOR (JESUCRISTO). En palabras de Wayne Jacobsen.
https://www.youtube.com/watch?v=S__Q8A65KWY
2.
PORQUE DONDE ESTE VUESTRO TESORO, AHÍ ESTARÁ VUESTRO CORAZÓN (Mateo 6:21).
https://www.youtube.com/watch?v=-YVq-rC9HFA
3.
LA AUTORIDAD DEL CREYENTE. Capítulos 6,7,8. Por: Kenneth E. Hagin.
https://www.youtube.com/watch?v=YBsO59hpIbQ
Ver en su sitio el resto de éste, así como otros de gran importancia: https://www.youtube.com/channel/UCCbLi9UnKI1lZUEiVOGvFqA (Como el primero relacionado con la vida de George Müller, un gran creyente quien nunca le pidió nada a nadie y siempre tuvo de Dios lo que necesitó)!!!
En Cristo,
Fernando.
1.
EL LLAMADO DEL PASTOR (JESUCRISTO). En palabras de Wayne Jacobsen.
https://www.youtube.com/watch?v=S__Q8A65KWY
2.
PORQUE DONDE ESTE VUESTRO TESORO, AHÍ ESTARÁ VUESTRO CORAZÓN (Mateo 6:21).
https://www.youtube.com/watch?v=-YVq-rC9HFA
3.
LA AUTORIDAD DEL CREYENTE. Capítulos 6,7,8. Por: Kenneth E. Hagin.
https://www.youtube.com/watch?v=YBsO59hpIbQ
Ver en su sitio el resto de éste, así como otros de gran importancia: https://www.youtube.com/channel/UCCbLi9UnKI1lZUEiVOGvFqA (Como el primero relacionado con la vida de George Müller, un gran creyente quien nunca le pidió nada a nadie y siempre tuvo de Dios lo que necesitó)!!!
En Cristo,
Fernando.
Updated Aug 10, 2015, 11:44 AM
Parte del servicio a los santos es el ir ofreciendo, conforme a las fuerzas y recursos que Dios me da, la Biblia interlineal en español con las notas de Bullinger que incluyen sus tremendos Apéndices; aquí van los primeros!: http://fdocc.ucoz.com/biblia/ewb/index.htm
Updated Aug 4, 2015, 5:52 PM
Updated Jul 14, 2015, 4:55 PM
Updated Jun 22, 2015, 10:45 AM
En esta ocasión quisiera compartir con los maravillosos santos de habla hispana esto en español e inglés: https://youtu.be/YczOxgHTTUE que incluye tanto la profecía de Sangat Bains de nuestro poder espiritual manifiesto por el Cuerpo de Cristo en su plenitud antes de nuestra partida, como la tremenda explicación de Ken Petty, basada en el trabajo de George G. Lake (Éx. 14:13-16) acerca de cómo podemos Manifestar con Creencia el poder espiritual que ya tenemos en lugar de escondernos en una religiosa apariencia de oración, cuando acción es lo que más se necesita! En Cristo, Fernando.
Updated Jun 18, 2015, 2:44 PM
En esta ocasión quisiera compartir con los maravillosos santos de habla hispana esto en español e inglés: https://youtu.be/YczOxgHTTUE que incluye tanto la profecía de Sangat Bains de nuestro poder espiritual manifiesto por el Cuerpo de Cristo en su plenitud antes de nuestra partida, como la tremenda explicación de Ken Petty, basada en el trabajo de George G. Lake (Éx. 14:13-16) acerca de cómo podemos Manifestar con Creencia el poder espiritual que ya tenemos en lugar de escondernos en una religiosa apariencia de oración, cuando acción es lo que más se necesita! En Cristo, Fernando.
Updated Jun 17, 2015, 10:27 AM
Fernando Castro-Chavez wrote on George Cumella Jr's timeline.
Happy birthday to my Indian brotha from anotha motha!!!
Fernando Castro-Chavez updated his status.
Key sayings inspired by the movie “God’s Not Dead”. Hey you, Dawkins and Hawkins, if the Universe formed you, then who formed the Universe? In the real world, we never see things jumping into existence out of nothing; however, major animal groups suddenly appeared in the basic forms which they currently hold, not slowly and steadily as Darwin predicted, but instantly! Creation happened because God said it should happen! God tolerates evil in this world on a temporary basis, so that one day, those who choose to love Him freely will dwell with Him forever! Free from the influence of evil, but with their free will intact! Dostoyevsky said that, "if God does not exist, then everything is permissible", and, we must add, then everything is pointless as well! To believe or not to believe, that's the question! Fernando.
Gracias a Fernando Serrao, la presentación del viernes pasado ahora contiene las transparencias sincronizadas a la voz: https://youtu.be/Zqm0-mHWnFs también deseo agradecer a César Cáceres por haber escrito las escrituras para los creyentes en Skype. Y a Claudia Juárez por sugerir y organizar la presentación. Dios los bendiga a todos! En Cristo, Fernando.
Updated Apr 17, 2015, 10:07 PM
Fernando Castro-Chavez is feeling funny.
Gracias a la valiosa sugerencia de mi amada hermana en Cristo Claudia Juárez Garbalena estoy ofreciendo este viernes a las 7:30 P.M. compartir en Español mis estudios Bíblicos a través del Skype, quienquiera que esté interesado, por favor dígame para mandarle un mensaje personal con mis datos del Skype.
This is the harmony of the four Gospels without notes based in the previous link: http://fdocc.ucoz.com/2/harmony_no_notes.pdf [also in docx, same name]
Updated Apr 1, 2015, 12:43 PM
Esta es la armonía de los cuatro Evangelios sin notas basada en el nexo previo: http://fdocc.ucoz.com/2/armonia_sin_notas.pdf [y también en docx, mismo nombre]
Updated Mar 31, 2015, 4:55 PM
Fernando Castro-Chavez posted in WORD & SCIENCE.
Dear Ones, This is the most important Biblical Research that I have ever done in my life! To make sense and to put together all that chronological times of Jesus! After we prayed with the Lindsey Fellowship about this, my wife found this syllabus! http://fdocc.ucoz.com/2/harmony_gospels.pdf (early 1984's) and then I found this amazing updated ones (late 1984's) I had never heard of them!!!: http://tinyurl.com/jcapohp Plus the next information: http://www.askelm.com/star/star020.htm There you have some of its ingredients! In Christ, Fernando.
Fernando Castro-Chavez posted on a timeline.
Mar 9, 2015, 9:25 AM
One Amazing Song, part of the Healing Time with Tim and Rosa Raub!
Updated Mar 4, 2015, 3:43 PM
Fernando Castro-Chavez wrote on Valentin Chavez's timeline.
Orando por su salud! Salud!
Updated Jan 28, 2015, 7:59 AM
Fernando Castro-Chavez shared a link to the event: WORD & SCIENCE.
And this is the preview for those holy saints that may be interested: http://fdocc.ucoz.com/2/09_hope.pdf
And this is the preview for those holy saints that may be interested: http://fdocc.ucoz.com/2/09_hope.pdf
Updated Jan 2, 2015, 7:32 PM
Fernando Castro-Chavez shared moments from his year.
Fernando's Year
January to February
My parents and a cold weather (freezing the surface of the cars).
March to May
Word and Science (W&S) starts: Waters Above, Angels Below.
June to July
W&S: Scorpio = Red Dragon and the Fall and Restoration.
August
W&S: The Astronomy of the Birth of Jesus with sounds of the Shofar.
September to November
W&S: Eastern Customs (the honeymoon of Joseph and Mary) and the Witness of the Stars.
September 29
My beautiful wife Tracy wearing the 10 pieces of silver, similar to Luke 15:8-10.
December
W&S: Common Expressions Found on the Bible [& Walk on Sea (Thalasso) vs Walk on Water (Hydratos)]
Happy New Year!
It's been a great year! Thanks for being a part of it.
warming up motors for our next W&S study! Here, "There is HOPE": https://www.youtube.com/watch?v=9KIhYZQ_ovw
Updated Dec 21, 2014, 12:47 AM
https://www.youtube.com/watch?v=amxE80Zj1Ys (this link works, the immediate one below don't) Your 10 votes for Craig are still open (12/08/2014): http://www.nbc.com/the-voice/vote 'You are surrendering all to God in the prime of your career', or something like that was Pharrell Williams' comment...
Updated Dec 8, 2014, 9:15 PM
Two of our beloved brethren (Gabriel, Dianne, we love you) in their "Word of God" filled trip to India, where miracles and wonders are happening by the tons!!! Like in everywhere else, once believing that the living Christ is our Lord, the same that healed the sick and forgave sinners, so we can do that too, and even more!!!
Updated Nov 19, 2014, 7:53 AM
This is what we all Christians can always do!!! It's not how much we "know", but if we believe, it's how much we love!!! Here, see a walk from a wonderful group of Christians at the "Towne East Square Mall" (Wichita, Kansas), including our visiting brethren from South Africa that we met at "Camp Tejas", Marius and Dewald...
Updated Nov 17, 2014, 8:23 AM
Praised be God that my most recent article, related to the Genetic Code in 3-D and its Yin and Yang components, plus some of the Bible verses that we saw in our "Word and Science" series, is now available at the NIH's PubMed: http://www.ncbi.nlm.nih.gov/pubmed/25340175 This is the picture I added in my last comment related to it (also to be found there): http://fdocc.ucoz.com/2/hand_holding_genetic_code.jpg
Updated Oct 28, 2014, 9:08 AM
I was searching for free open source code in C++ and found a good book Online: http://fdocc.ucoz.com/2/chas_germany_1.pdf and http://fdocc.ucoz.com/2/chas_germany_2.pdf Its author loves God: http://www.youtube.com/watch?v=ZITrMZLkIcU (music starts at 0.55 Sec.)
Updated Sep 26, 2014, 5:33 PM
According to Hebrew Chronology (its Calendar), today at sunset the Birth of our Christ happened! http://www.youtube.com/watch?v=53_10GfaN4c
Según la cronología Hebrea (su Calendario), al atardecer del día de hoy nació nuestro Cristo!
Según la cronología Hebrea (su Calendario), al atardecer del día de hoy nació nuestro Cristo!
Updated Sep 24, 2014, 8:05 AM
Fernando Castro-Chavez updated his status.
Algunas 7 cosas que vimos en nuestro Maratón de Investigación Bíblica (por 7 horas)! Incluyen: 1) Los patrones climáticos: Ecl. 1:6 El viento tira hacia el sur, y rodea al norte; va girando de continuo, y a sus giros vuelve el viento de nuevo, 2) Las Corrientes Oceánicas: Sal. 8:8 Las aves de los cielos y los peces del mar; todo cuanto pasa por los senderos del mar, 3) Los géiser al fondo del océano: Job 38:16 ¿Has entrado tú hasta las fuentes del mar, y has andado escudriñando el abismo? , 4) “Existen …más de 24,000 manuscritos antiguos del Nuevo Testamento que pueden ser comparados y usados para reconstruir el texto original” y que “muchos de los Cristianos tempranos y de los Padres de la Iglesia escribieron "más de 36,000 citas de la Biblia …que los estudiosos usan para ayudarse a determinar el texto original..." en segundo lugar la Ilíada por el poeta griega Homero con solamente 643 manuscritos preservados, 5) En Nm. 24:5-7, Balaam predijo que Israel tendría un Rey ... 400 años antes de que Israel tuviera su primer rey — Saúl, 6) En Is. 44:26-45:6, Isaías predijo que Jerusalén y el Templo sería reconstruido por Ciro cuando el Templo aún no había sido destruido! Continuó en pie por más de 100 años después de su profecía, 7) Que las manos y los pies de Jesús serían perforados (Sal. 22:16 — Interesante, ya que la crucifixión aún no se practicaba cuando fue escrito, así de que no había razón conocida para atravesar las manos y los pies en ese entonces)...
Fernando Castro-Chavez shared a link to the event: Bible Research Night # 3.
My wife, Ashley, Annette, etc., are going to be in the "Keepers of the House" event organized by Kristen Logsdon. My wife is going to be teaching the Eastern dance of the "Belly Dancing". Meanwhile, my older sister Patty confirmed that she is coming from San Antonio to be here for our "Bible Research Marathon" on Saturday 20, starting at ~ 10:00 AM!!! Jane is also invited to stay here coming from Grapevine! Plus everybody willing to be here! So, I suggest to study: Are the dead alive now?: http://tinyurl.com/kcpm6t6 And then, my ongoing research on the chronology of our future hope!: http://fdocc.ucoz.com/2/hope_big.pdf
My wife, Ashley, Annette, etc., are going to be in the "Keepers of the House" event organized by Kristen Logsdon. My wife is going to be teaching the Eastern dance of the "Belly Dancing". Meanwhile, my older sister Patty confirmed that she is coming from San Antonio to be here for our "Bible Research Marathon" on Saturday 20, starting at ~ 10:00 AM!!! Jane is also invited to stay here coming from Grapevine! Plus everybody willing to be here! So, I suggest to study: Are the dead alive now?: http://tinyurl.com/kcpm6t6 And then, my ongoing research on the chronology of our future hope!: http://fdocc.ucoz.com/2/hope_big.pdf
Updated Sep 15, 2014, 8:26 AM
Fernando Castro-Chavez posted in Bible Research Night # 3.
For you saints with eyes to see! We have the tremendous power to speak in tongues to restraint and to defeat all devices of the Adversary, which God tells us not to ignore. When Russell was here last Saturday, he checked the heavens as they were on September the eleventh of two thousand and one; with no comments (I let God do that), the graphic description and example used at the end, corresponds to it: http://tinyurl.com/sky-map-9-11-01 Here below, the close-up of those graphics for you to receive your prayerful Revelation, by Heavenly Design divided in 3 of 3 (read from right to left, just like the Hebrew language):
Mazzaroth: "The Constellations, i.e., Virgo (Rev. 12:1), the Sacrifice upon the Altar, "Libra" (Dt. 33:10), the great red dragon with its star Antares, anti Ares the rival of Mars, also known as the old serpent, "Scorpio" (Rev. 12:3, Gn. 49:17a), the rider on his horse, "Saggitarius" (Gn. 49:17b). Below, a detail of Leo during the first year of the birth of Christ (Gn. 49:10)." In Spanish: "Mazzaroth: Las Constelaciones, v.gr., Virgo (Ap. 12:1), el Sacrificio sobre el Altar, "Libra" (Dt. 33:10), el gran dragón rojo con su estrella Antares anti Ares, el rival de Marte, también conocido como la serpiente antigua, "Scorpio" (Ap. 12:3, Gn. 49:17a), el jinete en su caballo, "Saggitarius" (Gn. 49:17b). Abajo, un detalle de Leo durante el primer año del nacimiento de Cristo (Gn. 49:10)."
Mazzaloth: The Planets and their Biblical meaning; the farther two on the Ecliptic: Uranus (false prophet) and Neptune (Abaddon, the Beast) represent the other two leading demons of Revelation that end up in the lake of fire with Satan, who goes there the last (Rev. 20:10); unknown to man until the Telescope was invented, further evidence that the Bible is The Revelation by God to the humanity.
Fernando Castro-Chavez wrote on Valentin Chavez's timeline.
Me uno a la bienvenida de Juan Pablo: Saludos!
Fernando Castro-Chavez wrote on Stefano Macedo Reyes's timeline.
Estimado Estéfano, Deseándote lo mejor ahora y siempre, te mando feliciaticones por tu cumpleaños! Fernando.
Fernando Castro-Chavez wrote on Diana Moreno's timeline.
Happy Birthday! It's great meeting you!
Fernando Castro-Chavez wrote on Raul Martín Cruz-mireles's timeline.
Oraciones espirituales para tí, y para tu familia espiritual en expansión; hoy y siempre!
Fernando Castro-Chavez wrote on Alejandro Heredia's timeline.
Felicidades, nacimos el mismo día!!! Renacimos al día de Dios!
Fernando Castro-Chavez updated his status.
Last year, I did a "Biology Sampler" presentation to the wonderful 'Marvels', here is the PDF of such an event; to prevent it to get lost in "the sands of time": http://fdocc.ucoz.com/2/fdocc-biology-sampler.pdf
Un estudio de los más importantes para que el Enemigo de Dios no gane ventaja sobre nosotros es el que enseña que los muertos están muertos hasta que Cristo mismo regrese: "Are the dead alive now?": http://tinyurl.com/kcpm6t6 No en vano Pablo dice en 1. Cor. 15:22 y 23: "Porque así como en Adán todos mueren, también en Cristo todos serán vivificados. Pero cada uno en su debido orden: Cristo, las primicias; luego los que son de Cristo, en su venida." Hasta que él regrese es que los muertos volverán a vivir, unos para vida eterna, otros para muerte eterna.
