The web site of fdocc

Anticovidian v.2 COVID-19: Hypothesis of the Lab Origin Versus a Zoonotic Event which can also be of a Lab Origin: https://zenodo.org/record/3988139

AT LEAST SIX RESEARCH GROUPS HAVE FOUND HIV INSERTS IN SARS-CoV-2

An Updated Letter to Dr. Francis S. Collins,

Sir, Prompted by this article: Jun 25, 2020 – Health: The NIH claims joint ownership of Moderna's coronavirus vaccine: https://www.axios.com/moderna-nih-coronavirus-vaccine-ownership-agreements-22051c42-2dee-4b19-938d-099afd71f6a0.html (https://archive.vn/TArE3), I write to you, saying that we had a deep respect for you (my sister, my girl companion and my peers). The first letter I wrote to you was about Creation, in 2000, just having arrived from my country, and I wrote it in a bad English still, willing to live the American dream!!! Then, we saw you in person, and introduced ourselves, when you went to the BMC to give a speech about the Human Genome Project, I remember that you said something like: "Mendel is also there, in this slide, right there at the corner..."; then I wrote about our dreams to pursue, not only these Postdoctoral couple of jobs in Medicine, but also an MD Career, we two starting again from the scratch. Dreaming to be truthful and to really help humanity... However, now, I dedicate to you my current findings, humble, but nonetheless, they are still findings:

1) "COVID-19: AATGGTACTAAGAGG (NGTKR) = HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene (GU455503)". Finding also done by:

2) Shi Zheng-Li, from the WIV at Wuhan and co-author of Ralph Baric, and she distinctively calls it an "INSERTION" (she puts it as: GTNGTKR, GGGACCAATGGTACTAAGAGG, adding other two more, but skipping the key one: The Furin Site!), whose putative function is immunosuppressant, as she says that those INSERTIONS have: "sialic-acid-binding activity", at: Zhou, P., plus 27 et als & Zheng-Li Shi. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature 2020:579:270-73, & 16pp: https://www.nature.com/articles/s41586-020-2012-7.pdf; a third group that found these unique INSERTS is that of:

3) Sørensen (identical to the previous one: GTNGTKR, but also studying, to leave no doubts, its functional span by performing 6 by 6 NT iterations containing our sequence of interest (and of many others), such as: VSGTNG, SGTNGT, TNGTKR, NGTKRF, etc.), who says in an interview, as he found many more INSERTS (saved at: https://archive.vn/7TPTc): "The INSERTED sequences have a functionality that we describe. We explain why they are essential: ...accumulated charge from inserts and salt bridges are in surface positions capable of binding with cell membrane components other than the ACE2 receptor." This statement is very important and indicates that if we realize that this virus is NOT natural we could be and have been better prepared since the start to fight against it in a more logical, rational and prepared way, which did not happen. The artificiality of the virus also makes it unsuitable for vaccination, instead of the opposite, because that is the way the human tampering of nature works, the attempted purpose of its design is to do one thing, and it happens to result just the opposite thing than what was wanted: "...the naked coronavirus spike protein as a concept for the basis of a vaccine, which we have rejected because of high risk of contamination with human-like epitopes. Analysis of the Spike protein of SARS-CoV-2 shows 78.4% similarity with human-like (HL) epitopes..." and "... A search so tailored to match against all human known proteins will give a 78.4% human similarity to the SARS-CoV-2 Spike protein, i.e if all epitopes on the 1255 amino acid long SARS-CoV-2 Spike protein can be used by antibodies then there will be 983 antibody binding sites which also could bind to epitopes on human proteins..." The original article delving in all of those technicisms is: Sørensen, B., Susrud, A. and Dalgleish, A.G. Biovacc-19: A Candidate Vaccine for Covid-19 (SARS-CoV-2) Developed from Analysis of its General Method of Action for Infectivity. QRB Discovery (by Cambridge University Press) 2020:17 pp [Accepted Manuscript]: https://doi.org/10.1017/qrd.2020.8, so, this important article clearly indicates that if we do NOT realize the real origin and the real nature of this virus, we will continue deceived as per its treatment and its strategies of attack, and will be responsible for having on purpose dimmed the light of its artificial origin. Especially when we all are aware that the authors of "The Proximal…", Andersen et al. Nat. Med. 2020 article has been written by reefers that have ever been used for political purposes rather than scientific ones. So, apart as these three independent findings of that and many more related HIV sequences, we have another three sets of witnesses, totaling SIX independent groups finding this: Mine, Zheng-Li's, and Sørensen's, but also:

4) Pradhan, from the Indian group that was forced to withdraw its article, who calls the contained sequence under consideration as the previous ones: "INSERT 1": TNGTKR, elongating the set of meaningful nucleotides as: TCTGGGACCAATGGTACTAAGAGG (SGTNGTKR): Pradhan, P. et al. Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag. Biorxiv 2020: 14 pp. (Withdrawn, 128 comments): https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1, they start describing their findings as follows: "We found four new insertions in the protein of 2019-nCoV- “GTNGTKR” (IS1)...", but this is not all, but also a fifth group, being this the one integrated by:

5) Perez and Montagnier (2008 Nobel Prize in Medicine, precisely for his discovery of the HIV virus), and they describe our found sequence within, together with a couple of tens more: TCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTG (SGTNGTKRFDNP..., finding them in here, fragments of SIV joined to the HIV-1A that I found, and sown in point "1"), from these sequences found by them, they start and end their meaningful conclusions, coming from the wisest of men, as follows: "1) 18 RNA fragments of homology equal or more than 80% with human or simian retroviruses have been found in the COVID_19 genome; 2) These fragments are 18 to 30 nucleotides long and therefore have the potential to modify the gene expression of Covid19. We have named them external Informative Elements or EIE; 3) These EIE are not dispersed randomly, but are concentrated in a small part of the COVID_19 genome... ...everything converges towards possible laboratory manipulations which contributed to modifications of the genome of COVID_19, but also, very probably much older SARS, with perhaps this double objective of vaccine design and of "gain of function" in terms of penetration of this virus into the cell. This analysis, made in silico, is dedicated to the real authors of Coronavirus COVID_19. It belongs only to them to describe their own experiments and why it turned into a world disaster: 400 000 lives, more than those taken by the two atomic bombs of Hiroshima and Nagasaki. We, the survivors, should take lessons from this serious alert for the future of humanity. We urge our colleagues scientists and medical doctors to respect ethical rules as expressed by Hippocrates oath: do not harm, never and never!"; an earlier manuscript of them can be found at: Perez, J.-C., and Montagnier, L. COVID-19, SARS and Bats Coronaviruses Genomes Unexpected Exogenous RNA Sequences. ResearchGate & OSF 2020:43 pp. [Older Manuscript]: https://osf.io/d9e5g/download/?format=pdf. I started my letter saying that I used to have respect for you. However, the standing taken as to ignore the real origins documented by these five research groups and by countless others, of the whole pre-planning of the current Pandemic by COVID-19, has made me to change my current opinion about you.

6) Arumugham also discusses such “Artificial selection at work… via recombination with HIV-1 derived inserts and selecting the viruses for efficient human kidney cell infection”, and my comment is again that to notice this artificial origin of COVID-19 is very important to do the proper treatment to patients, and to prevent another thing like this from emerging out of a Gain of Function “research”: Arumugham, V. Root cause of COVID-19? Biotechnology’s dirty secret: Contamination. Bioinformatics evidence demonstrates that SARS-CoV-2 was created in a laboratory, unlikely to be a bioweapon but most likely a result of sloppy experiments. Zenodo 2020:9 pp. (Manuscript saved at: https://archive.vn/N79Ci): https://zenodo.org/record/3766463#.Xuu9RTpKjIW

My experience on finding human artifacts on genomes dates back to the EcoRI palindromic linker that is contaminating thousands of sequences in the Genbank: Castro-Chavez, F. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes. DNA Cell Biol. 2012, 31(2):151-63: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3272245/

The freedoms of the whole humanity are at stake and the good God The Creator that you deeply respect, has put you in a key position as to be able to revert as soon as possible the current decline of the human values, and of the human nature in general, and this all because of a deliberate release of the current Sars-CoV-2. 9/11 was the first False Flag Operation aimed at stealing as much freedoms as possible from the human race, and the Fake Anthrax Attack of 2001 had the same purpose, releasing a pre-planned and very antipatriotic document called the "Patriot" Act, which also included an immunity clause preventing the Pharmaceutical Industry of even more liabilities, but it was contested by the population, and it was removed. So, I wish to stop the GoF initiatives. Here we are today, contesting the "official" narrative of the current Plandemic as we did in the past with the “official” narratives of 9/11 when we discovered nano-bombs and both holographic and fake planes injected into the TV screens, impossible speeds for a 767 of 580 MPH, whose blurry patsies lived dissolute lives in Florida, where given passports by the CIA, and even their identities are questionable, as well as the fake aircraft evidence planted on the sites (like a wing motor that did not poke a hole on the pavement when falling? Go and tell those lies to the pretenders that envisioned such a deception, even the identities of the passengers and their fates are questionable, as that 9/11 black operation resembles the Operation Northwoods against Cuba, with fake identities for the presumed passengers…). I expect to publish this letter on the open after you have read it. Only history will tell if TRUTH was able to win on this time over darkness, or if the criminals will get away once more... With my same thinking as at the beginning of the current letter (but praying that this could very soon change),

Fernando Castro-Chavez, PhD.