Updated Feb 10, 2014, 5:09 PM
Fernando Castro-Chavez updated his status.
Para nuestras exploraciones e investigaciones de "La Palabra (de Dios) y la Ciencia", uno de los gráficos que ayudarán a entender la Palabra escrita en los cielos (lo que NO ES astrología) es (del libro de Bullinger): http://www.biblebelievers.org.au/images/planisph.jpg Jesús es representado en el Hércules que le está aplastando la cabeza al dragón cerca del centro, Jesús es el que aplasta al escorpión, sujetando a la serpiente para evitar que alcanze a la Corona (Borealis), Jesús es el León (Leo) que aplasta la cabeza de la serpiente, Jesús es el cordero (Aries) que aplasta la cabeza del monstruo marino, Jesús es el Orión que aplasta la cabeza de una fiera, Jesús es el jinete del caballo que viene a vencer al mal...
And my brother in Christ and 'son' in the Word, Raúl Cruz reminds me that the 'Bible and Archaeology' is also an almost limitless field of enjoyment, research and understanding, then we have the 'Bible and Physics', suggested by Chuck Flynn, and then 'Bible and Biology' (i.e., and Botany, and Zoology), etc., etc...
Updated Feb 7, 2014, 8:15 AM
You tagged Nava Nerry, Juanand Monica Villalvazo, Maggy LC Samperio, Merary Neftaly Castro and Beettyy Leona
Fernando te mAndo el video donde le cantaron a tú papá las hermanas castro samperio
Fernando Castro-Chavez updated his status.
My wife Tracy Duncan really likes her students at “The Y”. However, the coordinator told her that she was not allowed to use her “Body Pump” by 'Les Mills' class notes anymore, giving her an ultimatum; as my wife couldn't do it, she was forced to resign. My question is: Is “The Y” a “Les Mills” franchise or an independent, sovereign, and supposedly 'Christian' institution... or no more?
Fernando Castro-Chavez updated his status.
One of the best Christmas Cards we received (by Kicha and Sylvia): http://fdocc.ucoz.com/2/lamb_lion_kicha.jpg A reminder of the future time when the lion will be at peace with the lamb; part of the release of the Creation from its current bondage...
Fernando Castro-Chavez updated his status.
http://fdocc.ucoz.com/2/owens-bw.jpg
The study that started my interest to understand the Holy Bible, done by Dorothy Owens:
http://fdocc.ucoz.com/2/dorothy_owens_ktsl.pdf
The study that started my interest to understand the Holy Bible, done by Dorothy Owens:
http://fdocc.ucoz.com/2/dorothy_owens_ktsl.pdf
When the Bolivian Ex-President Hernando Siles Reyes Accepted Christ, by Walter Manuel Montaño: http://fdocc.ucoz.com/index/0-114
Updated Dec 3, 2013, 9:38 AM
Y traducido al español, dice así:
Recuerdos de Acción de Gracias, Recuerdos de Libertad...:
“Antes de ir a Brasil, estaba como invitado del Presidente de la República de la Argentina” Después de comer, un día. nos sentamos en su solar mirando al río, él se encontraba bastante pensativo, y dijo: “…me he preguntado porqué es que Sudamérica,* con todas sus grandes ventajas naturales se encuentra tan atrasada en comparación con Norteamérica a pesar de que Sudamérica fue establecida antes de Norteamérica.” Entonces habló acerca de los bosques de Sudamérica que tenían 286 árboles que no se encontraban en libro alguno de botánica. Me dijo de muchos ranchos que tenían miles de hectáreas de alfalfa…, mencionando a las minas de hierro, de carbón, de cobre, plata, y oro; de todos esos grandes ríos, y de la energía hidráulica que rivalizan al Niágara: “¿Porqué es que con todos éstos recursos naturales, Sudamérica se encuentra tan atrasada en comparación con Norteamérica?”, preguntó. Yo le dije que aquellos que han ponderado éstas cosas saben la razón. Pero, siendo tan sólo un invitado, le pregunté: “Señor Presidente, ¿cuál cree usted que sea la razón?”
* Yo incluiría a México y a Centroamérica, a toda la América Hispana y Portuguesa.
Él respondió: “He concluido lo siguiente: Sudamérica fue conquistada por los españoles que llegaron a Sudamérica en busca de oro (gold), pero Norteamérica fue colonizada por los “Padres Viajeros” (The Pilgrim Fathers) que llegaron allá en búsqueda de DIOS (GOD).”
Amigos míos, ciudadanos de América, no derribemos la escalera por medio de la cual hemos subido. Que nunca olvidemos el fundamento sobre el cual la prosperidad permanente se basa."
http://www.gutenberg.org/files/21502/21502-h/21502-h.htm
[Referencia Original: Babson, R. W. Fundamentals of Prosperity. What They Are and Whence They Come. Revell & Co., New York, 1920, pp. 94-95.]
Recuerdos de Acción de Gracias, Recuerdos de Libertad...:
“Antes de ir a Brasil, estaba como invitado del Presidente de la República de la Argentina” Después de comer, un día. nos sentamos en su solar mirando al río, él se encontraba bastante pensativo, y dijo: “…me he preguntado porqué es que Sudamérica,* con todas sus grandes ventajas naturales se encuentra tan atrasada en comparación con Norteamérica a pesar de que Sudamérica fue establecida antes de Norteamérica.” Entonces habló acerca de los bosques de Sudamérica que tenían 286 árboles que no se encontraban en libro alguno de botánica. Me dijo de muchos ranchos que tenían miles de hectáreas de alfalfa…, mencionando a las minas de hierro, de carbón, de cobre, plata, y oro; de todos esos grandes ríos, y de la energía hidráulica que rivalizan al Niágara: “¿Porqué es que con todos éstos recursos naturales, Sudamérica se encuentra tan atrasada en comparación con Norteamérica?”, preguntó. Yo le dije que aquellos que han ponderado éstas cosas saben la razón. Pero, siendo tan sólo un invitado, le pregunté: “Señor Presidente, ¿cuál cree usted que sea la razón?”
* Yo incluiría a México y a Centroamérica, a toda la América Hispana y Portuguesa.
Él respondió: “He concluido lo siguiente: Sudamérica fue conquistada por los españoles que llegaron a Sudamérica en busca de oro (gold), pero Norteamérica fue colonizada por los “Padres Viajeros” (The Pilgrim Fathers) que llegaron allá en búsqueda de DIOS (GOD).”
Amigos míos, ciudadanos de América, no derribemos la escalera por medio de la cual hemos subido. Que nunca olvidemos el fundamento sobre el cual la prosperidad permanente se basa."
http://www.gutenberg.org/files/21502/21502-h/21502-h.htm
[Referencia Original: Babson, R. W. Fundamentals of Prosperity. What They Are and Whence They Come. Revell & Co., New York, 1920, pp. 94-95.]
Updated Dec 2, 2013, 9:13 AM
Memories of Thanksgiving, Memories of Freedom...:
"Just before I went to Brazil I was the guest of the President of the Argentine Republic. After lunching one day we sat in his sun parlor looking out over the river. He was very thoughtful. He said, “Mr. Babson, I have been wondering why it is that South America with all its great natural advantages is so far behind North America notwithstanding that South America was settled before North America.” Then he went on to tell how the forests of South America had two hundred and eighty-six trees that can be found in no book of botany. He told me about many ranches that had thousands of acres under alfalfa in one block. He mentioned the mines of iron, coal, copper, silver, gold; all those great rivers and water-powers which rival Niagara. “Why is it, with all these natural resources, South America is so far behind North America?” he asked. Well, those of you who have been there know the reason. But, being a guest, I said:
“Mr. President, what do you think is the reason?”
He replied: “I have come to this conclusion. South America was settled by the Spanish who came to South America in search of gold, but North America was settled by the Pilgrim Fathers who went there in search of GOD.”
Friends, let us as American citizens never kick down the ladder by which we climbed up. Let us never forget the foundation upon which all permanent prosperity is based."
http://www.gutenberg.org/files/21502/21502-h/21502-h.htm
[Original Reference: Babson, R. W. Fundamentals of Prosperity. What They Are and Whence They Come. Revell & Co., New York, 1920, pp. 94-95.]
"Just before I went to Brazil I was the guest of the President of the Argentine Republic. After lunching one day we sat in his sun parlor looking out over the river. He was very thoughtful. He said, “Mr. Babson, I have been wondering why it is that South America with all its great natural advantages is so far behind North America notwithstanding that South America was settled before North America.” Then he went on to tell how the forests of South America had two hundred and eighty-six trees that can be found in no book of botany. He told me about many ranches that had thousands of acres under alfalfa in one block. He mentioned the mines of iron, coal, copper, silver, gold; all those great rivers and water-powers which rival Niagara. “Why is it, with all these natural resources, South America is so far behind North America?” he asked. Well, those of you who have been there know the reason. But, being a guest, I said:
“Mr. President, what do you think is the reason?”
He replied: “I have come to this conclusion. South America was settled by the Spanish who came to South America in search of gold, but North America was settled by the Pilgrim Fathers who went there in search of GOD.”
Friends, let us as American citizens never kick down the ladder by which we climbed up. Let us never forget the foundation upon which all permanent prosperity is based."
http://www.gutenberg.org/files/21502/21502-h/21502-h.htm
[Original Reference: Babson, R. W. Fundamentals of Prosperity. What They Are and Whence They Come. Revell & Co., New York, 1920, pp. 94-95.]
Updated Dec 2, 2013, 8:04 AM
Fernando Castro-Chavez updated his status.
P.D. al mensaje anterior:
Muchas gracias por leer esto, por su misericordia y por sus santas respuestas cual creyentes independientes!
De cierto, todos nosotros nos vamos a ver en el futuro por toda una eternidad sin las limitaciones actuales!
Pero, por ahora esto es lo que en Cristo hemos recibido:
"...los verdaderos adoradores adorarán al Padre en espíritu y en verdad; porque también el Padre tales adoradores busca que le adoren." (Jn. 4:23).
Pablo nos dijo que el hablar en lenguas de hoy estaba profetizado en el Antiguo Testamento: "En otras lenguas y con otros labios hablaré..." (1 Cor. 14:21), al menos desde Is. 28:11-12:"...en extraña lengua hablará a este pueblo, a los cuales él dijo: Este es el reposo; dad reposo al cansado; y este es el refrigerio; mas no quisieron oír."
La igualdad es la siguiente:
Adorar al Padre en espíritu y en verdad (Jn. 4:23) = Hablar en otras lenguas (Is. 28:11-12)
El hecho de que habla de "refrigerio" nos hace observar que incluso las preciosas palabras de Cristo de que:
"..."Si alguno tiene sed, venga a mí y beba. El que cree en mí, como dice la Escritura, de su interior correrán ríos de agua viva". Esto dijo del Espíritu que habían de recibir (de manifestar) los que creyesen en él" Jn. 7:37-39.
Esto confirma lo que nos dijo en Jn. 14:12, la escritura que me trajo a la luz antes de que yo conociera grupo alguno de estudios de la Biblia.
J.C. nos habla hoy con la misma fuerza que cuando andaba caminando sobre la tierra:
"De cierto, de cierto os digo: El que en mí cree, las obras que yo hago, él las hará también; y aun mayores hará, porque yo voy al Padre" (Jn. 14:12).
Hablar en lengua extra (desconocida para el que la habla, espiritualmente inspirada) = reposo y refrigerio = emitir ríos de agua viva = hacer obras mayores que las que Cristo mismo hizo!
Les amo incondicionalmente en Cristo! Muchas gracias por amarme de la misma manera!
Fer.
Muchas gracias por leer esto, por su misericordia y por sus santas respuestas cual creyentes independientes!
De cierto, todos nosotros nos vamos a ver en el futuro por toda una eternidad sin las limitaciones actuales!
Pero, por ahora esto es lo que en Cristo hemos recibido:
"...los verdaderos adoradores adorarán al Padre en espíritu y en verdad; porque también el Padre tales adoradores busca que le adoren." (Jn. 4:23).
Pablo nos dijo que el hablar en lenguas de hoy estaba profetizado en el Antiguo Testamento: "En otras lenguas y con otros labios hablaré..." (1 Cor. 14:21), al menos desde Is. 28:11-12:"...en extraña lengua hablará a este pueblo, a los cuales él dijo: Este es el reposo; dad reposo al cansado; y este es el refrigerio; mas no quisieron oír."
La igualdad es la siguiente:
Adorar al Padre en espíritu y en verdad (Jn. 4:23) = Hablar en otras lenguas (Is. 28:11-12)
El hecho de que habla de "refrigerio" nos hace observar que incluso las preciosas palabras de Cristo de que:
"..."Si alguno tiene sed, venga a mí y beba. El que cree en mí, como dice la Escritura, de su interior correrán ríos de agua viva". Esto dijo del Espíritu que habían de recibir (de manifestar) los que creyesen en él" Jn. 7:37-39.
Esto confirma lo que nos dijo en Jn. 14:12, la escritura que me trajo a la luz antes de que yo conociera grupo alguno de estudios de la Biblia.
J.C. nos habla hoy con la misma fuerza que cuando andaba caminando sobre la tierra:
"De cierto, de cierto os digo: El que en mí cree, las obras que yo hago, él las hará también; y aun mayores hará, porque yo voy al Padre" (Jn. 14:12).
Hablar en lengua extra (desconocida para el que la habla, espiritualmente inspirada) = reposo y refrigerio = emitir ríos de agua viva = hacer obras mayores que las que Cristo mismo hizo!
Les amo incondicionalmente en Cristo! Muchas gracias por amarme de la misma manera!
Fer.
Fernando Castro-Chavez updated his status.
Amada Familia del Cielo,
Ésto es lo que he compartido recientemente en mis mensajes personales:
"Te dejo otra maravillosa escritura que solamente la pude entender al grabarme en mi mente la tan profunda y preciosa igualdad "matemática" relacionada con los asuntos espirituales:
Si yo oro en lengua desconocida = mi espíritu ora (1 Cor. 14:14)
Si yo oro en lengua desconocida para mí (que soy el que habla) lo interpreto como cuando balbuceábamos de niños, o como cuando queríamos sentirnos importantes y jugábamos a tratar de imitar el hablar en Chino, o en algún otro idioma, y entonces comenzábamos a "platricar" en ese (curiosamente, esto lo hicimos mi hermana mayor y yo en el "Club Guadalajara", supuestamente queriendo "impresionar" a los otros niños que nos rodeaban, smile, y por la pura gracia de Dios ahora mi hermana mayor sabe del hablar en lenguas que proviene de Dios, y lo ha manifestado!)
Y eso de que "mi espíritu ora" lo interpreto por la gracia de Dios como el espíritu santo que Dios ha depositado en mí y en todo aquel que ha renacido de Dios, a todo aquel que ha aceptado a Dios como su papá, recibiendo los genes espirituales de Él (por confesar que éste gran Dios resucitó a Jesús Su hijo tan amado, de entre los muertos, y lo colocó a su diestra en los lugares celestiales; a éste Jesús lo hizo Señor nuestro, y nosotros lo hemos aceptado).
Pero todo este "rollo divino" es para poder entender algo que el Juditas bueno dijo en su tan per tan profunda carta tan breve que ni llega a capítulo (smile):
Extracto de la Carta de Judas (justo antes del Apocalipsis):
"20 Pero vosotros, amados, edificándoos sobre vuestra santísima fe, orando en el espíritu santo,
21 conservaos en el amor de Dios, esperando la misericordia de nuestro Señor Jesucristo para vida eterna.
22 A algunos que dudan, convencedlos.
23a A otros salvad, arrebatándolos del fuego..."
Concluyendo, ésto de orar en el "espíritu santo" es el orar en lenguas!!! El mismo que Jesús prometió y que ha sido tan ignorado y tan olvidado entre casi toda la "cristiandad":
"Y estas señales seguirán a los que creen: En mi nombre echarán fuera demonios; hablarán nuevas lenguas..." (San Jesús hablando en Mc. 16:17).
La igualdad entonces quedaría así, juntando las palabras del buen Judas con las de Jesús, el más Santo de todos nosotros los Santos:
Orando en el espíritu santo (Jd 20) = hablar nuevas lenguas (Mc. 16:17).
En fin, ésto me apasiona tremendamente y le dejo a Dios mismo el alumbrar el entendimiento de todos aquellos que profundamente amamos en el Señor para que entiendan plenamente estas cosas divinas."
En Cristo,
El Fer.
Ésto es lo que he compartido recientemente en mis mensajes personales:
"Te dejo otra maravillosa escritura que solamente la pude entender al grabarme en mi mente la tan profunda y preciosa igualdad "matemática" relacionada con los asuntos espirituales:
Si yo oro en lengua desconocida = mi espíritu ora (1 Cor. 14:14)
Si yo oro en lengua desconocida para mí (que soy el que habla) lo interpreto como cuando balbuceábamos de niños, o como cuando queríamos sentirnos importantes y jugábamos a tratar de imitar el hablar en Chino, o en algún otro idioma, y entonces comenzábamos a "platricar" en ese (curiosamente, esto lo hicimos mi hermana mayor y yo en el "Club Guadalajara", supuestamente queriendo "impresionar" a los otros niños que nos rodeaban, smile, y por la pura gracia de Dios ahora mi hermana mayor sabe del hablar en lenguas que proviene de Dios, y lo ha manifestado!)
Y eso de que "mi espíritu ora" lo interpreto por la gracia de Dios como el espíritu santo que Dios ha depositado en mí y en todo aquel que ha renacido de Dios, a todo aquel que ha aceptado a Dios como su papá, recibiendo los genes espirituales de Él (por confesar que éste gran Dios resucitó a Jesús Su hijo tan amado, de entre los muertos, y lo colocó a su diestra en los lugares celestiales; a éste Jesús lo hizo Señor nuestro, y nosotros lo hemos aceptado).
Pero todo este "rollo divino" es para poder entender algo que el Juditas bueno dijo en su tan per tan profunda carta tan breve que ni llega a capítulo (smile):
Extracto de la Carta de Judas (justo antes del Apocalipsis):
"20 Pero vosotros, amados, edificándoos sobre vuestra santísima fe, orando en el espíritu santo,
21 conservaos en el amor de Dios, esperando la misericordia de nuestro Señor Jesucristo para vida eterna.
22 A algunos que dudan, convencedlos.
23a A otros salvad, arrebatándolos del fuego..."
Concluyendo, ésto de orar en el "espíritu santo" es el orar en lenguas!!! El mismo que Jesús prometió y que ha sido tan ignorado y tan olvidado entre casi toda la "cristiandad":
"Y estas señales seguirán a los que creen: En mi nombre echarán fuera demonios; hablarán nuevas lenguas..." (San Jesús hablando en Mc. 16:17).
La igualdad entonces quedaría así, juntando las palabras del buen Judas con las de Jesús, el más Santo de todos nosotros los Santos:
Orando en el espíritu santo (Jd 20) = hablar nuevas lenguas (Mc. 16:17).
En fin, ésto me apasiona tremendamente y le dejo a Dios mismo el alumbrar el entendimiento de todos aquellos que profundamente amamos en el Señor para que entiendan plenamente estas cosas divinas."
En Cristo,
El Fer.
I thank God that my last research can finally be read in full Online (in PDF, except Appendixes); thanks to n3d in Houston who provided the magnetic levitation tools for the human vascular cells! http://tinyurl.com/nandino
Updated Nov 7, 2013, 8:05 AM
Some more photos of 'Raiding the Rock Vault', when singing a Foreigner song, and McAuley with Leese, plus some more songs that they interpreted: http://www.youtube.com/watch?v=4ZKvkRSBEGI
Some of the pictures that my wife took of 'Raiding the Rock Vault', Payne, Shortino, Freeman and Guns, and some of the songs they interpreted: http://www.youtube.com/watch?v=2vV_L7OQtU0
One of the events that my Tracy Duncan and I attended was a signature celebration of 'Classic Rock' at Elvis Presley's LVH Theater, by new vocalist of "Asia"; I won a 'Guitar Pick' used by Tracii Guns, from 'Guns N' Roses'. We had the opportunity to talk with them, and with Amanda Gibson, Coby Mosby, etc., dancers and actors of the show; on the 18 to 22 Oct.; this was part of their show: http://fdocc.ucoz.com/2/rock_vault_10.11.13.pdf I'll seek to post some of them!
And, talking about ancient things, this is the text of the old Eastern wedding traditions from the Bible: http://fdocc.ucoz.com/2/marriage.pdf This was the material that my Tracy and I gave to Vicky and Kevin in their wedding day! Which we enjoyed very much, as indicated by these pictures:
A great choice as favorite: http://www.youtube.com/watch?v=rN6kXO7BOCY
Updated Aug 24, 2013, 12:55 PM
What I'm studying now is Visual C++, you can learn it for free: http://msdn.microsoft.com/en-us/library/hh145619(v=vs.88).aspx
Updated Aug 16, 2013, 6:34 PM
Our God and his Word is a constant source of joy, here are 85 inspiring references for us to rejoice and to do our own research: http://fdocc.blogspot.com/2013/07/85-inspiring-references-to-do-our-own.html
And videos, i.e. (in Spanish): http://www.youtube.com/watch?v=AnCaEqUr1m0&list=TLiYDG4YYRMLo
And videos, i.e. (in Spanish): http://www.youtube.com/watch?v=AnCaEqUr1m0&list=TLiYDG4YYRMLo
Updated Jul 26, 2013, 8:54 AM
Last Saturday, at Kelly's 50's my wife @[1218645485:2048:Tracy Duncan] won the contest of "The Star of the Moment" adapting the next opening song from a TV show: http://www.youtube.com/watch?v=96A0uyFWQHs
Updated Jul 19, 2013, 8:14 AM
Today, celebrating our Independence with a blast from the past: http://www.youtube.com/watch?v=qhkk1tZzNjk
Updated Jul 4, 2013, 11:18 AM
Seeking for a summer programmer to improve and make compatible related software at my job: http://www.pipingsolutions.com/TriHanger/index.htm This is the original message from the boss: "Fernando, would you know any other programmers who could work on TRI*HANGER? They could still be in college and want to work 2 or 3 days/week."
Updated Jul 1, 2013, 8:16 AM
In English: This is what I wrote before: In my classes I mention that based on the Bible, since at least some 17 years ago I did publish (in Spanish) that the dominant water above the earth, from Noah's flood, did come from the outer space, falling also in Mars and impacting the moon, leaving it filled with craters, as well as in other satellites and planets, in English, Fig. 1): http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3271378/#!po=6.94444
Updated Jun 27, 2013, 8:08 AM
I posted this one last week and for unknown reasons it was removed from here by somebody else, here we go again: http://www.youtube.com/watch?v=3sXj1GwV-rs
Updated Jun 25, 2013, 8:17 AM
En mis clases menciono que basado en la Biblia, desde hace al menos unos 17 años publiqué que el agua dominante sobre la tierra, la del diluvio de Noé, vino del espacio exterior, cayendo también en marte e impactando a la luna, dejándola llena de cráteres, así como a otros satélites y planetas: http://www.oocities.org/fcastrocha/spa.htm
Updated Jun 12, 2013, 8:12 AM
In my tutoring, I remembered this week how initially the most famous formula of Einstein was reported by him in its constructive or edifying way, say: M = E/c^2 , I post one pair of early fragments of it: http://fdocc.ucoz.com/2/einstein1.jpg And full: http://www.relativitycalculator.com/pdfs/On_the_influence_of_Gravitation_on_the_Propagation_of_Light_English.pdf
Updated Jun 5, 2013, 10:32 PM
El milagro de Dios consiste en que apenas comencé a estudiar computación a finales de Enero, y para mediados de Mayo ya tenía un trabajo relacionado; a diario le pedía yo a Dios un trabajo cercano a mi casa y así sucedió. Comparto las finales del M.I.T.: https://www.youtube.com/watch?v=mB26qQckcHc
Updated Jun 3, 2013, 8:11 AM
So, now that I'm working on Programming, its harder and harder for me to continue studying my computing classes; I have one month left to complete the ones from Rice U. and, the hardest of them all, from the M.I.T. Next, a fascinating fragment from its last invited speaker: http://www.youtube.com/watch?v=sVlC_-e-4yg
Updated May 22, 2013, 9:26 PM
God be thanked for giving me an engineering/programming job! Tomorrow is my first day (Gracias a Dios por darme un trabajo en ing. y prog. El Jueves comienzo): http://www.aaatech.com/ Thanks also to all of you who prayed for me! (Gracias a aquellos que oraron por esto!): http://natecnologia.wordpress.com/tag/triflex-3-3-5
Updated May 15, 2013, 9:40 PM
Fernando Castro-Chavez updated his status.
http://m8.i.pbase.com/o6/27/756927/1/149695848.OJT1sRhe._MG_4125_1_1.JPG
Experiencing (Viviendo en carne propia) Is. 40:31:
"They that wait upon the Lord shall renew their strength; they shall mount up with wings as eagles; they shall run, and not be weary; and they shall walk, and not faint."
"Los que confían en el Señor renovarán sus fuerzas; volarán como las águilas: correrán y no se fatigarán, caminarán y no se cansarán."
Experiencing (Viviendo en carne propia) Is. 40:31:
"They that wait upon the Lord shall renew their strength; they shall mount up with wings as eagles; they shall run, and not be weary; and they shall walk, and not faint."
"Los que confían en el Señor renovarán sus fuerzas; volarán como las águilas: correrán y no se fatigarán, caminarán y no se cansarán."
La siguiente oración la repetía el Abuelo materno Rafael: "Gracias rendidas demos
al Dios Omnipotente, que sacó de la nada la turba de los seres...": http://fdocc.ucoz.com/2/gradio.pdf Publicada en el "Diario de México", 1805 y traducida al inglés en 1882: http://tinyurl.com/ccu4buc
al Dios Omnipotente, que sacó de la nada la turba de los seres...": http://fdocc.ucoz.com/2/gradio.pdf Publicada en el "Diario de México", 1805 y traducida al inglés en 1882: http://tinyurl.com/ccu4buc
Updated Apr 29, 2013, 11:13 AM
When my younger sister-in-law shared an evening with us, she played this song about something wondrous that sometimes is easier to say than to do, isn't it?:
http://youtu.be/FMn0QNdiuGE
http://youtu.be/FMn0QNdiuGE
Updated Apr 26, 2013, 8:15 AM
"The Retirement Gamble" Frontline's documentary, is very informative for adult Americans, talks about deceptions within 401(k), such as 'Mutual Funds' and 'Financial Advisers', both salesmen working for the companies but NOT for you: http://www.pbs.org/wgbh/pages/frontline/retirement-gamble/ The skinny seems to be an Indexed fixed fund, John (Jack) Bogle, founder and CEO of 'The Vanguard Group' gives good advice to keep your retirement funds!
Updated Apr 24, 2013, 9:56 AM
Praying for the injured at Boston and for relatives of victims, and if possible that truth may arise regarding such event; 1st page: http://www.webcitation.org/6FvPCyGok
Updated Apr 16, 2013, 10:23 AM
And while I wait for the answer of Dr. Eissa (and/or of his secretary), I delight myself singing the next song to my Jesus: http://www.youtube.com/watch?v=aikTUMFm1lM A great song filled with 'soul', the best song sung in a singing contest!
Updated Apr 12, 2013, 9:47 PM
A bonus for my presentation of Tomorrow, I uploaded one minute of my work that impressed me the most; but, my most important need right now is that I'll be seeking for a job!: http://youtu.be/oYd96rj_51Q
Updated Apr 8, 2013, 6:26 PM
This was my Final Project for my free cs50x class at Harvard University: http://youtu.be/0aacCShsmWo Thank you Harvard! Now I can illustrate better my research on the Genetic Code (birds and fishes remind us of the 5th day)!
Updated Apr 5, 2013, 10:13 PM
And then we have the CS101 classes from the two Virginias, this 'Java the Hutt' one (smile):
http://www.cs.virginia.edu/~asb/teaching/cs101-spring07/lectures/lectures.html
http://www.cs.virginia.edu/~asb/teaching/cs101-spring07/lectures/lectures.html
Updated Mar 30, 2013, 6:27 AM
And today Monday started the interesting sequel class by Gries & Campbell: 'Learn to Program: Crafting Quality Code': https://www.coursera.org/course/programming2
Updated Mar 25, 2013, 8:55 PM
I thank my God and my lovely ex-wife (who was my wife at that time) for their unconditional support for my most recent article:
http://www.ncbi.nlm.nih.gov/pubmed/23500015
http://www.ncbi.nlm.nih.gov/pubmed/23500015
Updated Mar 19, 2013, 4:58 PM
I'm getting ready for my free online class from Harvard University's Final cs50x Project: http://youtu.be/ln7MDGXJOIw
Updated Mar 15, 2013, 12:42 PM
One of my favorite subjects is 'Adaptation', the origin of a reversible variation!, here exemplified by the cave fish (but imagine similar changes over an underground bipedal mammal): http://fdocc.blogspot.com/2006/02/adaptations-of-cave-fish.html
Updated Mar 8, 2013, 8:10 AM
Great molecular moments were, the illustrations for Transcription (from 2-D letters of 'the golden book' to slightly different 2-D copy letters), and Translation (from the last letters to 3-D objects!): http://bilology.files.wordpress.com/2012/04/post-3-figure-1.jpg
Updated Mar 1, 2013, 8:32 PM
Three of the "Greatest Hits" with the students today were:
1 - The Costa Rican Jesus Lizard:
http://www.youtube.com/watch?v=45yabrnryXk
1 - The Costa Rican Jesus Lizard:
http://www.youtube.com/watch?v=45yabrnryXk
Updated Feb 28, 2013, 5:28 PM
And, here is my last article's full text as it will appear in the PubMed: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3575644
Updated Feb 22, 2013, 8:38 PM
This one also contains all the class big materials packaged at the end of the page (289MB):
http://see.stanford.edu/see/courseinfo.aspx?coll=824a47e1-135f-4508-a5aa-866adcae1111
http://see.stanford.edu/see/courseinfo.aspx?coll=824a47e1-135f-4508-a5aa-866adcae1111
Updated Feb 22, 2013, 7:08 AM
And this one is a basic computer class from Australia: https://www.openlearning.com/courses/unsw/computing1
Updated Feb 16, 2013, 8:27 AM
This is the amazing video of "Earth From Space":
http://www.pbs.org/wgbh/nova/space/earth-from-space.html
http://www.pbs.org/wgbh/nova/space/earth-from-space.html
Updated Feb 14, 2013, 10:53 AM
Another free computer class that I just found is from Stanford University: https://www.coursera.org/course/cs101
Updated Feb 13, 2013, 1:26 PM
My 2012s, 10-year work on the Genbank contaminated DNA by methodological palindromes was finally released in full for free reading: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3272245
Updated Feb 12, 2013, 9:00 AM
My "Hello, World" Homework, my name is Fernando Castro-Chavez and this is CS50!: http://www.youtube.com/watch?v=DIgHiQ9drY4
My project from "Scratch":
http://scratch.mit.edu/projects/fdocc/3087747
My project from "Scratch":
http://scratch.mit.edu/projects/fdocc/3087747
Updated Feb 8, 2013, 7:34 AM
Here's my first 10 sec. program inspired by the class number 0 of CS50x, done with the BYOB program!: http://www.youtube.com/watch?v=jNDZycAvXCE
Updated Feb 3, 2013, 1:29 PM
And this is the Pre-Calculus free class from the Univ of California: https://class.coursera.org/precalculus-001/class
Updated Feb 1, 2013, 8:05 PM
So, after having seen all that basic theory; it's time to finally start tackling all those quizzes, problem sets and to the final project!: http://www.youtube.com/watch?v=7NlaBl_jt2k
Updated Jan 31, 2013, 6:17 PM
Fernando Castro-Chavez likes a link on Coursera.
CourseraLearn to Program: Crafting Quality Code - University of Toronto | Courserahttps://www.coursera.org/course/programming2
But, the 3 sites that actually offer you free Certificates after you completing their tests, to really advance your careers are: https://www.edx.org/courses ,
https://www.coursera.org/courses ,
http://www.udacity.com/
https://www.coursera.org/courses ,
http://www.udacity.com/
Updated Jan 23, 2013, 7:07 PM
This is a very good class or tutorial to start learning Computer Sciences & Computer Programming with the useful program Python (numerous "well-paid" job applications require you to have expertise using Python): http://anh.cs.luc.edu/python/hands-on/3.1/handsonHtml/context.html
Updated Jan 22, 2013, 6:03 PM
This excellent program is about the salmon, his uphill migration from the ocean to the farthest and toxic volcanic lake, and of its transformation: change of color (to red), and of the shape of its face: https://youtu.be/1nWD0mFTA_s A living and proverbial example for us of persevering against all odds!