P. S.

My ongoing work can be found at the ResearchGate, while many pieces of it have been removed from the Facebook and from the YouTube by some heartless and brainless censors appointed by the WHO and by their owner, Bill Gates, apparently the mastermind chosen by the globalists to pull this event of an artificially manufactured viral harm for the whole of humanity. But as Mordechai told to Esther: "If you do nothing about it, God will raise somebody else to redeem us of this plague, because our clamors for freedom and for justice have already reached the Heavens". Jesus said that it will not be so easy for the believers to overcome evil in the current times, but that it could be possible. As Christian believers, we believe that as long as we continue over the earth, the total fruition of the plans of darkness can NOT prosper, and you may be a key member of the Body of Christ in order to fulfill such restraining against the forces of evil of this world. Thus far, the next are some of the sequences that seem to be inserts (some of them seem to have been started to be tampered since the RaTG13 "experiment" of Shi Zheng-Li, a genome she had since 2013 but that she did not publish until 2020 after the first Sars-CoV-2 had been published in China, genome that of the RaTG13 (previously published in part twice with different names that included the number 4991, which is dishonesty in science to change the names of the sequences, and that is what Shi just did!) which has been used, ironically, even with all its methodological anomalies to, precisely attempt to undermine the artificiality of the inserts, even two sequences published earlier by the Military of China seem to have been already tampered to make them more infectious, this is what happens when you only have the sequences provided by them with nobody else corroborating their authenticity), so, I may use the "probable" inserts clause, mostly from HIV-1, some few from HIV-2 and one from SIV (as explained by Perez & Montagnier). So, the number of artificial sequences is growing as research progresses, that is why, when people tries to discredit some of these from being artificially made, the burden is over them to explain how all of them got INSERTED into one same viral genome, which may have required a same animal cell with multiple different viruses and even bacteria exchanging only the specific required portions and no more, which is something naturally implausible but completely possible within a lab setting:

1) In the the Nsp3 :

ACTGTTGGTCAACAAGACGGCAGTGAGGACAATCAGACAACTACTATTCAAACAATTGTT

And

CAAGTTGAACAAAAGATCGCT

Found by:

Arumugham, V. Root cause of COVID-19? Biotechnology’s dirty secret: Contamination. Bioinformatics evidence demonstrates that SARS-CoV-2 was created in a laboratory, unlikely to be a bioweapon but most likely a result of sloppy experiments. Zenodo 2020:9 pp. (Manuscript): https://zenodo.org/record/3766463#.Xuu9RTpKjIW, saved at: https://archive.vn/N79Ci

3) In Nsp4:

TGATTTTGACACATGGTTTA

4) In Nsp12:

ATTGTGCAAACTTTAATGTTTTATTCTCTACAGTGTTC

5) In Nsp15:

AATCACCTTTTGAATTAGAAGATTTTA_{TTCCTATGGACAGTACAGTTAAAAACTAT}

6) In Nsp16:

ATAAAGATAACAGAAC

And

7) ATGCGTCATCATCTGAAGCAT

And:

8) TGCAAATTACATATTTTG

And:

9) GATATGATTTTATCTCTTCTT

In the interface Nsp16 and S1 from Spike:

TTGTTAACAACTAAACGAACA_{ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCT}

In S1:

10) TTAATCTTACAACCAGAA

11) ACTTGTTCTTACCTTTCTTTTCCAATGT

12) TCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTG

13) TGTTTATTTTGCTTCCACTGAGAAGT

14) TTTTTGGTACTACTTT

15) CCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATT

16) CACAAAAACAACAAAAGT_TGGATG

17) _{AGAAGTTATTTGACTCCT}GGTGATTCTTCTTCAGGT

These last two and the 12th and the most important one, the 20, were found by the Indian team that was forced to withdraw:

Pradhan, P. et al. Uncanny similarity of unique inserts in the 2019-nCoV spike protein to HIV-1 gp120 and Gag. Biorxiv 2020: 14 pp. (Withdrawn, 128 comments): https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1

The sequences that appear underlined have been added as INSERTIONS in an article by the main suspect herself, Shi Zheng-Li (in the same article where she introduces the other, now being more clearly that has been a manipulated sequence, that of the RaTG13):