Updated Jan 17, 2013, 5:28 PM
And one more that they did record in their little blue 'Nintendos'... by Air Supply, "Every Woman In The World":
http://www.youtube.com/watch?v=dpM9RktL9Ek
http://www.youtube.com/watch?v=dpM9RktL9Ek
Updated Jan 12, 2013, 2:39 PM
And another shown to them: "Babe", by Dennis DeYoung (from 'Styx'): http://www.youtube.com/watch?v=b9RrbwOWCFQ
Updated Jan 9, 2013, 8:10 AM
Sharing with my dear nephews some of my favorite rock songs of old: http://www.youtube.com/watch?v=MfHKyfrx2zA
Updated Jan 7, 2013, 4:48 PM
Recordando a un estimado cantante de Guadalajara y una pieza conocida del lugar: http://www.youtube.com/watch?v=L52VFVZuPGI
Updated Jan 5, 2013, 10:20 PM
Ahora leemos con mi hermana: http://www.custance.org/Library/WFANDV
Updated Dec 30, 2012, 9:46 AM
Fernando Castro-Chavez posted in GRUPO "LOS ESCRIBIADOS GDL-ORIGINALES Y REENCONTRADOS".
Dec 29, 2012, 2:46 PM
My bro. in-law suggests the next program for tonight at 9:00 PM ET and next week at the same time (of course, I won't call'em 'tales'): http://abcnews.go.com/International/slideshow/christiane-amanpours-journey-back-beginning-17894821
Updated Dec 21, 2012, 12:08 PM
When somebody hurts a believer, God is the only one able to heal, like when cutting a branch of a tree, helping us to grow bigger and stronger; God is healing our wings! ‘Mr. Mister’ got lost, went to God @ 2:30-3:00, being led to the beach (I remember Is. 40:28-31): http://www.youtube.com/watch?v=f5j53e5NreI
Updated Dec 19, 2012, 2:09 PM
And this is how it all started...:
http://content.onlinejacc.org/article.aspx?articleid=1145920
http://content.onlinejacc.org/article.aspx?articleid=1145920
Updated Dec 7, 2012, 8:06 AM
I deem this contemporaneous prophecy by Sangat Bains as true: http://liveweb.archive.org/http://www.reocities.com/plin9k/prophecy.mp3 Our departure won't be like a cowardly escape from this world but like a powerful simile of what Jesus achieved singularly while he was on earth, after all, we are the members of his body!
Updated Nov 30, 2012, 8:13 PM
Algunos detalles a considerar en relación con el ministerio de Jesús que fue "el año agradable del Señor", en PDF: http://fdocc.ucoz.com/2/28dc.pdf, y en Word Document: http://fdocc.ucoz.com/2/28dc.docx
Updated Nov 27, 2012, 8:35 AM
I just found this great one! As usual it is God's: "Love Rescuing Me" Live at 'The Ginger Man', Dallas, TX, Robert Gotcher Band: http://www.youtube.com/watch?v=iZ9EHxyKYAk
Updated Nov 14, 2012, 5:14 PM
I think it's time to put pressure over a selfish and self-serving U.S. Congress by enacting 'the Warren Buffet' method or a related variant of it: http://www.youtube.com/watch?v=cHdwFp-kJ5w
Updated Nov 12, 2012, 5:06 PM
A recent visual work, to be properly informed now and then: http://fdocc.blogspot.com/2012/10/a-visual-mormon-reproof.html
Updated Oct 31, 2012, 4:37 PM
The Royal Society has all his journals open for free until the 29th of November: http://royalsocietypublishing.org/ It includes articles such as this on "Fractal Geometry": http://rspa.royalsocietypublishing.org/content/423/1864/3.full.pdf+html?sid=3e51bf90-e0a2-44c6-a204-06c7424bac10
Updated Oct 30, 2012, 4:47 PM
Fernando Castro-Chavez wrote on Adriana Cecilia Vargas Alzaga's timeline.
"Gran gusto el verte, y a tu esposo"!, dice mi mamá, desde que te vio en la fiesta de Ale, hasta el café en tu casa, "una de las sobrinas más estimadas"; siempre con tu gran carácter, deseando lo mejor, y a tu inteligente niño entrando en su adolescencia.
Thomas Cleveland recommended the next beautiful song about the "Return of Christ", by a father and son:
http://www.youtube.com/watch?feature=player_embedded&v=7uGzQfkMIXE
http://www.youtube.com/watch?feature=player_embedded&v=7uGzQfkMIXE
Updated Oct 27, 2012, 11:22 PM
http://www.academia.edu/2060560/Pastor_pastor_what_is_the_Lamb_of_God_in_the_purported_Pre- Columbine_America_of_the_Book_of_Mormon_if_there_were_no_domestic_sheep_at_that_time
This is my most recent study: http://tinyurl.com/9cou57m
Updated Oct 26, 2012, 10:50 PM
My work from Bio-complexity where we see how the 64 components of the Genetic Code perfectly fit into a 3D tetrahedron, having the start at the angular top, the three angular ends at the bottom with the hydrophobic codons fitting at the center of each face: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3445437
Updated Sep 24, 2012, 10:18 AM
Finalmente, mi segundo trabajo en 'Neuroquantology' para el mundo libre, ha aparecido!: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3445418
Updated Sep 18, 2012, 6:09 PM
This 09/11, I remember our NY first responder heroes with a song of victory that defeats adversities and enemies either open or concealed: http://youtu.be/1ubL4jnqEm8
Updated Sep 11, 2012, 7:30 AM
1ero. de septiembre del 2001, ¡nos casamos!; nuestra canción en español fue: http://www.youtube.com/watch?v=1s3BIX0duKs Gozamos de la presencia de mis hermanas, una de ellas la cantó; también asistieron @[683653951:2048:Aida Castro-Snyder] y su esposo @[1426792736:2048:Edward C. Snyder] , Javier y Benny, Ruth (mamá de @[589539504:2048:Lisa Rogers Brown]), y la familia: @[1173726568:2048:Ronnie Petree], @[1038774784:2048:Melinda Beck Petree] y su hija; pongo los nombres de los testigos de mi boda para confirmar mis votos.
Updated Aug 29, 2012, 6:30 PM
This was another (the inst.) of our wedding: "Through the eyes of Love". @[100000434572356:2048:Sheila Hitchcock] was also there, and @[1225281381:2048:Keith Duncan], girl and mom, DeAnne @[100000111533430:2048:DeAnne Thompson Gabel] and John, it was at the house of @[100001169784553:2048:Michael Lindsey], @[100001239946731:2048:Annette Meador Lindsey] (bridesmaid), and @[507099117:2048:Sarah Schindler], music put together by @[1415462595:2048:Mike Mandi Ackerman], Thanks! http://www.youtube.com/watch?v=thW967KaAng
Updated Aug 27, 2012, 9:05 AM
My @[1218645485:2048:Tracy Duncan], 09/01/01, our English song! "You Make Me Feel Brand New", it says: "God bless you, you make me feel brand new for God bless me with you". @[1790955346:2048:Robert Houk Hitchcock] presided, my in-law nephew @[537035117:2048:Scott Anderson] was there with his parents (congrats! U'r next!), one being @[1029960885:2048:Ellen Anderson], while @[1796536970:2048:Regina Kapta] was filming! {Next week... our Spanish wedding song!} http://www.youtube.com/watch?v=lt4Gftj8OR4
Updated Aug 24, 2012, 8:25 AM
Our fellow sister in Christ, Virginia's double gold medalist Gabby Douglas glorified God in prime-time TV (NBC), first by saying that her source of comfort was the Bible before the team's finals, and later by declaring that her objective was to give glory to God, and by doing that, that she was reaping His blessings; after her last individual victory's ceremony, "Chariots of Fire", honoring an earlier believer, was heard on the Olympic speakers: http://www.webcitation.org/69do7lANd
Updated Aug 3, 2012, 7:22 AM
Sorprendente hallazgo del Arca de Noé por Ron Wyatt (1977), en cinco episodios: http://www.youtube.com/watch?v=mKasxNlCD8Q Las 12 rocas descubiertas parecen haber sido algunas de sus anclas; de las más impresionantes, 2 estaban grabadas con el arco, el arca, y los ocho sobrevivientes (alguien las tomó), la otra tenía pintada el arca, los montes y un par de cuervos aparentemente secuenciales.
Updated Jul 16, 2012, 1:39 PM
Fernando Castro-Chavez posted in Damas y Chambelanes de XV años de Ely, Ruth, y Aida.
Que se la pasen bien celebrando y conmemorando esos gratos momentos!
Dear @[100001535731331:2048:Raul Martin Cruz-mireles], on searching for megalithic evidence of Noah's flood equated to the last ice age, I found 'Gobekli Tepe', Turkey; a Biblical Archaeologist, Ron Wyatt, a male nurse who loved God, discovered similar structures earlier and was dismissed by dear believers, including Christian ex-astronaut James B. Irwin: http://www.youtube.com/watch?v=yTATYo1v0FU [Sadly, human arrogance here exemplified by Andy Collins prefers the imprecise human dating (C-14, preconceptions, etc.) instead of the Biblical Chronology...]
Updated Jul 12, 2012, 8:01 AM
Thanks to my friends & family! This is my most recent article that may interest you, specially to the researchers of Chinese ancestry like @[1222042:2048:Jennifer Jiang] and @[1073575351:2048:Merry Ruan]: Castro-Chavez F. Defragged Binary I Ching Genetic Code. JPSCB 2012, 1-24: http://dx.doi.org/10.7243/2050-2273-1-3
Updated Jul 5, 2012, 8:16 AM
Ef. 6:17 "... tomad el yelmo de la salvación, y la espada del espíritu, que es la Palabra de Dios."
Eph. 6:17 "... take the helmet of salvation, and the sword of the spirit, which is the Word of God": http://www.youtube.com/watch?v=ZdAgZom887g&feature=player_detailpage#t=266s
Eph. 6:17 "... take the helmet of salvation, and the sword of the spirit, which is the Word of God": http://www.youtube.com/watch?v=ZdAgZom887g&feature=player_detailpage#t=266s
Updated Jun 25, 2012, 10:52 AM
Juan 6:68-69: "Le respondió Simón Pedro: Señor, ¿a quién iremos? Tú tienes palabras de vida eterna. Y nosotros hemos creído y conocemos que tú eres el Cristo, el Hijo del Dios viviente": http://www.youtube.com/watch?v=NGicSWGmjQQ
Updated Jun 22, 2012, 8:11 AM
Quizás nosotros muramos algún día (si Cristo no viene antes a transformarons), pero "Dios Nunca Muere"! = Maybe we'll die some day (if Christ does not come before to transform us), but "God Never Dies"!: www.youtube.com/watch?v=jef91vP4ErY I'll take a break for a week! See U saints!
Updated Jun 8, 2012, 4:48 PM
Hace 50 años = 50 years ago... [Music: Waltz from Mexico's 'Belle époque': "Dios Nunca Muere" ["God Never Dies"] of 1868, by Macedonio Alcalá (1831-1869)]. |
Place: Ciudad Guzmán, Jalisco (19.6833, -103.483)
Address: Ciudad Guzmán, Jalisco, Mexico
Hace 50 años = 50 years ago... [Music: Waltz from Mexico's 'Belle époque': "Dios Nunca Muere" ["God Never Dies"] of 1868, by Macedonio Alcalá (1831-1869)].
May God Enlighten You to Fully Understand the Hope of His Calling! My Work Notes on "After Our Rapture": http://fdocc.ucoz.com/after_our_rapture_v.2.pdf
Updated Jun 8, 2012, 1:51 PM
"The Work", Prince: http://www.youtube.com/watch?v=zYb_Kl-qKcI
"the reason we were born that is 2 b the living truth in human 4m."
"the reason we were born that is 2 b the living truth in human 4m."
Updated Jun 7, 2012, 8:16 AM
Un regalo de cumpleaños para un estudioso de la historia: http://archive.org/details/The13thTribe Especialmente p. 47; las referencias allí mencionadas también se encuentran gratuitas para descarga: Tudela, Geniza, Disraeli, Baron (en parte), la que no encontré es la del Yahya.
Updated Jun 6, 2012, 12:37 PM
"My Saving Grace", Mariah Carey at Oprah Show (2002): http://www.youtube.com/watch?v=6X0MPpNu30w
Updated Jun 6, 2012, 11:36 AM
"Blessed", by Martina McBride: http://www.youtube.com/watch?v=4LS9Mgd8vqA
Updated Jun 5, 2012, 9:44 AM
"Pray", by Rev. MC Hammer, of "U Can't Touch This" fame: http://www.youtube.com/watch?v=7xNSgBkum7o
Updated Jun 4, 2012, 7:56 AM
This is a powerful reminder that our current life is like an instant that will open to eternity, the revealed mystery is that it is God in Christ in you, also called the gift of holy spirit and your salvation, our glorious hope: "This Is Your Time" (Remembering Cassie Bernall, who refused to deny God in the face of death): http://www.youtube.com/watch?v=4Ric6w2ERTg
Updated Jun 1, 2012, 6:54 PM
Porque, "no depende del que quiere, ni del que corre, sino de Dios que tiene misericordia" (Rom. 9:16), eres solamente Tú, Oh Dios, quien nos restaura a nuestras alturas: http://www.youtube.com/watch?v=lC_CXjgrtOw Otros versos dicen que no es del fuerte la victoria y que sin Dios, en vano edifica el sabio.
Updated May 31, 2012, 5:47 PM
Porque los creyentes renacidos nos vamos al cielo por unos 7 años para regresar a derrotar por completo al Anticristo, "I Can Only Imagine", por MercyMe w/ London Symphony Orchestra: http://www.youtube.com/watch?v=K_OB7d-B1Vw
Updated May 29, 2012, 9:06 AM
Spiritually we are born again at the very moment that we confess Jesus as our Living Lord and Savior, we receive the gift of holy spirit, our blessed assurance of our future transformation into immortals!: "...when I'm born again, you're gonna see a change in me. God made me for a reason and nothing is in vain" "oh give me some direction Lord, let me lean on you": http://www.youtube.com/watch?v=uVaulNC9_s0
Updated May 28, 2012, 3:01 PM
"When The Saints Go Marching In", it's all about resurrection, all about the victorious Kingdom of the Real King Jesus Christ!, and all about the New Earth! Bruce Springsteen, Marc Thompson, and Patti Scialfa, Bruce's wife (& E-Street band member since 1984) sing: http://www.youtube.com/watch?v=r_Nrl-5Ker4
Updated May 25, 2012, 4:06 PM
So, when we feel that we are losing it, we need to remember that we are children of the Owner and Creator of the whole universe, so "He's got the whole world in His hand", by Tanya Tucker: http://www.youtube.com/watch?v=guyrERfsCB8
Updated May 24, 2012, 5:04 PM
This one is "The Word", by Prince: http://www.youtube.com/watch?v=3rzbq1Fel6o He asks: "Don't u wanna go get saved?", "Don't u wanna know (hear) the word?", "Don't matter how far u have 2 the truth has got to be told don't matter how shiny ur lips they'll never b streets of gold", a call to humility.