Zhou, P., plus 27 et als & Zheng-Li Shi. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature (Owned by CCP, China) 2020:579:270-73, & 16pp: https://www.nature.com/articles/s41586-020-2012-7.pdf

Most of the previous, and of the last ones, 20, 21 have also been found by:

Perez, J.-C., and Montagnier, L. COVID-19, SARS and Bats Coronaviruses Genomes Unexpected Exogenous RNA Sequences. ResearchGate & OSF 2020:43 pp. [Old Manuscript]: https://osf.io/d9e5g/download/?format=pdf

18) AACAATCTTGATTCTAAGGTT (from Plasmodium malariae)

Hong, S-T et al. The emergence of SARS-CoV-2 by an unusual genome reconstitution. ResearchSquare 2020 (Manuscript):8 pp.: https://assets.researchsquare.com/files/rs-33201/v1/d78e2bcc-91bd-4246-b4f8-63d2aa8602da.pdf

This particular one has been called into question as it also appears in a virus from pangolin sequence, but Petrovsky indicates that it or few pangolins could have been deliberately injected with a previous version of the final Sars-CoV-2, as it does not seem to be a localized but not an expanded situation for pangolins:

Piplani S., Singh P. K., Winkler D. A., Petrovsky N. In silico comparison of spike protein-ACE2 binding affinities across species; significance for the possible origin of the SARS-CoV-2 virus. Arxiv 2020:34 pp. (Manuscript): https://arxiv.org/ftp/arxiv/papers/2005/2005.06199.pdf

Again, when you have the word of it by only a group of scientists from China with a clear conflict of interests, such as to attempt to cover-up the situation, it is better to put in doubt their claims until independent findings on the wild could be made by other nations and researchers.

19) The precise location of the 18 bases, the 6 x 3 key regions of the RBD:

^TTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGT^TTTAATTGTTACTTTCCTTTA^CAATCATATGGTTTCCAACCCACT^AATGGTGTTGGT^TAC

Andersen, K. G., et al. The proximal origin of SARS-CoV-2. Nat. Med. 2020, 26:450–452: https://www.nature.com/articles/s41591-020-0820-9

This is basically a discredited article, a hit-piece done with the purpose to uphold a political view rather than to do science, all the authors of it have been found involved into enforcing a politically convenient scientific view, instead of in doing science, but at least they demonstrate the two basic anomalies, and say that all options are possible, but that their OPINION is..., so, that is basically an OPINION piece.

20) _CAGACTAATTCTCCTCGGCGGGCACGT

21) CACAAGTCAAACAAATTTACAAAACACCACCAATTAAAGAT_{TTTGGTGGTTTTAATTTTTCACAA} (in S2, two separate sequences interlaced from Plasmodium yoelii)...

So, that letter went non-responded, and worst, in a horrible “example” of corrupt censorship, the NIH PubMed do not only not published my previous article, but worse, they removed my last three articles that I had submitted to their database without putting any explanation for doing so whatsoever (this shows all the filth of Fauci and his very negative influence in science and in medicine, at the service of the globalists only but NOT to the normal citizens):

Message still not responded, sent on Mon, Mar 8 at 12:43 AM, Subject: "Request for my Three Last Papers to be Restored to PubMed as They Were Removed in a "Cancel Culture" Fashion":

"Dear Dr. Francis S. Collins,

This is like the third or fourth time that I had the honor to write to you. This time I wish to report that the "Cancel InCulture" reached my three most recent articles that were already at the PubMed, and were removed, I suppose, because they never explained to me the reason (or is it another dark, worst and "unspeakable" reason for them on doing that?), on the spurious basis that I published them after my grant ended, even if they are the continuation of work that I started BEFORE the end of my grant. I thought the most that could be obtained from one NIH grant, the best. Unfortunately, whoever removed my three articles that were already there do not think on that way…

These are the articles that were mercilessly removed from my set of articles, with the original numbers that they had, and where have they been saved:

1) Was at: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6716617/ (with appendixes also removed: https://web.archive.org/web/20190802004554/https://fdocc.yolasite.com/resources/fdocc-digram-code-2019-appendixes.pdf), saved at: https://web.archive.org/web/20200915205421/https:/webcache.googleusercontent.com/search?q=cache%3A2W-4jjmxlRIJ%3Ahttps%3A%2F%2Fwww.ncbi.nlm.nih.gov%2Fpmc%2Farticles%2FPMC6716617, or from the original site at: https://web.archive.org/web/20190817211325/https:/biomedres.us/pdfs/BJSTR.MS.ID.003413.pdf

2) Was at: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4828969/ (plus appendix, also removed from PubMed: https://web.archive.org/web/20190902190949/https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4828969/bin/NIHMS771056-supplement-Appendix.pdf), it has been saved at: https://web.archive.org/web/20180826192648/https:/www.ncbi.nlm.nih.gov/pmc/articles/PMC4828969/

3) This last one, was at: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4203674, and has been saved at: https://web.archive.org/web/20180826192523/https:/www.ncbi.nlm.nih.gov/pmc/articles/PMC4203674

(You even praised our efforts on striving us to have a better understanding of the Genetic Code due to precisely those removed papers, as you said in our previous communication; below).