Updated May 23, 2012, 4:28 PM
Then, "Oh Lord I'd be lost, But for the grace of God (go I)" in Keith Urban's 1st #1 U.S.A., co-written by 2 of "The Go Go's", Charlotte Caffey & Jane Wiedlin: "But For The Grace Of God": http://www.youtube.com/watch?v=R-s7C58R0DM
Updated May 22, 2012, 7:57 AM
"Red Dirt Road", Brooks & Dunn. Here they sing that Brooks found Jesus after a car accident, that he did learn that the path to heaven is full of sinners and believers (Because it's all by grace when accepting Jesus as Lord!), and that happiness on earth ain't just for high achievers (being such an inner work within the believer): http://www.youtube.com/watch?v=xP3UwsDB_W0
Updated May 21, 2012, 7:48 AM
Otra canción coral de las que cantaba en mi infancia parroquial, esta se refiere a la segunda venida de Cristo, a quien esperamos con un gran gozo: Ven, "Ven Señor No Tardes", Coro juvenil San Jose: http://www.youtube.com/watch?v=0xFhIbN5epE
Updated May 18, 2012, 7:57 AM
Una de las viejitas que cantábamos en el coro de nuestra adolescencia, aquí interpretan el joven Enrique Guzmán y Estelita: http://www.youtube.com/watch?v=c-u3TkV0UX0
Updated May 17, 2012, 7:54 AM
Esta es una grabación casera que nos recuerda que estamos totalmente en Sus manos: "El Alfarero", por Beatriz Adriana: http://www.youtube.com/watch?v=cM9huFh5fRQ
Updated May 16, 2012, 8:05 AM
Aquí, en otra canción con Mariachi, "Jesus es mi Pastor", en voz de Leo Dan y el Mariachi Monterrey de Arequipa: http://www.youtube.com/watch?v=bbpO4TLfewI
Updated May 15, 2012, 7:54 AM
Yuri nos recuerda cantando con el Mariachi tan Mexicano: "Que Tu Fe Nunca Muera": http://www.youtube.com/watch?v=uFq1XLzt3Og
Updated May 14, 2012, 8:08 AM
For those wonderful mothers: http://www.ksat.com/news/SA-kids-share-Mother-s-Day-wishes/-/478452/13096238/-/6ny6yy/-/index.html
Updated May 13, 2012, 10:25 AM
Rock ParAdita, una de sus guitarras favoritas de la infancia, Gary Moore (R.I.P.): "The Messiah Will Come Again"(guitarra instrumental, 1990, live, bajar volumen, comienza con sonoros aplausos): http://www.youtube.com/watch?v=EtF-An9wFLk
Updated May 11, 2012, 9:59 AM
Un regalo para las madres, uno de los temas favoritos de mi mamá: "Cristo esta conmigo", canta el grupo "Mi roca y mi salvación". Después de 4:45 se vuelve más íntima y suave: http://www.youtube.com/watch?v=3kEXrp-ZiBI
Updated May 10, 2012, 8:19 AM
As my wife reminded me, we need to always cling to Our Hope, no matter what, in riches or in their lack; some of its aspects are sung here: http://www.youtube.com/watch?v=leFeWxV8EUA
Updated May 9, 2012, 8:16 AM
Remembering our Abundant Life from within, "Beautiful, Loved and Blessed", Tamar ft. Prince: http://www.youtube.com/watch?v=Eh54Fh6DdNw
Updated May 8, 2012, 7:47 AM
After our victories from the storms of life, triggered sometimes by "well-intentioned" relatives & friends, like a Peter telling Jesus not to allow his capture, even when that was the path for our salvation, we shout "Aleluya", by a Puerto Rican Christian: http://www.youtube.com/watch?v=Mr1lmqoS6Kk
Updated May 7, 2012, 7:46 AM
When everything around you seems to be falling apart, as that old lady's testimony mentioned by Amy Grant at the beginning, it's very sobering to remember that the one thing that remains forever is The Word of God; she sings inspired by Psalm 119:105, "Thy Word": http://www.youtube.com/watch?v=CSZlIVP9u0Y
Updated May 4, 2012, 7:44 AM
Esta la cantaban frecuentemente en el "Instituto de la Vera-Cruz", donde estudiaron mis hermanas: "Dominique", Angélica María: http://www.youtube.com/watch?v=ZJfov2Y1HFA
Updated May 3, 2012, 8:15 AM
Fernando Castro-Chavez updated his status.
When my wife Tracy was living in Thailand, she used to sing this song all the time while going to the beach; this one emphasizes the first coming of Christ:
"Go Tell It On the Mountain": http://www.youtube.com/watch?v=Fo27s_TjPeQ
"Go Tell It On the Mountain": http://www.youtube.com/watch?v=Fo27s_TjPeQ
Mi mamá me recordó que ayer fue el día del niño y que ella vió: La Montaña (Te Agradezco Señor) de la película "El niño y la Estrella", donde canta el niño Alejandro Uriegas y amigos: http://www.youtube.com/watch?v=zgFXyYgad2g
Updated May 1, 2012, 12:55 PM
Luego, cuando era niño, vi la siguiente melodía que se me quedó grabada en un programa de "Disneylandia": "Doy Gracias al Señor", Juanito Manzanas: http://www.youtube.com/watch?v=d7enSaOklBE Quien trabajaba duro sabiendo que solamente de su Señor recibiría la tan anhelada prosperidad.
Updated Apr 30, 2012, 12:00 PM
A member of the American Olympic Team (approved by Jackson Scholz) slipped a piece of paper into Liddell´s hand including a quotation from 1 Sam. 2:30: "Those who honor me, I will honor": http://www.youtube.com/watch?v=uwyltmUR3MU
Updated Apr 27, 2012, 11:28 AM
Liddell estuvo ausente en los 100 Mt. para dar lugar al triunfo de su conciudadano judío Abrahams, quien basó el resto de su vida en ello; así mismo, cuando estemos ausentes, una generación de creyentes en Jesús surgirá de los judíos en el Apocalipsis. Aquí, Ian Charleson cual Liddell predica al pueblo; mensaje escrito por Ian: http://www.youtube.com/watch?v=7yoDE-3dTvU
Updated Apr 26, 2012, 8:05 AM
The Christian saint Eric H. Liddell, Episcopal Missionary and Olympic gold medalist in the 1924's Paris VIII Olympics decided to take the pulpit on Sunday instead of competing for his 100 Mt. specialty, giving opportunity to win to another fellow athlete, the Jew Harold Abrahams; here, on that day, he reads Is. 40 https://youtu.be/ZjF59VB0h6g
Updated Apr 25, 2018, 7:16 AM
Aquí "El Milagro", por Yuri: http://www.youtube.com/watch?v=IW-SfL2H2_E "He aprendido la lección del amor divino que me transformo cruzándose en mi camino
Y que dio a mi vida entera otro sentido, otra meta y otro fin... Se lo que es la gracia y el perdón, su misericordia es mi canción."
Y que dio a mi vida entera otro sentido, otra meta y otro fin... Se lo que es la gracia y el perdón, su misericordia es mi canción."
Updated Apr 24, 2012, 8:19 AM
Rick Springfield, of "Jessie's Girl" fame, here singing his earlier "Speak To The Sky": "When you are talking to the Lord, the world will be better than before... the world will be better from up there", noticing that "the" is "your" own: http://www.youtube.com/watch?v=j_rP5XTo6bU
Updated Apr 23, 2012, 7:54 AM
Qué Hermoso Es! : http://www.youtube.com/watch?v=l76mBRQp_74 Con imágenes del Festival Musical del 2010, una bendición el convivir con santos creyentes de todo el mundo, de estudiar la Palabra, y de escuchar sus composiciones musicales alabando a Dios o enseñando a la Familia de Dios...
Updated Apr 19, 2012, 5:12 PM
La jarocha del "Qué te pasa", del "Dame un beso", y de muchas otras que nos gustan, la Yuri, cuando ella aceptó a Cristo, sanó de todos sus males y compuso su "María Magdalena": http://www.youtube.com/watch?v=y5S4saKKMSk
Updated Apr 18, 2012, 5:54 PM
Cuando el Dominicano de la "Bachata Rosa" y de las "Burbujas de Amor" aceptó a Cristo, su enfoque central fue en el del poder sanador del Jesús resucitado que vive en el cielo ayudándonos mediante su regalo de espíritu santo: "Ven Tócame", cancion de sanidad de Juan Luis Guerra: http://www.youtube.com/watch?v=Qk_W07GVXpw
Updated Apr 18, 2012, 7:53 AM
Si ahora nos vamos a lo prehispánico para alabar a Dios, aquí la primera parte del Salmo 19 "Los Cielos Cuentan la Gloria de Dios", por la Iglesia Cristiana "Misión": http://www.youtube.com/watch?v=0XqT8j0WR9c
Updated Apr 17, 2012, 7:59 AM
Allow me some international with: "Hine Ma Tov", by children of the "Kepong Chinese Methodist Church", another song of David paraphrased by King Ezekiah for his Psalm of Degrees 133: http://www.youtube.com/watch?v=LC3_T1qzMXY The Chinese kids sing in Hebrew: "Hine ma tov umanyim, shevet achim gam yachad".
Updated Apr 16, 2012, 8:10 AM
"Are You Washed In The Blood/I'll Fly Away", by Alan Jackson, for those holy saints that were at the famous 'Grand Ole Opry', Nashville, TN. Interesingly, the same disclaimer noticed for the Punk "Spirit in the Sky" and the Mariachi "God Never Dies" ('Dios Nunca Mere'), needs to be done also for this old Church Classic Christian song: It's from the P.O.V. of the one departing, but not from the ones that stay: http://www.youtube.com/watch?v=R52heyok9Ps
Updated Apr 14, 2012, 6:59 PM
@[704832104:2048:Tom Cleveland] reminded me this week that: After defeating time after time and only by the grace of God, the attacks of the adversary, we kneel and thank God, telling him: "How Great thou Art", by Carrie Underwood & at the guitar, Vince Gill (husband of Amy Grant): http://www.youtube.com/watch?v=pLLMzr3PFgk
Updated Apr 14, 2012, 8:04 AM
Mi mamá me recordó hoy que: "Por fuerte que sople el viento, permanece el firmamento; en Dios seguro y contento, ¡no cederé al desaliento!" (mi paráfrasis al Salesiano José L. Carreño), ya que "Hay una Respuesta": http://www.youtube.com/watch?v=k-Nnan5bUQ4
Updated Apr 13, 2012, 9:29 AM
So, the balance between works and grace is to think that every good work that we do according to God will account for exceeding recompenses for us! (And vice versa), as one more casting his lot with Jesus told us; Paul Anka's "Jubilation", by the Mexican 'Banda Old Days': http://www.youtube.com/watch?v=kr1lRS2M33k
Updated Apr 12, 2012, 10:22 AM
That was then, however, the revolutionary N.T. affirms that no matter how many mistakes you are making in a daily basis, if you accepted Jesus as your Living Lord, you are saved only by grace! No matter what! So, "I have Decided", by an adolescent Amy Grant: http://www.youtube.com/watch?v=aLIG3_I8FJE
Updated Apr 11, 2012, 7:59 AM
O.T. hints: Did you Rob? Did you Repent? Did you Restore?... so we hear: "I believe God but I do not believe men", however we all are men! So, we better do what Josh Turner, the best U.S.A. bass (i.e., 1:40) sings in this "cell-phone" version of the great "Me and God", comp. by the "constant sorrows" tiny voice of Ralph Stanley: http://www.youtube.com/watch?v=36cg63z3PRM
Updated Apr 10, 2012, 7:50 AM
Como le comenté a mi hermano en Cristo @[1499774924:2048:Hazaelo DeJesús], esto lo escribe un creyente Argentino: http://www.scribd.com/doc/54480462/Cristo-nuestra-pascua-Parte-1-1 y esto lo transcribí yo, enfatizando la victoria: http://fdocc.ucoz.com/index/el_dia_en_que_cristo_resucito/0-45
Updated Apr 9, 2012, 8:08 AM
Fernando Castro-Chavez updated his status.
Así como tenemos el poder de hablar en lenguas en nuestro santo espíritu, también tenemos el poder personal de conmemorar por nosotros mismos el cuerpo partido de Jesús representado en el pan para una milagrosa sanidad física, y su sangre derramada representada en el vino, para recordar el perdón de nuestros pecados, ya que el mismo Jesús sanador y perdonador, sigue vivo en el cielo, y le gusta mucho cuando recordamos esa ofrenda que tanto le costó, 1 Cor. 10:16-17, 1 Cor. 11:23-31, él nos pide recordar cuidadosa y claramente su ofrenda...
Esta es otra versión más moderna de la introducción del segundo Salmo de los Grados del Rey Ezequías: "Qué alegría" por Christus Vocis: http://www.youtube.com/watch?v=OtScn0Cv0C0
Updated Apr 5, 2012, 7:57 AM
Luego, después de Sheila, RC, JLR y JS, otros cantos que recuerdo haber escuchado a temprana edad son algunos de los "Salmos de los Grados" (2 de ellos más abajo): http://www.expresionespiritual.org/biblioteca/0026B-Los-Salmos-de-los-Grados-Salmos-120-134.html
Updated Apr 4, 2012, 7:57 AM
La siguiente canción me motiva a introducir el estudio de más abajo, para que los lectores lo expandan, ya que la Palabra de Dios da vida y muestra Su amplio plan de salvación, no solamente a los cristianos, sino también a los no cristianos: "Tu palabra me da vida": http://www.youtube.com/watch?v=6Jsg1PAWZjM
Updated Apr 3, 2012, 8:43 AM
@[1499774924:2048:Hazaelo DeJesús] me hizo ponerme a pensar en cuales serían las canciones específicamente religiosas que más me gustan desde mi infancia; creo que la primera de todas sería: "En Jesús puse toda mi esperanza": http://www.youtube.com/watch?v=I-A8LtGtrbM
Updated Apr 2, 2012, 10:20 AM
El título de esta canción es verdadero: "Dios Nunca Muere", por Javier Solís: http://www.youtube.com/watch?v=0wZPVeov6OE "todo aquel que llega a morir empieza a vivir una eternidad", ésto, como cuando puse "Spirit in the Sky", entendido desde el punto de vista del que fallece, no del de los que aún viven.
Updated Mar 29, 2012, 7:16 AM
Esta de "Se Busca", por José Luis Rodriguez, la escuché por primera vez tarareada por mi primo Toño de la T. en la sierra en mi adolescencia, quien repetía una y otra vez la frase: "Búscalo!": http://www.youtube.com/watch?v=1XL_wlRzIgg Hasta donde sé, Jesús tenía 30 años cuando ofreció su vida por tí y por mí.
Updated Mar 28, 2012, 7:22 AM
Fernando Castro-Chavez updated his status.
Luego, cuando comenzaba a crecer escuché "Jesucristo" [4:57], aquí interpretada por Yuri: http://www.youtube.com/watch?v=ytz11eSF1WM
La siguiente la escuché a mis cinco años de edad y se me quedó grabada como algo relacionado con Jesús a quien yo necesitaba seguir por el resto de mis días: http://www.youtube.com/watch?v=HasClzMooDY Hoy yo les llamaría los "Sabios"
Updated Mar 26, 2012, 8:11 AM
"Feast of Trumpets", by George Saint George, believer from the fellowship of Michael Lindsey, Annette @[100001239946731:2048:Annette Meador Lindsey], @[507099117:2048:Sarah Lindsey] and @[100000917566677:2048:Justin Schindler]. Geo'll perform the world premiere of his latest march: “The Throne of Grace” in a free concert in the ´Alvin Community College´ theater, Thu. 03/29/12, 7:30 PM: http://www.youtube.com/watch?v=53_10GfaN4c
Updated Mar 23, 2012, 7:02 AM
Fernando Castro-Chavez wrote on Rocio Villegas Albarran's timeline.
Estimada Chío, Orando para que todo vaya bien por allá después del temblorcillo. En Cristo, Fernando Castro-Chavez.
Fernando Castro-Chavez updated his status.
A fusion of Bach's Classic, "Jesus Joy of Man's Desiring", by Celtic Woman (courtesy of PBS): http://www.youtube.com/watch?v=IVh0-jenY6s
Classics recognizing the greatness of Jesus! [I saw other version by Sissel Kyrkjebø at the FB of @[100001535731331:2048:Raul Martin Cruz-mireles], to him & friends and family in Mexico, we wish the best after today's earthquake!]: Jesus bleibet meine Freude (lit. "Jesus is my Joy"), J.S. Bach, BWV 147-7: http://www.youtube.com/watch?v=3Mn1ibFdXDU
Updated Mar 20, 2012, 6:10 PM
When you feel like the lowest of sinners, remember "Amazing Grace", this one a capella by LeAnn Rimes: http://www.youtube.com/watch?v=aHugDOFupOM Song also showing the intimate realtion of God with you. It is not the group or the institution, it is your own personal walk with the Word of God.
Updated Mar 20, 2012, 7:33 AM
Kool and The Gang, Celebration (1980): http://www.youtube.com/watch?v=rw1P7gdtAeY In 1982 believers of the group "New Horizons" recorded it as part of their W.O.W. (Word Over the World), in BP, McS used it to do Squats (the DJ BoBo version).
Updated Mar 19, 2012, 7:57 AM
The purpose of these songs is to bless you, even when none of them are as perfect as when you sing in tongues! But when you feel like touching rock bottom, GOD is still there reminding you that: You still are His light of the world, so "Shine" by Paradiso. My wife does chest with this one, a McS BP choice hard to found elsewhere: http://www.youtube.com/watch?v=NMfTzDJz-J0
Updated Mar 16, 2012, 6:57 AM
Celine Dion & Andrea Bocelli, The Prayer (1999), my gprgeous ex-wife and best friend @[1218645485:2048:Tracy Duncan] does "Cooldown" with this BP McS choice, "guide us with your grace"... remembering that the best prayer is in our spiritu, by speaking in tongues, the perfect one: https://www.youtube.com/watch?v=pb8Z_6HVutk
Updated Mar 15, 2012, 6:47 AM
This one: http://www.youtube.com/watch?v=JyWncQMcPwg "Clean & Press" a BP exercise, McSweeney's choice. Remember that to "Pray" is a Conversation with GOD, you talk, then you expect His response.
Updated Mar 14, 2012, 7:46 AM
From the good friends of Billy Falcone, unplugged, "Livin' on a Prayer", Bon Jovi: http://www.youtube.com/watch?v=8VxVI8dja-0 Recently used, the plugged version in "Body Pump" to do my favorite excercise. biceps.
Updated Mar 13, 2012, 7:53 AM
My Tracy teaches 'chest' with this great song selected by McSweeney: "Sing Hallelujah", Dr.Alban ft. Yamboo (2005). Hallelujah in context is "Praising to God", so 'Sing Praising God'!: http://www.youtube.com/watch?v=nY_g8eCvkp8
Updated Mar 12, 2012, 6:42 AM
To my @[1218645485:2048:Tracy Duncan] in her day, 'oh yes, there can be Miracles "When You Believe" (Mariah Carey & Whitney Houston)', song from "Prince of Egypt", about Moses, the believer: http://www.youtube.com/watch?v=eAM2-hg7xJs
Updated Mar 9, 2012, 7:48 AM
Fernando Castro-Chavez updated his status.
With this one my Tracy Duncan does biceps, "Spirit In The Sky" by Gareth Gates, this also was in the old McSweeney's "Body Pump": http://www.youtube.com/watch?v=DVe3K2KVg_0 To be understood from the point of view of the asleep Christian but not from the P.O.V. of the ones still around
(Update March 2016:) My dear friend and ex-wife @[1218645485:2048:Tracy Duncan] does lunges with: Funky Green Dogs, "Rise Up", included by Michael McSweeney in the "Body Pump" workout: "Rise up, put your faith in Jesus, Rise up, he's got the power to heal us...": http://www.youtube.com/watch?v=6Mmfw0s-2a0
Updated Mar 7, 2012, 7:54 AM
Another classic piece by The Byrds, "Turn Turn Turn" (1966), based on the O.T., Eccl. 3: http://www.youtube.com/watch?v=fg73MRomwSA
Updated Mar 6, 2012, 7:51 AM
This song was very popular in the Country radio stations of Texas, Josh Turner and Randy Travis, Long Black Train: https://www.youtube.com/watch?v=PyRZTAmcW7c "There's victory in the Lord I say, victory in the Lord, claim to the Father in his holy name..." (1:02)
Updated Mar 5, 2012, 7:56 AM
Watching, by @[1363921798:2048:Sal Arico], "For he'll be gathered in the clouds, and so shall he ever be with his Lord" (3:17): http://www.youtube.com/watch?v=Plo5WBTyfjQ
Updated Mar 2, 2012, 8:03 AM
Resurrection in Budapest, Hungary (2010): http://www.youtube.com/watch?v=SymvsnAOnL0 Remembering that God raised Jesus at the Sabbath's end, a 17th of Nisan, after 72 hours of being on the grave.
Updated Mar 1, 2012, 8:00 AM
And in a leap of hope, Houston danced for our Risen Savior Jesus, ending leaving their tennis on the ground in allegory of our own and collective departure when he comes for us! "Rise up" by Lyle Countryman (& thanks for the Job Fair!): http://www.youtube.com/watch?v=8KX2-J6uS-o
Updated Feb 29, 2012, 7:52 AM
Up to Faith! Dancing for Jesus before our great departure: "Tune in for, you've got the power, the faith to believe, The key that in this crucial hour, you need to receive" (2:10), from: http://www.youtube.com/watch?v=IRaUnR1XtgQ
Updated Feb 28, 2012, 8:04 AM
Updated Feb 27, 2012, 8:35 AM
Brooks and Dunn, "Believe": http://www.youtube.com/watch?v=Z9-FQMxO_-Q
Updated Feb 24, 2012, 8:15 AM
"Rivers of Babylon",a popular song in my adolescence (the 70s), by the history-themed disco Islanders gathered by someone from the 'Europop', Boney M, based on Ps. 137, notice the words: "Let the words of our mouth and the meditations of our heart be acceptable in Thy sight...": http://www.youtube.com/watch?v=Nm1g8FFRArc
Updated Feb 23, 2012, 8:31 AM
One 'Doobie Brothers' version of "Jesus is Just Alright" (4:41) after "Takin' it to the Street" at Sta.Barbara (1982). Jesus is what keeps us as individuals and Nations from falling apart into pieces, they added: "Jesus, he's my friend, he took me by the hand, led me far from this land": http://www.youtube.com/watch?v=zob0j9xpX6w
Updated Feb 22, 2012, 8:02 AM
This is the testimony by Glen Campbell, his song "Jesus and Me" (2:39): http://www.youtube.com/watch?v=tBKodIRDGkw [Pray for his life].
Updated Feb 21, 2012, 7:55 AM
Reminding us of our collective departure from this world, "Fly Like a Bird" by Mariah Carey (2:40). Notice her initial Grammy's testimony, only Jesus and gospel music uplifted her, then the Scriptures by the preacher (Ps. Psalm 30:5b), and the statement by Teri Hatcher w/ M. Buble: https://youtu.be/f1SzYjdg8GU
Updated Feb 20, 2012, 8:10 AM
A song from the 70s that seems written yesterday. Forgiving 'real enemies' is a hard thing to do, as Brian Bliss and the "Joyful Noise" portray in "Wake Up America"! i.e., can you forgive the 9/11 perps.? Those wealthy experienced men in covert operations? Those foreign owners of the media, of whom we barely hear anything. Got their ID? Keep it to you while praying spiritually in tongues for you and me (S.I.T.): http://www.youtube.com/watch?v=BBMIe6AgJ8A
Updated Feb 17, 2012, 7:49 AM
Fernando Castro-Chavez wrote on Kayano F. Shiomi's timeline.
Dear Kayano, many hugs and kisses by my Tracy and me from Houston!!! Praying for your well being and the one of your dear family. Sincerely, Fernando.
By the beautiful starter of the Christian music movement in the U.S.A., Amy Grant, praising the greatness of God and some of His Names: "El Shaddai"!, a song my wife sometimes uses at the end of her classes, leaving His notes in their hearts (lyrics there): http://www.youtube.com/watch?v=jy5XA4SwuPg
Updated Feb 16, 2012, 8:05 AM
To our young saints (and who of us isn't?), a remake of the Celestial Choir's "Stand in the Word"; the video tells: "Oh, that we could transform our surroundings with our holy spirit!": http://www.youtube.com/watch?v=7qXa7Ppopgs
Updated Feb 15, 2012, 10:24 AM
... And also this one too, by Toby Mac, "Made to Love": http://www.youtube.com/watch?v=V2NDIq82H5s Happy Valentine's Day!
Updated Feb 14, 2012, 8:09 AM
This one I heard in my lovely ex-wife's signature class, her "Major Tone Up"; this is the live version of the Christian song "Shackles", by the dynamic ladies of the group 'Mary Mary', with soul...: www.youtube.com/watch?v=tC6vm1942v0
Updated Feb 13, 2012, 11:57 AM
The Deceivers of this world may think that they "got away" in this life, but here, beautiful Faith Hill, wife of Tim McGraw, boldly reminds us that "There Will Come A Day"! Thank you Jesus!!!: http://www.youtube.com/watch?v=VojyZW6O3I8
Updated Feb 10, 2012, 8:04 AM
And this one is by @[1634423943:2048:Joe Fair], and colleagues: "Let your Light Shine": www.youtube.com/watch?v=hPU4GYXrKfg
Updated Feb 9, 2012, 7:51 AM
Also, filmed and edited by @[1591850013:2048:Sky Wood], Rachel Barbera singing "Ain't A Whisper", with guitar accompaniment by @[1397941891:2048:Scott Powell]: http://www.youtube.com/watch?v=hMbV8ooYKFI
Updated Feb 8, 2012, 10:50 AM
Estimado Hazael y lectores, hoy pueden leer los excelentes estudios Bíblicos de mi colega biomédico @[100001535731331:2048:Raul Martin Cruz-mireles], por ejemplo:
Updated Feb 4, 2012, 10:11 AM
Fernando Castro-Chavez updated his status.
If somebody new wants to be my friend, click on me, I won't deny anybody! (except a spammer and disruptor). I'm unable to do so right now. Yesterday I requested to be friends with an in-law-nephew and before I had requested the friendship of Lane Lester, co-author of the book that inspired me in my earlier career, also co-written by Raymond G Bohlin, I also requested friendship of some "Intelligent Design" supporters... However, today I was greeted by: “Friend Requests Blocked for 7 Days. We received feedback that you sent multiple friend requests to people you don’t know, so you won’t be able to send friend requests for 7 days. To keep this from happening again, please only send friend requests to people you know. I understand that sending friend requests to people I don’t know isn’t allowed on Facebook."
Este es el breve estudio acerca de las diferencias entre una inmortalidad biológica vulnerable, o imperfecta, y una inmortalidad espiritual perfecta, con pleno domino sobre nuestra biología actual: http://fdocc.ucoz.com/contrastandos.pdf
Updated Jan 27, 2012, 8:08 PM
This is the scheme of the study I'll share this Sunday at Michael Lindsey's Fellowship: http://fdocc.ucoz.com/aftermath.pdf
Updated Jan 20, 2012, 1:43 PM
Fernando Castro-Chavez wrote on Lambert Dolphin's timeline.
Your writings inspire me to search deeper on the designs of God.
Fernando Castro-Chavez wrote on Juan P. Chávez's timeline.
Felicidades a mi primo Juan Pablo !
Hazael, gracias por los comentarios. En el siguiente estudio de hace años me llena de admiración hacia la sabiduría de nuestro gran Dios el amor a su hijo, ¡y saber que así se puede investigar cada libro de la Biblia! http://fdocc.ucoz.com/jesgen.pdf
Updated Dec 21, 2011, 11:06 PM
Most recent article: http://www.neuroquantology.com/index.php/journal/article/view/499/455
Updated Dec 15, 2011, 8:43 AM
You tagged Marcela Julia Galarza
A very interesting class about "The Restrainer" by Andy Woods, bright Professor of the 'College of Biblical Studies' of Houston: http://vimeo.com/12211374 As long as you are still here, and if you are a born again one, the Apocalypse can NOT happen! See it to learn why.
Updated Oct 18, 2011, 5:13 PM
Fernando Castro-Chavez updated his status.
Hazael, es interesante lo que comentas. Is. 45:18, sobre el plan de Dios relacionado con la tierra, lo dijo el profeta al Rey Ciro; la referencia a la rebelión de Lucifer en Is. 14:12-17 y Ez. 28:12-19 es para malos líderes políticos y/o teócratas, 1 Tim. 3:6 previene a líderes religiosos, 2 Pe 3:5-6 es para malos líderes religiosos, y Jer. 4:23 es contra una nación perversa.
My article in full on the rules of variation expanded has appeared in PubMed; first I dedicate it to our heroic first responders of the 9/11 WTC, N.Y., and of course, to everyone interested on it. I am sure God will help while we are still in here (smile): http://www.ncbi.nlm.nih.gov/pubmed/21743816
Updated Jul 22, 2011, 6:09 PM
On checking the Cambridge publications for a critical analysis, this was my quick selection of seven interesting articles, here and in its comments below: Early Numerical Analysis in Kepler’s New Astronomy by Steinar Thorvaldsen: http://journals.cambridge.org/action/displayFulltext?type=1&pdftype=1&fid=7153328&jid=SIC&volumeId=23&issueId&aid=7153320
Updated Jul 20, 2011, 5:56 PM
Raúl nos dice: "hasta el día 30 de agosto todos los números de los años 2009 y 2010 de TODAS las revistas especializadas publicadas por la Cambridge University Press (más de 300 en medio centenar de áreas) estarán disponibles de manera gratuita."
Updated Jul 19, 2011, 4:44 PM
Jesucristo es representado en las constelaciones siempre venciendo a aquellas constelaciones que representan al adversario: http://fdocc.blogspot.com/2006/01/hero-for-ages.html
Updated Jul 13, 2011, 5:57 PM
Para aquellos que se interesan en estudiar la historia del estudio de las Constelaciones, algo que traduje al castellano del libro de Bullinger que recomiendo lean cuidadosamente; se puede leer gratuitamente (ver 5 mensajes abajo: "The Witness of the Stars"): http://www.reocities.com/fdocc/bull.htm
Updated Jul 12, 2011, 4:12 PM
For the study of the Word of God written in the sky, the astronomy of God: http://philologos.org/__eb-tws
The constellations start with Virgo (head of the Spynx) and end with Leo (body of Spynx) Virgo. The Virgin. The Promised Seed of the woman. Leo. The Lion. The Lion of the Tribe of Judah aroused for the rending of the Enemy.
The constellations start with Virgo (head of the Spynx) and end with Leo (body of Spynx) Virgo. The Virgin. The Promised Seed of the woman. Leo. The Lion. The Lion of the Tribe of Judah aroused for the rending of the Enemy.
Updated Jul 11, 2011, 9:30 AM
Fernando Castro-Chavez updated his status.
Mariana y Hazael, esto es muy sorprendente: Gn 1:2 "Tinieblas", '¿O no sabéis que hemos de juzgar a los ángeles? ¿Cuánto más las cosas de esta vida?' 1 Cor. 6:3
This is my 2010 article related to the circular genetic code: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3130497
Updated Jul 8, 2011, 10:36 AM
Fernando Castro-Chavez updated his status.
Gn 1:2 tinieblas; cuántos ángeles cayeron? 1/3! Ap 12:4 arrastraba 1/3 de las estrellas=ángeles; Job 38:7 alababan las estrellas. C/ángel con su estrella o planeta y c/renacido también! En resurrección seremos como ángeles (Mt 22:30); 3 ayudaban a Dios: 1/3 Lucifer, 1/3 Miguel=Marte, 1/3 Gabriel=Mercurio. Uno cayó perdiendo puesto y planeta, Jesús=Venus los tomó! Hoy Satán=Saturno. Nosotros reemplazando al 1/3 caído!
Fernando Castro-Chavez updated his status.
Gn 1:2 me hace pensar en la morada de Dios, donde Jesús se encuentra con Él. Sal. 104:3 dice que Dios "establece sus aposentos entre las aguas", Sal. 29:3 "el Señor está sobre las aguas impetuosas", 10 "El Señor tiene su trono sobre las lluvias". Según entiendo, Dios vive más allá del universo, por encima de esas aguas que rodean al universo en dirección de Polaris o Estrella del Norte...
Fernando Castro-Chavez updated his status.
Observación de Gn 1:2 , las 2 fuerzas opuestas ya estaban literalmente "enfrentadas" la una vs la otra: 1) el maligno, convertido en "tinieblas sobre la faz del abismo", en su reto a Dios miraba hacia afuera del universo, al abismo sin fin, mientras que 2) Dios se estremecía de dolor sobre la faz de las aguas que rodean al universo, miraba hacia adentro desde su trono, planeando su total restauración!
Estimada Cecilia, comentarios como los tuyos me ayudan a seguir adelante, muchas gracias! Te recomiendo leer lo que mi colega Raúl publica en el FB, hoy aprendí que Edwin Hubble, alteró su traducción para ocultar el descubrimiento de "la expansión del universo" que el Abad Lemaître realizó antes que él:
Updated Jul 1, 2011, 1:35 PM
Gracias Raúl, "tinieblas sobre la faz del abismo" (Gn 1:2) y las que entraron por mala traducción. La tierra no "estaba" desordenada y vacía, la tierra "quedó" así por Lucifer. En Is 45:18 Dios dijo que no creó a la tierra "en vano" o "tohu" en hebreo, palabra que en Gn 1:2 se tradujo como "desordenada". http://www.therain.org/appendixes/isa4518.html
Updated Jun 29, 2011, 10:07 AM
Fernando Castro-Chavez updated his status.