This is the number of my grant: T32 HL-07812

I am also attaching here as P.S. the previous messages where they explained their "reasons" for removing my articles.

Would not be too much to ask you as still current director of the NIH for them to restore these, my three research articles, promising on my part to them not to upload any other article under the same grant ever due to their purported reasons for removing them? (Still searching for the best stable job, especially now that Dad died and I want to take care of Mom, at the same time that I want to formalize with my friend... Hopefully I could see you in person soon, as I am doing a tour with... through all the US during the month of August, praying to find the best place as per God; please, if possible pray for us!)

With my best regards,

Fernando Castro-Chavez, PhD.

P.S.

The last message from the PubMed:

Fri, Sep 18, 2020 at 3:15 PM

Dear Fernando Castro-Chavez,

Thank you for voicing your concerns. Your case is currently under review and we will get back to you shortly.

Thank you for your patience.

Regards,

Pierce

[My Note: But even when he wrote that, Pierce Smith or anybody else from the NIH went back to me never at all until this day!]

Pierce Smith

Customer Support Lead, Contractor

NIHMS | NCBI | NLM | NIH

Their reason given for removing my three articles (all of them with the same message, originally sent to me these emails separately each one, sent all of them on Thu, Sep 3, 2020, all the three of them sent exactly at 12:05 PM):

Dear NIHMS Customer,

"The Digram I Ching Genetic Code Compresses the Genetic Code into 24 Compatible Main Codons" (NIHMS1045332)

"ANATOMICAL MNEMONICS OF THE GENETIC CODE: A FUNCTIONAL ICOSAHEDRON AND THE VIGESIMAL SYSTEM OF THE MAYA TO REPRESENT THE TWENTY PROTEINOGENIC AMINO ACIDS" (NIHMS771056)

"File Compression and Expansion of the Genetic Code by the use of the Yin/Yang Directions to find its Sphered Cube" (NIHMS611184)

You are receiving this email because you are associated with the above-listed manuscript in the NIH Manuscript Submission (NIHMS) system. The manuscript has been withdrawn from PubMed Central (PMC) for the following:

[Note added in proof: Here for the three messages the reason for their removal has been left completely blank!]

As such, the PMCID (PMC6716617) previously assigned to this manuscript is no longer valid for reporting purposes.

As such, the PMCID (PMC4828969) previously assigned to this manuscript is no longer valid for reporting purposes.

As such, the PMCID (PMC4203674) previously assigned to this manuscript is no longer valid for reporting purposes.

For additional assistance, please reply to this email.

Thank you,

The NIHMS Help Desk

At that time I replied to them with the next message:

Dear Nihms help,

I will repeat this message three times as you sent me three times the removal of three of my articles from the PubMed database:

On my article(s, listed above):

I was unaware of the time limit to keep on working on a grant. It seems that my working and productivity is being curtailed by your decision to remove three of my works. Due that I did not know about that and nobody told me, I ask in the kindest way possible to have this and the other two articles that you removed to have then restored, with the understanding from now on not to work or to send absolutely nothing until that same grant. According to your response, I can also consult later on with Francis S. Collins, or you can do it yourself, as he is the one that in one of his eMail sentences, he started by praising my work that you have precisely unilaterally removed from me after being respectively standing during six, four and one year without any problem.

Collins wrote to me: “Collins, Francis (NIH/OD) [E] collinsf@od.nih.gov To: Fernando Castro-Chavez: fdocc@yahoo.com. Dec. 29, 2019, 5:50 PM. (The same day that his contribution against sickle cell anemia appeared on TV, in “60 minutes”). Hi Fernando, Thanks for your message. I am glad to know of the way in which you... (Then, also the names two of my collaborators) have been pursuing visions about contributing to medical advances... Francis S. Collins.

So, leaving the restoration of my three already there from a while until now articles unter PubMed, I await eagerly for your response.

So, with my Best for You, I also hope you could be able to help me on this. For that, I will be blessed and thankful.

Fernando Castro-Chavez, PhD.

Postdoc at BCM (where I meet you in person in the company of my sister)

And at the NYMC (one that I was unable to complete, due, I think, to the current pest that was already on the making)"