"God is spirit" (Jn. 4:24), Gn 1:2 says that God's spirit moved upon the face of the waters. These waters are the waters above, outside our universe. God was above the situation. That makes me think that there is a thick 'mono-layer' of water surrounding our universe, like a giant cell, and God is above it!
Fernando Castro-Chavez updated his status.
In Gn 1:2 all problems start, the Adversary is already expelled from his job and position being now in full rebellion. Formerly 'light', now he is “darkness upon the face of the deep”, being the deep those waters outside the universe that in his evil he used to drawn the Earth and the universe, causing the end of the dinosaurs.
Fernando Castro-Chavez updated his status.
“God is light” (1 Jn. 1:5), God’s clothes are light (Sal. 104:2). Light is energy & mass (fotons are attracted by gravity!) God allowed His then closest collaborator, Lucifer, to participate in creation… since Gn 1:1 Lucifer wanted to take-over creation excluding God, Who fired him, calling him Satan, Devil, Demon, Serpent, Adversary… Satan in rage ruined the Universe, flooding everything causing the 1st glacial age.
Fernando Castro-Chavez updated his status.
Estimada Mariana, yo me enfoco a orar a diario con mi esposa por las noches y brevemente por las mañanas; personalmente, recuerdo y/o leo la Biblia a diario, y de ser posible, con mi esposa. Oro en el espíritu (en lenguas) lo más que puedo durante el día. Escrituras adicionales tremendas, acerca de nuestra tan especial esperanza como creyentes cristianos renacidos, se encuentran en 2 Tes 2:1-17.
Fernando Castro-Chavez updated his status.
Mariana, Dios jamás da fechas. La Biblia dice que los que aceptamos de corazón a Jesucristo como Nuestro Señor (Rom. 10:9-10), él nos va a rescatar de este mundo (1 Tes 4:13-18; 1 Cor. 15:20-23, 42-58) y ya que nos hayamos ido de aquí, todo mal predicho en el Apocalipsis se va a desatar por 7 años sin que nadie lo detenga… hasta que regresemos con Cristo a recuperar nuestra heredad!
Fernando Castro-Chavez wrote on Luis Ruiz's timeline.
Luis Ruiz, felicitándote por tu graduación!
Fernando Castro-Chavez wrote on Ofrm Gabby's timeline.
Estimada Gaby, felicidades en tu graduación de hoy!
Fernando Castro-Chavez updated his status.
Querida Aby, la fórmula se representa E=mc^2 ej., si proyectas un lápiz (m: masa) a la velocidad de la luz (300,000 Km/seg) al cuadrado (^2), el lápiz se desintegra y se convierte en energía (E), como bomba atómica; pero si la despejas como Einstein la publicó obtienes E/c^2=m ej., si comprimes E por todos lados con la fuerza de c^2 obtienes m, representación del proceso creador de Dios de Gén. 1:1
Acaso alguien tiene escaneado este libro?
http://www.todocoleccion.net/libro-oro-estampas-biblia-novaro-completo~x26275402
Me interesa mucho para mis sobrinos y fue mi favorito de cuando yo era niño.
http://www.todocoleccion.net/libro-oro-estampas-biblia-novaro-completo~x26275402
Me interesa mucho para mis sobrinos y fue mi favorito de cuando yo era niño.
Updated Jun 20, 2011, 8:24 AM
Fernando Castro-Chavez updated his status.
Yesterday I went to Fellowship and Annette did the teaching on how a wonderful Father we have! For all of you that are fathers, to value the incomparable treasure that you have, congratulations. I talked with wonderful believers about the edifying original writing of Einstein's most famous formula: E/c^2 = m
Fernando Castro-Chavez updated his status.
More: FB lied when it said, putting my pic (some'll remember), saying that I used one of their "systems" to "find" more friends - I never used it! Before, I had 50 email 'friend' requests for me to join FB, was that FB's strategy? FB may be ab-'using' your ID... but let's use this site to glorify God as an extended FELLOWSHIP of the saints! You better be a nice & clever "Jack Hodgins"! (smile).
Ava, June, Dianne, Daniela, Cesar, Luz, Cooper, I like personal words, not impersonal Q&A's. I told Henry: "if you want to know anything about me, ask me directly". Reason: Hackers plant confusion by impersonal games at a click's distance. Maybe happened to students Grano, S. Flores... I hope they still be my friends, sorry! i.e.: "Don’t Fall": http://blog.alexanderhiggins.com/2011/06/13/hackers-facebook-26511
Updated Jun 16, 2011, 8:35 AM
El Dr. Cruz-Mireles nos comparte: "La Biblioteca Británica, gracias al apoyo de la Fundación Stavros Niarchos (http://www.snf.org/) está por terminar la digitalización de TODOS sus manuscritos griegos. Este viernes colocó en su sitio web otros 25 (que se añaden a los 284 ya disponibles) que van de los siglos VI al XVII d.C. Además de diversos manuscritos del Antiguo y Nuevo Testamento, también hay algunos de autores
Updated Jun 15, 2011, 10:23 AM
El Dr. Raúl escribió: "Desde hace 10 días TODOS los libros y reportes publicados por las Academias Nacionales de los Estados Unidos (la Academia Nacional de Ciencias, la Academia Nacional de Ingeniería, El Instituto de Medicina y el Consejo Nacional de Investigación) se pueden descargar gratuitamente desde su sitio web. Son más de 4 mil, algunos excepcionales:"
Updated Jun 13, 2011, 5:03 PM
Raymond Thomas said: "Hi Family, I just read this on FB. Many of you know Jai, he's our brother from UK"
Updated Jun 10, 2011, 5:49 PM
Estimado Hazael:
"Motivado por el interés y las preguntas de mi amado hermano en Cristo a quien conocí en Mérida, Yucatán cuando le pedí a Dios el poder convivir con un creyente con un amor inquebrantable hacia Él...:
http://fdocc.ucoz.com/clase.zip (1.87 MB)"
Con todo respeto sigo orando en lenguas por tí y por los tuyos.
"Motivado por el interés y las preguntas de mi amado hermano en Cristo a quien conocí en Mérida, Yucatán cuando le pedí a Dios el poder convivir con un creyente con un amor inquebrantable hacia Él...:
http://fdocc.ucoz.com/clase.zip (1.87 MB)"
Con todo respeto sigo orando en lenguas por tí y por los tuyos.
Updated Jun 6, 2011, 9:31 AM
Raúl, feliz llegada al mundo! Te comparto una de esas frases que me hacen pensar: "Casi todos los días, mi verdadera batalla es entre hacer el bien o no hacer nada." Deirdre Sullivan [Foto de la autora: http://thisibelieve.org/media/essayists/tib-sullivand-8-200.jpg]
Updated Jun 3, 2011, 12:12 PM
Un regalo de cumpleaños para mi primer verdadero maestro en los asuntos espirituales: el libro de William J. Larkin “Ephesians: A Handbook on the Greek Text” (Baylor Handbook on the Greek New Testament, Baylor University Press, Waco, 2009). ¡Que lo exprimas, amado Fernando, y que te regocijes en nuestro Padre como Él se regocija en nosotros!
Updated May 31, 2011, 8:26 AM
This "Memorial Day", remember America as an Eagle in the sky, and pray for it to soar FREE with the help of God once more: http://www.pbase.com/mlndsy/image/123335834
From the amazing bird album of my brother in Christ Michael Lindsey.
From the amazing bird album of my brother in Christ Michael Lindsey.
Updated May 27, 2011, 12:34 PM
This is my recent biosketch at the Optical Coherence Tomography website:
http://www.octnews.org/entity/profile/fernando-castro-chavez
Thanks to Dr. Larin and Dr. Ghosn.
http://www.octnews.org/entity/profile/fernando-castro-chavez
Thanks to Dr. Larin and Dr. Ghosn.
Updated May 24, 2011, 9:43 AM
Updated May 24, 2011, 9:35 AM
Updated May 24, 2011, 9:27 AM
Updated May 23, 2011, 10:03 AM
New @ "Braking Zionism Today": http://vsthe36syd.blogspot.com/2011/05/brother-take-back-america-please-rescue.html
Updated May 20, 2011, 5:46 PM
Gracias Mercedes, Lisa y Aída. Hablando de astrofísica, nuestro macro-universo y del espacio exterior, esto es lo que he escrito en español e inglés, espero les guste: "Las Aguas que Están Sobre los Cielo" http://fdocc.ucoz.com/index/agua_en_marte_y_en_la_luna/0-81 "The Bible Says That There is Water Outside our Circumscribed Universe": http://fdocc.ucoz.com/index/water_outside_our_universe_1/0-102
Updated May 17, 2011, 7:32 AM
I was introduced by Margaret West & by my wife to Peter Max. We talked about molecular biology while he told me about his fascination with the atomic micro-universes, his second scientific love after astrophysics, the macro-universe! http://www.petermax.com/ Last year they visited his studio in New York. He signed our "Yellow Submarine" booklet while talking about such 60's enterprise.
Updated May 15, 2011, 11:41 PM
The "Bone Disease Program" accepted the poster of my work to be presented today at their Scientific Retreat: http://www.bcm.edu/boneprogram
Updated May 6, 2011, 8:13 AM
Today, Glauco R. Souza, one of the inventors of the 3D Cell Culture by Magnetic Levitation is presenting a Seminar at 12:00 [organizer, Dr. Morrisett]: http://www.n3dbio.com/about/the-technology/our-team/firstname-lastname
Updated May 5, 2011, 8:11 AM
Raúl señala que un grupo de casi 400 científicos publicó el martes en PLoS Biology (http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001046#fn1)
un artículo sobre el proyecto ´ENCODE´, enciclopedia gratuita en
línea que identifica y ofrece información conocida sobre cada
elemento “funcional” del genoma humano:
un artículo sobre el proyecto ´ENCODE´, enciclopedia gratuita en
línea que identifica y ofrece información conocida sobre cada
elemento “funcional” del genoma humano:
Updated Apr 25, 2011, 10:41 PM
Last month, Michael Lindsey took pictures from India, near the Himalayas, different places, peoples and cultures but the same heart for God!: http://www.pbase.com/mlndsy/image/133707780
Updated Apr 25, 2011, 8:48 AM
Updated Apr 18, 2011, 7:59 AM
Para Hazael y para los que aman a Dios con TODO su corazón, en mi Web he agregado las notas de la clase de Houk que he traducido (http://fdocc.ucoz.com/clase.zip 1.87 MB): http://fdocc.ucoz.com/ , así como sus melodías relacionadas (Que hermoso es, Al despertar, Renacido, Que cambio...)
Updated Apr 13, 2011, 4:39 PM
Desde luego, la datación es siempre algo bastante muy dudoso, yo diría que de un mamut de unos cuatro mil años de antiguedad... pero lo importante es que por primera vez se ha podido aislar una de sus proteínas.
Updated Apr 11, 2011, 4:54 PM
Place: New Orleans Ernest N. Morial Convention Center (29.941064456101, -90.063643455505)
Address: 900 Convention Center Blvd, New Orleans, LA 70130
Linda invited us to the "Opera in the Heights" to see "The Pearl Fishers" by Georges Bizet; Yoonsang Lee's role was excellent. Last week, I went to the Seminar "Mutations in Embryogenesis", by Joris Vermeesch from Belgium. I'm praying for our friend in Japan: Kayano & family, and here, for April Gallop: http://www.heraldonline.com/2011/03/23/2932008/amidst-growing-world-doubts-about.html
Updated Mar 25, 2011, 12:21 PM
Thoughts for a Christian. E. W. Bullinger wrote: "...the "Strong One" will not be with them. There will be reformation without repentance. The unclean spirit will return with other spirits more wicked than himself, and they will enter in and dwell there, and the last state will be worse than the first". Another important thing to pray in the spirit: http://vsthe36syd.blogspot.com/
Updated Mar 17, 2011, 8:05 PM
Here is a worldwide news site covering what is going on in Japan: http://whatreallyhappened.com/
Updated Mar 15, 2011, 8:24 AM
Anne Boleyn's personal copy of Tyndale's New Testament (Antwerp, 1534):
http://www.bollyn.com/the-english-bible
"...to place the Word of God among the people because of the love and affection which I bear for the Gospel and the truth of Christ’s words" (George Boleyn’s scaffold speech, 17 May 1536).
Please, read that whole site to fulfill your Eph. 5:11, 2 Thess. 2:6-7 and your 1 Jn. 1:5-7. Thanks!
http://www.bollyn.com/the-english-bible
"...to place the Word of God among the people because of the love and affection which I bear for the Gospel and the truth of Christ’s words" (George Boleyn’s scaffold speech, 17 May 1536).
Please, read that whole site to fulfill your Eph. 5:11, 2 Thess. 2:6-7 and your 1 Jn. 1:5-7. Thanks!
Updated Mar 15, 2011, 7:36 AM
Updated Mar 14, 2011, 8:17 AM
http://www.molecularimaging.org/2006electionresults.php Roger Y. Tsien, a down-to-earth Nobel Prize in Chemistry (2008) presented: "Synthetic Molecules and Nanoparticles to Image Tumors, Atherosclerosis, Stroke and Nerves". I told him about our autofluorescence project. 'Big Pharma' won't sponsor his 'early detection' protocols because: "there is no money on that", they said.
Updated Mar 11, 2011, 3:21 PM
Prof. Zahi A. Fayad presented: "Molecular Imaging and Nanomedicine". I did read: "PET can visualize tracer amounts of radiolabeled molecules". Strontium-90 (90^Sr) has a 1/2 life of ~29 years, experiencing beta decay, which was twice as normal on the 9/11 WTC. Bioavailable leachate was obtained from WTC's toxic dust, showing high levels of Sr: http://pubs.usgs.gov/of/2001/ofr-01-0429/leach1/wtcleachfig1_11-1.gif
Updated Mar 10, 2011, 4:37 PM
Updated Mar 7, 2011, 9:56 AM
Yesterday, the hard work of our dear graduate student Randy Crossland
http://www.bcm.edu/physio/graduate/index.cfm?PMID=6768
was presented by his Professor, Robert Bryan Ph.D.: "Obstructive Sleep Apnea: Cardiovascular Consequences in a New Animal Model". Good sleep and oxygenation, plus diet and exercise may also prevent obesity.
http://www.bcm.edu/physio/graduate/index.cfm?PMID=6768
was presented by his Professor, Robert Bryan Ph.D.: "Obstructive Sleep Apnea: Cardiovascular Consequences in a New Animal Model". Good sleep and oxygenation, plus diet and exercise may also prevent obesity.
Updated Mar 4, 2011, 11:28 AM
Avanzadas tecnologías fueron usadas en la destrucción de las torres gemelas: Nanotubos de carbono en pulmones de voluntarios: http://911stealth.blogspot.com/2011/02/911-carbon-nanotubes.html Vanadio evaporado (3,480°C), altas temperaturas en los escombros: https://e-reports-ext.llnl.gov/pdf/305393.pdf
Updated Mar 2, 2011, 8:52 AM
Rocker, keyboardist Audrey Marie Marrs and software entrepreneur Charles Henry Ferguson won the Oscar to 2010's 'Best Documentary'. Congratulations and please, keep up your Hard-Ware! http://washingtonexaminer.com/news/2011/02/oscar-winners-hit-union-busting-bank-bigwigs
Updated Feb 28, 2011, 11:59 AM
"The role of the cardiomyocyte circadian clock", by David J. Durgan; keep a uniform daily biological clock for your health! We had an "Apples to Apples" game night (Feb. 5) after our meal honoring Margaret West. Ellen Anderson, Tenn. sister-in-law helped, Ava won! The Rogers invited us to a delicious 'super-bowl' BBQ! "Perspectives in History and Art" by R. E. Greenspan (Feb 2): http://medicalhistoryandart.com/
Updated Feb 25, 2011, 7:57 PM
Estimada sobrina Daniela, espero te encuentres bien de salud. Una investigadora del Baylor, donde trabajo, hizo la siguiente parodia para expresar su gran angustia al no obtener resultados con los "Western Blot":
http://www.youtube.com/watch?v=Fl4L4M8m4d0
http://www.youtube.com/watch?v=Fl4L4M8m4d0
Updated Feb 18, 2011, 3:45 PM
Updated Feb 11, 2011, 1:33 PM
Fernando Castro-Chavez updated his status.
Yesterday I had a Seminar by Keith A. Youker on "Heart Failure Research: Of Mice and Men". It was very impressive to see how before heart failure, there is a very clear immunological message that is sent (IgG). The heart says: "Help me, help me!" We just need to be able to hear it on time. Happy Valentine's!
Algo importante que hemos de recordar:
http://www.expresionespiritual.org/biblioteca/0091-Al-que-Detiene-al-Anticristo.html
http://www.expresionespiritual.org/biblioteca/0091-Al-que-Detiene-al-Anticristo.html
Updated Feb 3, 2011, 1:52 PM
Fernando Castro-Chavez posted on a timeline.
Feb 3, 2011, 8:58 AM
Updated Jan 25, 2011, 7:49 PM
Updated Jan 25, 2011, 9:50 AM
Tomorrow's Seminar by Johnny Chen on 'Small Diameter Vascular Grafts & Tissue Engineering'. Last week's one was 'Assessment of Molecular Permeability in Cardiovascular Tissue with Optical Coherence Tomography' by Mohamad Ghosn, who invited me to collaborate in one of his works: http://spie.org/app/program/index.cfm?fuseaction=conferencedetail&conference_id=927642&event_id=894270&list=1&abstracts=1
Updated Jan 19, 2011, 4:00 PM
Fernando Castro-Chavez updated his status.
Ready to celebrate Thanksgiving Day tomorrow ? It's a nice time to recover strengths to continue working hard next week! Please, this patriotic time, remember to check the link I posted on Nov. 11, thanks!
Fernando Castro-Chavez updated his status.
Dr. Sekhar presented actually "Role of Glutathione (plus Gly & Cys) on Oxidative Stress and Energy Metabolism in Aging". With family we celebrated our Veterans at "Pappasito's", we pray for the First Responders (please, see my yesterday's link).
Rajagopal Sehkcar presents "HIV associated lipodystrophy". Remember our first respondents! http://www.youtube.com/biosemiotician
Updated Nov 11, 2010, 11:25 AM
Fernando Castro-Chavez updated his status.
Miguel Cruz presented his “Recent Advances in Thrombosis Research”
Today, Craig J. Hartley presented "LM CFR as an Index of Cardiac Function" & yesterday Huaizhu Wu talked about macrophages and atherosclerosis. When I am under pressure (or always), I pray in the spirit! http://fertra1.blogspot.com/2009/09/weve-got-power-to-heal.html
Updated Oct 28, 2010, 1:46 PM
Fernando Castro-Chavez updated his status.
Dipan J. Shah presented "Cardiac Magnetic Resonance Imaging", today's article related to my Water on the Moon 1996 research in Mexico (smile):
http://www.chron.com/disp/story.mpl/ap/science/7258556.html
http://www.chron.com/disp/story.mpl/ap/science/7258556.html
Fernando Castro-Chavez updated his status.
Ariel Brautbar exposed the genetics of lipid disorders while Peter Jones did it for HDL.
Fernando Castro-Chavez updated his status.
"Importance of complete personal genome sequences", Richard Gibbs, "Exome sequencing identifies a familial combined hypolipidemia, novel mendelian disorder", James Pirruccello. Plus David Reich, Matt Stephens, Bryan Howie, Chris Carlson, Rasmus Nielson & Amy McGuire...
Fernando Castro-Chavez updated his status.
Today Ron C. Hoogeveen presented his advances on the cardiac Troponin risk factor research. Males are more prone to die of a "broken heart"; meanwhile, magnetite is acting as a "growth factor" (smile).
Fernando Castro-Chavez updated his status.
Ayer fuimos al concierto de la "Vienna Strauss Orchestra" que dirigió el ganante de un Emmy, Edvin Marton, quien tocó el violín con gran destreza, incluyendo "Sobre las Olas" y "Cielito Lindo".
Fernando Castro-Chavez updated his status.
Zhechao Merry Ruan presented her progress in the Osteoarthritis research while Brian Dawson introduced the MicroCT Core's 2 new systems. Dr. Christie M. Ballantyne presented “Management of LDL Cholesterol” on Wednesday.
Fernando Castro-Chavez updated his status.
“Current Status of AVM Trials Using MRI for Surrogate Endpoints” is Dr. Morrisett's Seminar. On 9/11, I choose: http://www.cortright.org/revsign.htm
Fernando Castro-Chavez updated his status.
Today, I celebrate with my Tracy our 9th wedding anniversary! God is very good, I still have a year long job and today I'm applying for my new grant! Thanks to Dr. Joel D. Morrisett we are celebrating with a big smile on our face!
Fernando Castro-Chavez updated his status.
Hoy, nuestro colega Gerd Brunner presenta el Seminario: “Quantitative Analysis of Lower Extremity Peripheral Artery Disease using Magnetic Resonance Imaging”. Margarita Gonzalez Barroso se interesa en encontrar la cura para el DBA por su niño.
Fernando Castro-Chavez updated his status.
Hoy, clase sobre "Platelets in Thrombosis, lesson learned from Thrombotic Thrombocytopenic Purpura (TTP)". Margarita me contactó, está muy interesada en encontrar la cura para la "Diamond-Blackfan anemia" (DBA).
Fernando Castro-Chavez updated his status.
Busy weekend, Saturday's work, then a 6 hour Sunday's trip with the kids... Thanks to my wife Tracy!!!
Fernando Castro-Chavez updated his status.
Yesterday, "HDL-cholesterol", today a Seminar on "HIV lipodystrophy" by Ashok Balasubramanyam MD. I'm working on improving the videos of my "Frozen Experiment".
Taffet habló de lo nuevo en Renina-Angiotensina, en el Club, sobre la controversia de Gotto, yo hablé con Khidir acerca del transcrito de mi alumna Elvia Beatriz, relacionado con "cuerpo, alma y espíritu": http://fdocc.ucoz.com/index/victor_paul_wierwille/0-7
Updated Aug 6, 2010, 8:25 AM
Fernando Castro-Chavez updated his status.
My Tracy is getting better; we had a Poirot weekend; now, working hard to improve some images for our next article.
Mi libro favorito de cuando era niño, el que tenía con mis primeros colores lo regalé a sobrinos 2ndos. en alta estima. Ojalá y alguien lo tuviera y escaneara para pasarle copias electrónicas a mis queridos pequeños sobrinos 1eros.: No. 27 Un Libro de Oro de Estampas de la Biblia. Editorial Novaro. Los temas principales del Antiguo y Nuevo Testamento en 48 estampas a todo color, complementadas con historias y dibujos para iluminar. Usado lo venden en Europa a 54.99 euros = 71.7894 US dólares
http://www.todocoleccion.net/n-27-un-libro-oro-estampas-biblia-editorial-novaro-completo~x17466833
La Wiki, acerca de Editorial Novaro: http://es.wikipedia.org/wiki/Editorial_Novaro
http://www.todocoleccion.net/n-27-un-libro-oro-estampas-biblia-editorial-novaro-completo~x17466833
La Wiki, acerca de Editorial Novaro: http://es.wikipedia.org/wiki/Editorial_Novaro
Updated Jul 30, 2010, 4:11 PM
Yesterday, seminar by Rebecca Reeves & John Foreyt. Eating breakfast is good and a diet change ("Slim Fast" is good), this solves sleep apnea: http://tinyurl.com/22txzxn
Updated Jul 30, 2010, 10:19 AM
Fernando Castro-Chavez updated his status.
Today, at Bistro Alex with a fellow-laborer; ah, and I wish an “Olympus FL LCV-110” microscope or similar for my next experiments!!! (smile).
Tremendous weekend, went to 'McCormick & Schmick's', to the 'Houston Museum of Natural Science' & to 'Two Rows' with the family!!! Saw petrified wood, evidence of The Floods: http://tinyurl.com/266ey6f
Updated Jul 26, 2010, 12:22 PM
Fernando Castro-Chavez updated his status.
Busy, working 'pain-filled' Westerns; tomorrow, a Seminar entitled: “Genetics to improve cardiovascular medicine: From population studies to clinical therapy”, but today, some exercise with my lovely wife at the "Chancellors".
Fernando Castro-Chavez updated his status.
Busy, Huaizhu Wu presented "Hyperlipidemia, Monocytes, and Atherosclerosis" & Inder Verma "Cancer: A Malady of Genes". Tomorrow, a Carotid Study. My study on "The Dog Variation"; prehispanic "goat sucker" (chupacabras) dogs found at Hood County, Texas, included (smile): http://fdocc.blogspot.com/2005/12/dog-variation.html
Fernando Castro-Chavez updated his status.
Went to my dear Chief Leah's ceremony and to South Beach. Now, time to get back to work!
Fernando Castro-Chavez updated his status.
14th and last day of this project, basically it is complete. I thank God for his miracles! Also, thanks to my 224 friends!
Estimada Damaris, ¿cómo estás?, ¿cómo te fue de fin de semana? Aquí nosotros estuvimos en un evento de música, danza y ópera China, un ejemplo: http://www.lagunajournal.com/Guyun_Michelle_jump%5B1%5D.jpg
Luego celebramos la independencia de los Estados Unidos.
Tus fotos se le hicieron muy bonitas a mi esposa. Entre las que seleccioné están la del sombrero púrpura, la de las dos palmeras, la de las tejas con bufanda morada, la del sombrero blanco, la del cachorro, la del pelo rojo con reja y camioneta roja, la 9 a las 8:28PM... Bueno, ¡Qué tengas una gran semana! Con toda mi estimación. Fernando.
Luego celebramos la independencia de los Estados Unidos.
Tus fotos se le hicieron muy bonitas a mi esposa. Entre las que seleccioné están la del sombrero púrpura, la de las dos palmeras, la de las tejas con bufanda morada, la del sombrero blanco, la del cachorro, la del pelo rojo con reja y camioneta roja, la 9 a las 8:28PM... Bueno, ¡Qué tengas una gran semana! Con toda mi estimación. Fernando.
Updated Jul 5, 2010, 9:34 AM
Fernando Castro-Chavez updated his status.
13th day, weekend: Shen Yun at the Wortham, then to Denis' Seafood, then a Capitol 4th in PBS. Today: working to improve the current manuscript.
Fernando Castro-Chavez updated his status.
12th day, a rainy day, to optimize the green wavelength; weekend is here, to start translating into Spanish one chapter of an enlightening class on the Scriptures.
Fernando Castro-Chavez updated his status.
11th day, extreme UV and IR Ex/Em are hard to track. Eric Yang is going to present a Seminar on ultrasound to detect arterial hardening: "Sound advice: Don't be so stiff."
Día 11, los extremos ultravioleta e infrarrojo son difíciles de perseguir. Seminario sobre ultrasonido para detectar el endurecimiento arterial (ver arriba).
Día 11, los extremos ultravioleta e infrarrojo son difíciles de perseguir. Seminario sobre ultrasonido para detectar el endurecimiento arterial (ver arriba).
Fernando Castro-Chavez updated his status.
10th day, while I take pictures of the invisible universe, I wish to mention my 3 students also acknowledged at my June J.T.B. article: Ed, Stefano and Mario Alberto, thank you for being an inspiration to me!
Día 10, mientras sigo tomado fotos del universo invisible, quisiera mencionar a mis 3 alumnos que también reconocí en mi artículo de Junio (mencionados arriba): ¡Gracias por ser una inspiración para mí!
Día 10, mientras sigo tomado fotos del universo invisible, quisiera mencionar a mis 3 alumnos que también reconocí en mi artículo de Junio (mencionados arriba): ¡Gracias por ser una inspiración para mí!
Fernando Castro-Chavez updated his status.
9th day. Natural fluorescence (i.e., sea fish), I need to detect its best Ex/Em wavelength. Currently, I don't know of an automatic system, so, I need to insert the values manually...
Día 9. Fluorescencia natural, necesito detectar su más óptima longitud de onda. Actualmente, desconozco de un sistema automático, así que lo he de hacer insertando manualmente los valores...
Día 9. Fluorescencia natural, necesito detectar su más óptima longitud de onda. Actualmente, desconozco de un sistema automático, así que lo he de hacer insertando manualmente los valores...
Fernando Castro-Chavez updated his status.
8th day. Yesterday at Galveston (Casey's & Moody Gardens); today, to design the experiments for a new project, to read carefully the methodology.
Octavo día, ayer en la rivera de Galveston, hoy a diseñar experimentos para un nuevo proyecto, a leer cuidadosamente los métodos...
Octavo día, ayer en la rivera de Galveston, hoy a diseñar experimentos para un nuevo proyecto, a leer cuidadosamente los métodos...
7th (work) day: To study my results for the backbone of a publication. I'm mind-boggled by the beauty of fractals secreted by our cells. My conversation this week with Justin Vance at: http://fdocc.blogspot.com/2006/01/cichlid-variation.html
Séptimo día de trabajo, estudiar los resultados e integrar el armazón de un artículo. Es exorbitante el ver la belleza de los fractales secretados por nuestras células. Diálogo con experto en peces (nexo anterior), quizá le interese a Linda Jireh Mora.
Séptimo día de trabajo, estudiar los resultados e integrar el armazón de un artículo. Es exorbitante el ver la belleza de los fractales secretados por nuestras células. Diálogo con experto en peces (nexo anterior), quizá le interese a Linda Jireh Mora.
Updated Jun 25, 2010, 11:31 AM
Fernando Castro-Chavez updated his status.
6th day. Seminar on fatty liver, more experiments with inorganic controls and fluorescence, more pictures of the microscopic universe, of fractals and more.
Sexto día. Seminario del hígado graso, más experimentos con controles inorgánicos y fluorescencia, mas fotos del universo microscópico, de fractales y más.
Sexto día. Seminario del hígado graso, más experimentos con controles inorgánicos y fluorescencia, mas fotos del universo microscópico, de fractales y más.
Fernando Castro-Chavez updated his status.
5th day. Dr. Joshua Wooten told me how to use the fluorescence detector. Glauco R. Souza provided his notable cell culture invention. Today I'll do data analysis.
5to día: el Dr. Josué me dijo como usar el detector de fluorescencia, el Dr. Glauco proporcionó su notable invento del cultivo celular; hoy voy a analizar los resultados.
5to día: el Dr. Josué me dijo como usar el detector de fluorescencia, el Dr. Glauco proporcionó su notable invento del cultivo celular; hoy voy a analizar los resultados.
Fernando Castro-Chavez updated his status.
4th day. It will be all about fluorescence, the backbone for an article proposing a new treatment for advanced atherosclerosis.
Cuarto día. Será todo acerca de fluorescencia, el armazón para un artículo proponiendo un nuevo tratamiento para el endurecimiento de las arterias.
Cuarto día. Será todo acerca de fluorescencia, el armazón para un artículo proponiendo un nuevo tratamiento para el endurecimiento de las arterias.
Fernando Castro-Chavez updated his status.
3rd (working) day since I started. 145 friends. Today, total protein extraction of controls (point of reference), seeding them in liquid Nitrogen to preserve them, new director...
Tercer día, 145 amigos. Hoy, extraigo proteínas de controles (siempre necesitamos un punto de referencia), plantarlas en Nitrógeno líquido para el futuro, nuevo director...
Tercer día, 145 amigos. Hoy, extraigo proteínas de controles (siempre necesitamos un punto de referencia), plantarlas en Nitrógeno líquido para el futuro, nuevo director...
Fernando Castro-Chavez updated his status.
2nd. day: Today, 18th of June at 11:00 AM I have 101 friends, thanks! Busy Friday, two protein extractions, four seedings for the liquid Nitrogen, to pick up fluorescent probes...
Segundo día: Hoy, 18 de Junio a las 11 tengo 101 amigos, gracias! Viernes activo, 2 extracciones de proteínas, 4 cultivos al N líquido, recoger sondas fluorescentes...
Segundo día: Hoy, 18 de Junio a las 11 tengo 101 amigos, gracias! Viernes activo, 2 extracciones de proteínas, 4 cultivos al N líquido, recoger sondas fluorescentes...
Fernando Castro-Chavez updated his status.
So, today 17th of June was my first day here. I ended up with 50 friends at 7:00 PM. Yahoo!
Hoy fue mi primer día aquí en Facebook (17-Jun-10), terminé el día con 50 amigos. Bravo!
Hoy fue mi primer día aquí en Facebook (17-Jun-10), terminé el día con 50 amigos. Bravo!